Novel Coronavirus Vaccines, Their Preparation Methods, and Applications

Abstract

This invention provides a novel coronavirus vaccine, its preparation method, and its application, relating to the technical field of vaccines. The novel coronavirus vaccine comprises nucleic acid molecules encoding the S protein of the Delta variant of the novel coronavirus and the S protein of the Omeprung variant of the novel coronavirus, making it a multivalent vaccine that alleviates the technical problem of poor protective efficacy against variant strains in existing novel coronavirus vaccines.

Description

Technical Field

[0001] This invention relates to the field of vaccine technology, and in particular to a novel coronavirus vaccine, its preparation method, and its application. Background Technology

[0002] The COVID-19 pandemic has caused enormous social and economic losses worldwide. The novel coronavirus is highly prone to mutation, and since its discovery, various strains have emerged, including the original strain, the Alpha strain, the Beta strain, the Gamma variant, the Kappa strain, the Delta strain, and the Omicron strain.

[0003] Currently marketed and most COVID-19 vaccines in clinical trials are designed with antigens targeting the original strain of the SARS-CoV-2 virus. Compared to the original SARS-CoV-2 virus sequence, the Omicron variant has at least 60 new mutations, including more than 35 mutations in the spike protein (S protein), with 15 mutations in the most critical receptor-binding domain of the S protein. In contrast, the Delta variant has only 2 mutations in this region. Based on the differences in mutation sites, the Omicron variant can be divided into at least five sub-variants: BA.1, BA.2.12.1, BA.2, BA.4, and BA.5, with the first three being the main circulating strains.

[0004] Studies have found that existing vaccines offer varying degrees of protection against variant strains, particularly the Omeprone strain of the novel coronavirus. Therefore, the development of a COVID-19 vaccine with better protective efficacy against variant strains is urgently needed.

[0005] In view of this, the present invention is hereby proposed. Summary of the Invention

[0006] The primary objective of this invention is to provide a novel coronavirus vaccine that alleviates the technical problem of poor protective efficacy of existing novel coronavirus vaccines against variant strains.

[0007] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0008] According to one aspect of the present invention, a novel coronavirus vaccine is provided, the novel coronavirus vaccine comprising a nucleic acid molecule containing a first reading frame and a second reading frame;

[0009] The first open reading frame encodes the S protein of the Delta variant of the novel coronavirus;

[0010] The second open reading frame encodes the S protein of the novel coronavirus Omeprung variant.

[0011] Preferably, the novel coronavirus vaccine comprises: a nucleic acid molecule containing a first open reading frame; and a nucleic acid molecule containing a second open reading frame;

[0012] Alternatively, the novel coronavirus vaccine may comprise a fusion nucleic acid molecule containing both a first open reading frame and a second open reading frame.

[0013] Preferably, the amino acid sequence of the S protein of the Delta variant of the novel coronavirus is shown in Seq_8;

[0014] Preferably, the novel coronavirus Omeprung variant is a BA.2 sub-variant or a BA.1 sub-variant; more preferably, it is a BA.2 sub-variant.

[0015] Preferably, the amino acid sequence of the S protein of the BA.1 sub-variant is shown in Seq_16;

[0016] Preferably, the amino acid sequence of the S protein of the BA.2 sub-variant is shown in Seq_14 or Seq_26.

[0017] Preferably, the nucleic acid molecule is RNA;

[0018] Preferably, the total GC% content of the open reading frame portion of the RNA is 30-70%, and the GC% content of any 60bp fragment in the open reading frame is not less than 40%.

