Application of piR-43452 simulant as new target in preparation of medicine for treating bladder cancer
Gene therapy using the piR-43452 mimic has addressed the issues of chemotherapy resistance and insufficient targeted therapy selection in bladder cancer, achieving inhibition of bladder cancer cell proliferation and migration, as well as improved chemosensitivity, thus providing a new treatment strategy.
Patent Information
- Application Number
- CN202610060625.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-16
- Publication Date
- 2026-02-13
AI Technical Summary
Currently, there are limited options for targeted therapy in the treatment of bladder cancer, severe chemotherapy resistance, and a lack of effective strategies to reverse chemotherapy resistance. The stability and targeted delivery efficiency of RNA therapy have not been effectively addressed.
Using piR-43452 mimics as a novel target, gene therapy mediated by lentiviruses aims to inhibit or enhance the proliferation and migration of bladder cancer cells and improve their sensitivity to gemcitabine chemotherapy. The drug can be formulated as an injection, a liposomal nanoparticle formulation, or a gene therapy formulation based on a virus/non-viral vector.
It significantly inhibits the proliferation and migration of bladder cancer cells, promotes apoptosis, and enhances chemosensitivity, providing a new treatment strategy for bladder cancer and an important means of screening new anti-bladder cancer drugs.
Smart Images

Figure CN121518657A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biological medicine, more particularly, it relates to the application of piR-43452 mimics as a new target in the preparation of drugs for treating bladder cancer. BACKGROUND
[0002] Bladder cancer is one of the most common malignant tumors of the urinary system worldwide, with high morbidity and mortality, posing a serious threat to public health. According to pathological characteristics, bladder cancer is mainly divided into non-muscular invasive bladder cancer and muscular invasive bladder cancer. For advanced or metastatic bladder cancer, gemcitabine combined with cisplatin is the standard first-line treatment. However, the inherent or acquired resistance of tumors to chemotherapy is the main reason for treatment failure and poor prognosis of patients. Currently, in addition to traditional chemotherapy and immune checkpoint inhibitors, the options for targeted therapy for bladder cancer are still limited. Therefore, in-depth exploration of the molecular mechanisms of bladder cancer development, identification of new therapeutic targets, and development of effective strategies to reverse chemotherapy resistance are key scientific problems that need to be solved in current clinical practice.
[0003] With the in-depth study of genomics, scientists have found that more than 90% of DNA in the human genome is transcribed, but only a small number of them encode proteins, and the vast majority of transcripts are non-coding RNAs. Non-coding RNAs, especially microRNAs and small interfering RNAs, have been shown to play a key role in gene expression regulation, and their dysfunction is closely related to a variety of diseases, including cancer. Non-coding RNA-based therapies, such as miRNA mimics or antisense oligonucleotides, have become a new frontier in drug development. Such therapies, by mimicking or inhibiting the function of endogenous RNA, achieve precise regulation of specific pathogenic genes at the post-transcriptional level, and show great therapeutic potential. However, the stability, targeted delivery efficiency, and off-target effects of RNA therapy are still major challenges in its clinical translation.
[0004] PIWI-interacting RNAs (piRNAs) are a class of small non-coding RNAs that specifically bind to the PIWI protein family, typically 24-35 nucleotides in length. piRNAs were initially discovered for their crucial role in silencing transposon elements in germ cells and maintaining genome stability. Recent breakthroughs have shown that piRNAs are widely expressed in various human somatic cells, including tumor cells, and play diverse functions beyond transposon silencing. They can deeply participate in the regulation of key biological processes such as cell proliferation, apoptosis, metabolism, and drug response by guiding PIWI protein complexes to perform transcriptional gene silencing (e.g., recruiting DNA methyltransferases and histone modifying enzymes) or post-transcriptional gene silencing (e.g., directly cleaving target mRNAs or promoting their degradation). Although increasing evidence suggests that piRNAs are aberrantly expressed in various cancers and function as proto-oncogenes or tumor suppressor genes, their specific roles, molecular mechanisms, and clinical applications in bladder cancer progression and chemotherapy resistance still require further in-depth and systematic elucidation. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide the application of piR-43452 mimics as a new target in the preparation of drugs for treating bladder cancer.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] Application of a piR-43452 mimic as a novel target in the preparation of drugs for treating bladder cancer.