[0019] Preferably, the total GC content of the open reading frame portion of the RNA is 50% to 60%, more preferably 54% to 60%;

[0020] Preferably, the RNA further includes one or more of the following: a 5' cap, a 5' UTR, a 3' UTR, a polyA tail, a start region, a stop region, a signal sequence region, and a linker sequence;

[0021] Preferably, the nucleotide sequence of the first open reading frame is as shown in Seq_9, Seq_47, Seq_48, Seq_49, Seq_50, ​​Seq_51, Seq_52, Seq_53 or Seq_54;

[0022] Preferably, the second open reading frame encodes the BA.1 sub-variant of the novel coronavirus Omeprón strain; the nucleotide sequence of the second open reading frame is shown in Seq_17;

[0023] Preferably, the second open reading frame encodes the BA.2 sub-variant of the novel coronavirus Omeprón strain; the nucleotide sequence of the second open reading frame is as shown in Seq_15, Seq_27, Seq_32, Seq_55, Seq_56, Seq_57, Seq_58, Seq_59, Seq_60 or Seq_46;

[0024] Preferably, the nucleotide sequence of the first open reading frame is selected from one of the sequences shown in Seq_9, Seq_47, Seq_48, Seq_49, Seq_50, ​​Seq_51, Seq_52, Seq_53 or Seq_54 expressing the Delta variant S protein; and the nucleotide sequence of the second open reading frame is selected from the sequence shown in Seq_17 expressing the Omeprone BA.1 variant S protein;

[0025] Preferably, the nucleotide sequence of the first open reading frame is selected from one of the following: Seq_9, Seq_47, Seq_48, Seq_49, Seq_50, ​​Seq_51, Seq_52, Seq_53, or Seq_54, which express the Delta variant S protein; and the nucleotide sequence of the second open reading frame is selected from one of the following: Seq_15, Seq_27, Seq_32, Seq_55, Seq_56, Seq_57, Seq_58, Seq_59, Seq_60, or Seq_46, which express the Omeprone BA.2 variant S protein;

[0026] Preferably, the combination of the first open reading frame and the second reading frame is selected from: Seq_9 and Seq_17, Seq_9 and Seq_27; Seq_47 and Seq_32; Seq_48 and Seq_55; Seq_49 and Seq_56; Seq_50 and Seq_57; Seq_51 and Seq_58; Seq_52 and Seq_59; Seq_53 and Seq_60; Seq_54 and Seq_46; Seq_54 and Seq_60; Seq_53 and Seq_55; Seq_52 and Seq_56; Seq_51 and Seq_57; Seq_50 and Seq_32; Seq_49 and Seq_59; Seq_48 and Seq_60; or, Seq_47 and Seq_58.

[0027] Preferably, the mass ratio of the nucleic acid molecule containing the first open reading frame to the nucleic acid molecule containing the second open reading frame is (1:9) to (9:1), more preferably (1:1) to (9:1), and even more preferably 3:1;

[0028] Preferably, the nucleic acid molecule is a fusion nucleic acid molecule, and the number of repetitions of the first open reading frame and the second open reading frame in the fusion nucleic acid molecule is (1:9) to (9:1); more preferably (1:1) to (9:1), and even more preferably 3:1.

[0029] Preferably, the vaccine further includes a delivery formulation;

[0030] Preferably, the novel coronavirus vaccine contains nucleic acid lipid nanoparticles composed of the nucleic acid molecules and lipid components;

[0031] Preferably, the novel coronavirus vaccine is selected from (a), (b), or (c):

[0032] (a) The novel coronavirus vaccine comprises: nucleic acid lipid nanoparticles encapsulating nucleic acid molecules containing a first open reading frame, and nucleic acid lipid nanoparticles encapsulating nucleic acid molecules containing a second open reading frame.

[0033] (b) The novel coronavirus vaccine comprises: nucleic acid lipid nanoparticles encapsulating a nucleic acid molecule containing a first open reading frame and a nucleic acid molecule containing a second open reading frame;

[0034] (c) The novel coronavirus vaccine comprises: nucleic acid lipid nanoparticles encapsulating fused nucleic acid molecules containing both a first open reading frame and a second open reading frame.