[0008] The present invention is further configured such that the piR-43452 mimic is an RNA molecule having the nucleotide sequence shown in SEQ ID NO:1 or a chemically modified derivative thereof, or a pharmaceutically acceptable salt.
[0009] The present invention is further configured such that the drug is used to inhibit the proliferation, migration or invasion of bladder cancer cells.
[0010] The present invention is further configured such that the drug is used to promote apoptosis of bladder cancer cells.
[0011] The present invention is further configured such that the drug is used to enhance the chemosensitivity of bladder cancer cells to gemcitabine.
[0012] The present invention is further configured such that the dosage form of the drug is an injection, a liposome nanoparticle formulation, or a gene therapy formulation based on a virus / non-viral vector.
[0013] In summary, the present invention has the following beneficial effects:
[0014] The application first proposes and verifies that the piR-43452 mimic can be used as a new target for gene therapy of bladder cancer (after transfecting the piR-43452 mimic into bladder cancer cells, the proliferation and migration ability of the cells is significantly reduced, the apoptosis is increased, and the sensitivity to gemcitabine chemotherapy is significantly enhanced), which has important significance for screening new drugs against bladder cancer, and provides a new strategy for the treatment of bladder cancer. BRIEF DESCRIPTION OF DRAWINGS
[0015] Figure 1 Figure for testing the expression efficiency of piR-43452 of UM-UC-3 cells and J82 cells in the overexpression experiment group and the overexpression control group;
[0016] Figure 2 Figure for testing the knockdown efficiency of piR-43452 of UM-UC-3 cells and J82 cells in the knockdown experiment group and the knockdown control group;
[0017] Figure 3 Figure for detecting the effect of piR-43452 mimic on the migration of bladder cancer cells;
[0018] Figure 4 Figure for detecting the effect of piR-43452 knockdown on the migration of bladder cancer cells;
[0019] Figure 5 Figure for detecting the effect of piR-43452 mimic overexpression on the proliferation ability of bladder cancer cells;
[0020] Figure 6 Figure for detecting the effect of piR-43452 knockdown on the proliferation ability of bladder cancer cells;
[0021] Figure 7 Figure for detecting the sensitivity of J82 cells in the piR-43452 mimic overexpression experiment group and the overexpression control group to the chemotherapeutic drug gemcitabine;
[0022] Figure 8 Figure for detecting the sensitivity of J82 cells in the piR-43452 knockdown experiment group and the knockdown control group to the chemotherapeutic drug gemcitabine;
[0023] Figure 9 Figure for detecting the in vivo tumorigenicity of UM-UC-3 cells in the piR-43452 mimic overexpression experiment group and the overexpression control group. DETAILED DESCRIPTION
[0024] With reference to the accompanying drawings, the technical solutions in the embodiments of the present application will be described clearly and completely. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all the other embodiments obtained by those of ordinary skill in the art without creative work fall within the scope of the present application.
[0025] Example 1: Establishment of piR-43452 lentivirus stable overexpression cell line
[0026] (a) Synthesis and cloning:
[0027] According to the mature sequence UCCCCAAAACAAGCACAGUAGCCUGCACAGU (SEQ ID NO: 1) of piR-43452, a precursor DNA sequence of piR-43452 was chemically synthesized by Shanghai Qizun Biotechnology Co., Ltd., and appropriate enzyme digestion sites were introduced at both ends of the precursor DNA sequence.
[0028] By DNA recombination technology, the synthesized precursor sequence of piR-43452 was cloned into the multiple cloning site of the lentivirus expression vector pEZX-MR03 (the vector carries a green fluorescent protein (GFP) reporter gene and a puromycin resistance screening gene) by Shanghai Qizun Biotechnology Co., Ltd., to construct a recombinant plasmid piR-43452-mimics.
[0029] According to the complementary single strand of the mature sequence of piR-43452, an inhibitor sequence that competes with endogenous piR-43452 for binding and weakens the downstream effect of piR-43452 was designed and synthesized by Shanghai Qizun Biotechnology Co., Ltd., and a recombinant plasmid piR-43452-inhibitor for knocking down the function of piR-43452 was constructed.
[0030] (b) Virus packaging and harvesting:
[0031] The day before transfection, an appropriate amount of human embryonic kidney HEK293T cells were inoculated into Gibco Advanced DMEM medium containing 10 v / v% fetal bovine serum (No. 04-001-1ACS, Biological Industries) so that the cell density reached 70-80% the next day for transfection; fresh Gibco Advanced DMEM medium containing 10 v / v% fetal bovine serum was replaced before transfection; recombinant plasmid piR-43452-mimics was co-transfected with packaging plasmid into human embryonic kidney HEK293T cells using a jetPRIME® kit (Polyplus, USA, containing jetPRIME® reagent and jetPRIME® buffer); the packaging plasmid used in this example was psPAX2 and pMD2.G, the mass ratio of recombinant plasmid to pSPAX2, pMD2.G was 5:3:2, and the amount ratio of recombinant plasmid to jetPRIME® reagent, jetPRIME® buffer was 2 μg:4 μL:200 mL); the cell supernatant containing lentivirus particles was collected 48 hours after transfection and Gibco Advanced DMEM medium containing 10 v / v% fetal bovine serum was added for further culture, and the cell supernatant containing lentivirus particles was collected again 72 hours later, the two supernatants were combined, filtered to remove cell debris, and stored at -80°C, obtaining piR-43452 mimic expression virus concentrate. Using piR-43452-inhibitor plasmid and empty vector plasmid, piR-43452 knockdown virus concentrate and lentivirus concentrate carrying empty vector for control were obtained in the same way.
[0032] (c) Cell infection and stable screening:
[0033] Human bladder cancer cell lines UM-UC-3 and J82 were selected as target cells. Gibco Advanced MEM medium (catalog number 12492013, Thermo Fisher Scientific) containing 10 v / v% fetal bovine serum was added to two culture dishes, and appropriate amounts of UM-UC-3 and J82 bladder cancer cells were seeded into each dish. The cell density reached 30% the next day, and the medium was replaced with fresh Gibco Advanced MEM medium (catalog number 12492013, Thermo Fisher Scientific) containing 10 v / v% fetal bovine serum. The piR-43452 mimic expression virus concentrate prepared in step (b) was added to each dish (experimental group). The total volume of the expression virus concentrate and the Gibco Advanced MEM medium containing 10 v / v% fetal bovine serum was the same. Twelve hours after infection, the medium was replaced with Gibco Advanced MEM medium containing 10 v / v% fetal bovine serum. The cells were cultured in MEM medium for 72 hours after infection. Then, the medium was replaced with MEM medium containing 2 μg / mL puromycin and 10 v / v% fetal bovine serum for continuous screening. After 2 weeks (the screening time can be adjusted to 1-2 weeks as needed), stable overexpression cell lines were obtained, namely, the overexpression experimental groups UM-UC-3 cells and J82 cells. The lentivirus concentrate carrying the empty vector prepared in step (b) was used as a control for cell infection and stabilization screening, yielding the overexpression control group UM-UC-3 cells and J82 cells, respectively.
[0034] The piR-43452 knockdown virus concentrate prepared in step (b) was used to replace the piR-43452 mimic expression virus concentrate. Cell infection and stabilization screening were performed according to the above steps. The lentivirus concentrate carrying the empty vector prepared in step (b) was used as a control. UM-UC-3 cells and J82 cells in the knockdown experimental group and UM-UC-3 cells and J82 cells in the knockdown control group were obtained respectively.