[0035] According to another aspect of the present invention, the present invention also provides a method for preparing the above-mentioned novel coronavirus vaccine, the method comprising mixing the nucleic acid molecules with optional excipients to obtain the novel coronavirus vaccine.

[0036] Preferably, the novel coronavirus vaccine comprises nucleic acid lipid nanoparticles, and the preparation method includes:

[0037] Nucleic acid lipid nanoparticles containing nucleic acid molecules with a first open reading frame and nucleic acid lipid nanoparticles containing nucleic acid molecules with a second open reading frame were prepared separately; then the two types of nucleic acid lipid nanoparticles were mixed according to the formulation amount.

[0038] Alternatively, nucleic acid molecules containing a first open reading frame and nucleic acid molecules containing a second open reading frame can be mixed according to the formula amount, and then nucleic acid lipid nanoparticles containing the two nucleic acid molecules can be prepared.

[0039] Alternatively, prepare nucleic acid lipid nanoparticles containing nucleic acid molecules that simultaneously contain a first open reading frame and a second open reading frame.

[0040] According to another aspect of the present invention, the present invention also provides the application of the above-described novel coronavirus vaccine, or the above-described preparation method, in the preparation of products for the prevention or treatment of diseases caused by the novel coronavirus.

[0041] According to another aspect of the present invention, the present invention also provides a product for preventing or treating diseases caused by the novel coronavirus, said product comprising the novel coronavirus vaccine described above.

[0042] Compared with the prior art, the present invention has the following beneficial effects:

[0043] The novel coronavirus vaccine provided by this invention uses nucleic acid as the main immunogenic material and comprises nucleic acid molecules containing a first open reading frame and a second open reading frame. The first open reading frame encodes the S protein of the Delta variant of the novel coronavirus, and the second open reading frame encodes the S protein of the Omicron variant of the novel coronavirus. After immunization, this novel coronavirus vaccine can express the S proteins of the Delta and Omicron variants of the novel coronavirus in the body, exhibiting minimal decrease in antibody activity against various variants of the SARS-CoV-2 virus, thus constituting a multivalent vaccine.

[0044] Immunizing animals with nucleic acid molecules encoding the Delta variant S protein of the novel coronavirus resulted in antibodies produced in the animal serum exhibiting strong neutralizing activity against six pseudovirus strains of the novel coronavirus: the original strain, Alpha variant, Beta variant, Gamma variant, Delta variant, and Omicron variant. Immunizing animals with nucleic acid molecules encoding the Omicron variant S protein of the novel coronavirus resulted in antibodies produced in the animal serum exhibiting strong neutralizing activity against the Omicron variant. Furthermore, considering the global distribution of prevalent strains of the novel coronavirus, the immunogen of the novel coronavirus vaccine can encode both the Delta and Omicron variant S proteins, thus providing protection against all prevalent strains of the novel coronavirus.

[0045] This invention, through experiments, found that immunizing animals with S proteins encoding the Delta and Omicron variants of the novel coronavirus produces antibodies that exhibit good neutralizing activity against the prevalent Delta, Omicron BA.1, and Omicron BA.2 variants of the novel coronavirus, thus achieving the effect of preventing an increase in the types of novel coronavirus variants. Attached Figure Description

[0046] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0047] Figure 1-1 The results of the test on the neutralizing activity of the novel coronavirus pseudovirus in the serum produced after immunizing cynomolgus monkeys with each vaccine preparation in Example 2 are as follows;

[0048] Figure 1-2 The results of the test on the neutralizing activity of the novel coronavirus pseudovirus in the serum produced after immunizing cynomolgus monkeys with the vaccine preparation in Example 2 are shown.

[0049] Figure 2 The results of the test on the neutralizing activity of the novel coronavirus pseudovirus in the serum produced after immunizing C57 mice with each vaccine formulation in Example 3 are as follows;

[0050] Figure 3 This represents the GC% content of RNA with reading frame sequences as shown in Seq_27.

[0051] Figure 4 This represents the GC% content of RNA with reading frame sequences as shown in Seq_32.

[0052] Figure 5 This represents the GC% content of RNA with reading frame sequences as shown in Seq_33;

[0053] Figure 6 This represents the GC% content of RNA with reading frame sequences as shown in Seq_34.

[0054] Figure 7 This represents the GC% content of RNA with reading frame sequences as shown in Seq_35.

[0055] Figure 8 The results of the test on the neutralizing activity of the novel coronavirus pseudovirus in the serum produced after immunizing C57 mice with each vaccine formulation in Example 6 are as follows;

[0056] Figure 9 The results of the test on the neutralizing activity of the novel coronavirus pseudovirus in the serum produced after immunizing C57 mice with samples 1-11 in Example 7 are as follows;

[0057] Figure 10 The results of the test on the neutralizing activity of the novel coronavirus pseudovirus in the serum produced after immunizing C57 mice with samples 11-12 in Example 7 are as follows;

[0058] Figure 11The results are cross-comparisons of samples 6-9 and samples 17-20 in Example 7;

[0059] Figure 12 The results of the test on the neutralizing activity of the novel coronavirus pseudovirus in the serum produced after immunizing C57 mice with samples 2-1 to 2-11 in Example 8 are as follows;

[0060] Figure 13 The results of the test on the neutralizing activity of the novel coronavirus pseudovirus in the serum produced after immunizing C57 mice with samples 2-12 to 2-22 in Example 9 are as follows;

[0061] Figure 14 The results of the test on the neutralizing activity of the novel coronavirus pseudovirus in the serum produced after immunizing C57 mice with the sample in Example 10 are shown.

[0062] Figure 15 The results of the test on the neutralizing activity of the novel coronavirus pseudovirus in the serum produced after immunizing C57 mice with the sample in Example 11 are shown.

[0063] Figure 16 The results of the test on the neutralizing activity of the novel coronavirus pseudovirus in the serum produced after immunizing C57 mice with the sample in Example 12 are shown.

[0064] Figure 17 The results show the neutralizing activity of serum generated after immunizing C57 mice with the sample in Example 13 against the pseudovirus of the novel coronavirus. Detailed Implementation

[0065] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0066] It should be noted that, unless otherwise specified, all embodiments and preferred embodiments mentioned herein can be combined to form new technical solutions; all technical features and preferred features mentioned herein can be combined to form new technical solutions; and the components involved or their preferred components can be combined to form new technical solutions.

[0067] The "scope" disclosed in this invention is in the form of a lower limit and an upper limit, and may be one or more lower limits and one or more upper limits, respectively; unless otherwise stated, the operation steps may be performed sequentially or not in sequence.

[0068] Unless otherwise stated, the technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods or materials similar to or equivalent to those described herein may also be used in this invention.

[0069] According to one aspect of the present invention, a novel coronavirus vaccine is provided, wherein the novel coronavirus vaccine mainly uses nucleic acid molecules as immunogenic materials, comprising nucleic acid molecules containing a first open reading frame and a second open reading frame, wherein the first open reading frame encodes the S protein of the Delta variant of the novel coronavirus, and the second open reading frame encodes the S protein of the Omicron variant of the novel coronavirus. After immunization with this novel coronavirus vaccine, it can express the S proteins of the Delta variant and the Omicron variant of the novel coronavirus in the body, thus constituting a multivalent vaccine.

[0070] The term "nucleic acid molecule" as used in this invention refers to a polymeric form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of nucleic acids include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA; vector DNA integrated with exogenous genes, such as expression cassettes or plasmids; DNA-RNA hybrids; or polymers containing purine and pyrimidine bases or other naturally occurring, chemically or biochemically modified, non-natural, or derived nucleotide bases.