[0035] Example 2: Determination of overexpression and knockdown efficiency (qRT-PCR)
[0036] Cells from the overexpression experimental group (UM-UC-3 and J82), the overexpression control group (UM-UC-3 and J82), the knockdown experimental group (UM-UC-3 and J82), and the knockdown control group (UM-UC-3 and J82) in Example 1 were collected and subjected to RNA extraction, reverse transcription, and quantitative PCR. The specific methods are as follows:
[0037] (1) RNA extraction:
[0038] Total RNA was extracted from cells using TRIzol reagent (catalog number 9108, Takara Biotech Ltd.) according to its instructions, and the RNA concentration and purity were determined by Nanodrop.
[0039] (2) Reverse transcription and quantitative PCR:
[0040] (i) The extracted total RNA was reverse transcribed into cDNA using miRNA 1st Strand cDNA Synthesis Kit (by stem-loop) (Cat. No. MR101-01 / 02, NuCyto Biosciences Co., Ltd.) with stem-loop specific primers. After reverse transcription, the reaction product was diluted to 60 ul with RNase-free water.
[0041] Specific primers were designed for reverse transcription of mature piR-43452 and internal reference U6 snRNA, and were synthesized by Shengong Biotech Co., Ltd. (Shanghai). The specific sequences are shown in Table 1.
[0042] Table 1
[0043]
[0044] The reverse transcription reaction system 1 is shown in Table 2, and the reaction conditions are: 42°C for 2 min.
[0045] Table 2 Reverse transcription reaction system 1
[0046]
[0047] The reverse transcription reaction system 2 is shown in Table 3, and the reaction conditions are: 25°C for 5 min, 50°C for 15 min, and 85°C for 5 min.
[0048] Table 3 Reverse transcription reaction system 2
[0049]
[0050] (ii) U6 snRNA was used as an internal reference gene; SYBR Green qPCR Master Mix was used for amplification reaction on a quantitative PCR instrument; the reaction program was: 95°C pre-denaturation for 5 min; then 95°C for 15 seconds, 60°C for 1 min, for a total of 40 cycles. The real-time PCR reaction system is shown in Table 4; the primers were synthesized by Shengong Biotech Co., Ltd. (Shanghai), and the specific sequences are shown in Table 5.
[0051] Table 4
[0052]
[0053] Table 5
[0054]
[0055] The 2^(-ΔΔCt) method was used to calculate the relative expression of piR-43452 in the overexpression experimental group relative to the overexpression control group and the relative expression in the knockdown experimental group relative to the knockdown control group. The results are shown in Figure 1 and Figure 2 As shown, the expression levels of piR-43452 in the UM-UC-3 cells and J82 cells of the overexpression experimental group were significantly up-regulated compared with the control group, and the expression levels of piR-43452 in the UM-UC-3 cells and J82 cells of the knockdown experimental group were significantly decreased, indicating that the stable overexpression and stable knockdown cell lines mediated by lentivirus were successfully constructed.
[0056] Example 3: Effect of piR-43452 on bladder cancer cell migration (Transwell experiment)
[0057] The logarithmic growth period of the overexpression experimental group UM-UC-3 cells and J82 cells, the overexpression control group UM-UC-3 cells and J82 cells, the knockdown experimental group UM-UC-3 cells and J82 cells, and the knockdown control group UM-UC-3 cells and J82 cells were taken, and the cells were prepared and inoculated, cultured and fixed, stained and counted, and the specific method was as follows:
[0058] (1) Cell preparation and inoculation:
[0059] The bladder cancer cells with a confluence of 70%-80%, i.e. in the logarithmic growth phase, were resuspended in serum-free Gibco Advanced MEM medium and the cell density was adjusted to 5.0×10 5 cells / mL; 200 μL of cell suspension (about 1.0×10 5 cells) was added to the upper chamber of the 24-well Transwell chamber, and 700 μL of Gibco Advanced MEM medium containing 10 v / v% fetal bovine serum was added to the lower chamber as a chemical attractant.
[0060] (2) Culture and fixation:
[0061] The culture plate was placed in a 37°C, 5% CO2 incubator for further culture for 24 hours; after the culture was completed, the chamber was carefully removed and the cells in the upper chamber that had not migrated were gently wiped off with a cotton swab; the chamber was placed in a 4 wt% paraformaldehyde solution and fixed at room temperature for 15 minutes.
[0062] (3) Staining and counting:
[0063] The cells that migrated to the bottom of the chamber were stained with 0.1 wt% crystal violet solution for 20 minutes; the chamber was gently rinsed with PBS and air-dried; under a stereomicroscope, 3 fields of view were randomly selected for photography, and the number of cells that crossed the polycarbonate membrane was counted.
[0064] Results as shown in Figure 3 and Figure 4 Compared with the control group, the number of cells migrating to the lower chamber in the overexpression experimental group was significantly reduced, while the number of cells migrating to the lower chamber in the knockdown experimental group was significantly increased. This indicates that overexpression of piR-43452 can effectively inhibit the migration and invasion ability of bladder cancer cells.
[0065] Example 4: Effect of piR-43452 on bladder cancer cell proliferation (CCK-8 method)
[0066] 4.1 In vitro proliferation experiment (CCK-8 method) and gemcitabine sensitivity detection
[0067] (A) Conventional proliferation detection:
[0068] Take the logarithmic growth phase of the overexpression experimental group UM-UC-3 cells and J82 cells, the overexpression control group UM-UC-3 cells and J82 cells, the knockdown experimental group UM-UC-3 cells and J82 cells, and the knockdown control group UM-UC-3 cells and J82 cells, respectively, and follow the steps below for detection:
[0069] Resuspend the cells to be tested into a single cell suspension with a cell density of 1 x 10 4 / mL with Gibco Advanced MEM medium containing 10 v / v% fetal bovine serum, and inoculate the cells into a 96-well plate at a density of 1000 cells / well (i.e. 100 μL / well). Set up 5 replicate wells, and after 0, 24, 48, 72, and 96 hours of culture, use the CCK-8 kit (item number CK04, Japan Tongren Chemical) to detect cell viability and draw a basic proliferation curve.
[0070] (B) Drug sensitivity detection:
[0071] Take the logarithmic growth phase of the overexpression experimental group J82 cells, the overexpression control group J82 cells, the knockdown experimental group J82 cells, and the knockdown control group J82 cells, respectively, and follow the steps below for detection:
[0072] Resuspend the cells to be tested into a single cell suspension with a cell density of 1 x 10 4 / mL of single cell suspension, cells were seeded in 96-well plates at a density of 1000 cells per well (i.e. 100 μL per well), cultured for 24 hours to adhere, then the cells were replaced with 10 v / v% fetal bovine serum in Gibco Advanced MEM medium containing a concentration gradient of 0, 0.8, 1.6, 3.2, 6.4 μM of gemcitabine powder (item number 95058-81-4, Shanghai Macklin Biochemical Technology Co., Ltd.) prepared, 5 replicate wells were set for each concentration; after continuing to culture for 48 hours, CCK-8 reagent was added and the absorbance was detected. The cell survival rate at each concentration was calculated, and the dose-effect curve was drawn, and the half inhibitory concentration (IC 50 ).
[0073] Results analysis: as shown in Figure 5 and Figure 6 , the proliferation rate of the experimental group cells was significantly lower than that of the control group under drug-free conditions. As shown in Figure 7 and Figure 8 , after gemcitabine treatment, the cell survival rate of the experimental group at each concentration was lower than that of the control group, and the IC 50 value was significantly lower than that of the control group. This indicates that overexpression of piR-43452 not only inhibits basal proliferation, but also significantly enhances the chemosensitivity of bladder cancer cells to gemcitabine.
[0074] 4.2 In vivo tumor formation experiment (nude mouse subcutaneous tumor model)
[0075] (1) Model construction and grouping:
[0076] Ten 4-6 week old male BALB / c nude mice were randomly divided into two groups (experimental group and control group), 5 in each group. The logarithmic growth phase piR-43452 mimic overexpression experimental group and overexpression control group UM-UC-3 cells were collected and resuspended with PBS to ensure cell viability. Each nude mouse was injected subcutaneously with 200 μL of the corresponding cell suspension (containing 5 x 10 6 cells) into the right axillary of the nude mouse, i.e. the experimental group of nude mice was injected with the overexpression experimental group UM-UC-3 cell suspension, and the control group of nude mice was injected with the overexpression control group UM-UC-3 cell suspension.
[0077] (2) Observation and measurement:
[0078] From the 7th day after inoculation, the long diameter (a) and short diameter (b) of the tumor were measured every 3 days with a vernier caliper, and the tumor volume was calculated according to the formula V = a x b2 / 2, and the observation was continued for 30 days. At the end of the experiment, the tumor mass was stripped, weighed and photographed.
[0079] (3) Data analysis:
[0080] The growth curve of tumor volume over time was plotted.
[0081] Results: As shown in Figure 9 the figure, the tumor volume and the final tumor weight of the experimental group were significantly smaller than those of the control group throughout the observation period. This in vivo experiment directly proves that overexpression of piR-43452 can effectively inhibit the in vivo tumorigenicity and growth ability of bladder cancer cells.
[0082] The piR-43452 mimics of the application can be a chemical modification derivative of the RNA molecule having the nucleotide sequence shown in SEQ ID NO: 1 or a pharmaceutically acceptable salt thereof; can be used for preparing a drug for treating bladder cancer (the dosage form of the drug is an injection, a liposome nanoparticle preparation or a gene therapy preparation based on a viral / non-viral carrier), inhibiting the proliferation, migration or invasion ability of bladder cancer cells, promoting the apoptosis of bladder cancer cells and enhancing the chemosensitivity of bladder cancer cells to gemcitabine.
[0083] The above only describes the preferred embodiments of the application, and the protection scope of the application is not limited to the above-described embodiments only. Any technical solution that belongs to the concept of the application shall fall within the protection scope of the application. It should be noted that, for ordinary skilled persons in the art, some improvements and refinements without departing from the principles of the application shall also be considered as falling within the protection scope of the application.
Claims
1. The application of a piR-43452 mimic as a novel target in the preparation of drugs for treating bladder cancer.
2. The application of a piR-43452 mimic as a novel target in the preparation of drugs for treating bladder cancer according to claim 1, characterized in that, The piR-43452 mimic is an RNA molecule having the nucleotide sequence shown in SEQ ID NO:1 or a chemically modified derivative thereof, or a pharmaceutically acceptable salt.
3. The application of a piR-43452 mimic as a novel target in the preparation of drugs for treating bladder cancer according to claim 1, characterized in that, The drug is used to inhibit the proliferation, migration, or invasion of bladder cancer cells.
4. The application of the piR-43452 mimicry as a novel target in the preparation of drugs for treating bladder cancer according to claim 1, characterized in that, The drug is used to promote apoptosis in bladder cancer cells.
5. The application of a piR-43452 mimic as a novel target in the preparation of drugs for treating bladder cancer according to claim 1, characterized in that, The drug is used to enhance the sensitivity of bladder cancer cells to gemcitabine chemotherapy.
6. The application of a piR-43452 mimic as a novel target in the preparation of drugs for treating bladder cancer according to claim 1, characterized in that, The drug is available in the form of an injection, a liposome nanoparticle formulation, or a gene therapy formulation based on a viral / non-viral vector.
Citation Information
Patent Citations
PiRNA biomarker related to bladder cancer and application thereof
CN103627705A