[0071] It should be noted that the first and second reading frames in the nucleic acid molecules containing a first reading frame and a second reading frame can exist in the same nucleic acid molecule or in different nucleic acid molecules. Therefore, as long as the nucleic acid molecules contained in the novel coronavirus vaccine contain a first and a second reading frame, and can produce the S protein of the novel coronavirus Delta variant and Omeprone variant in the body after administration, it belongs to the novel coronavirus vaccine provided by this invention.

[0072] In some alternative embodiments, the novel coronavirus vaccine comprises: a nucleic acid molecule containing a first open reading frame; and a nucleic acid molecule containing a second open reading frame;

[0073] Alternatively, the novel coronavirus vaccine may comprise a fusion nucleic acid molecule containing both a first open reading frame and a second open reading frame.

[0074] This invention, through experiments, has shown that immunizing animals with nucleic acid molecules encoding the Delta variant S protein of the novel coronavirus results in antibodies produced in the animal serum that exhibit strong neutralizing activity against six pseudovirus strains of the novel coronavirus: the original strain, Alpha variant, Beta variant, Gamma variant, Delta variant, and Omicron variant. Furthermore, immunizing animals with nucleic acid molecules encoding the Omicron variant S protein of the novel coronavirus results in antibodies produced in the animal serum that exhibit strong neutralizing activity against the Omicron variant. Considering the global distribution of prevalent strains of the novel coronavirus, this invention demonstrates that novel coronavirus vaccines containing nucleic acid molecules encoding both the Delta and Omicron variant S proteins can provide protection against all prevalent strains of the novel coronavirus.

[0075] In the novel coronavirus vaccine provided by this invention, the S protein of the novel coronavirus encoded by the open reading frame may optionally be the S protein obtained by mutation of the Delta variant and / or the Omeprung variant under natural conditions; or may optionally be the S protein that has been artificially mutated and modified, wherein the mutation and modification may be to obtain an amino acid sequence of the S protein that conforms to the Delta variant or the Omeprung variant by mutation and modification of the wild type; or, may be the amino acid sequence of the S protein obtained by further mutation and modification based on the amino acid sequence of the Delta variant and the Omeprung variant.

[0076] The preferred amino acid sequence of the S protein of the novel coronavirus encoded by the open reading frame is as follows:

[0077] The preferred amino acid sequence of the S protein of the Delta variant of the novel coronavirus is shown in Seq_8.

[0078] The amino acid sequence of the S protein of the novel coronavirus Omeprung variant can optionally be derived from the S protein of the BA.1 sub-variant, BA.2 sub-variant, or BA.3 sub-variant.

[0079] Alternatively, the amino acid sequence of the S protein of the Omeprón mutant strain may be derived from the amino acid sequence obtained by mutating the wild-type S protein. The mutation includes obtaining at least one mutation site in the Omeprón strain BA.1, BA.2, and BA.3 sub-variants by mutating the wild-type S protein; for example, it may be, but is not limited to, obtaining a common mutation site in the Omeprón strain BA.1, BA.2, and BA.3 sub-variants, or one or more of all mutation sites in the three sub-variants; or obtaining a common mutation site in the BA.1 and BA.2 sub-variants, or one or more of all mutation sites in the two sub-variants; or obtaining a common mutation site in the BA.1 and BA.3 sub-variants, or one or more of all mutation sites in the two sub-variants; or obtaining a common mutation site in the BA.1 and BA.3 sub-variants, or one or more of all mutation sites in the two sub-variants.

[0080] In some preferred embodiments, the novel coronavirus Omeprón variant is a BA.2 sub-variant or a BA.1 sub-variant; more preferably, it is a BA.2 sub-variant.

[0081] The preferred amino acid sequence of the S protein of the BA.1 sub-variant strain of the novel coronavirus Omeprone is shown in Seq_16.

[0082] The preferred amino acid sequence of the S protein of the Omicron BA.2 variant of the novel coronavirus is shown in Seq_14 or Seq_26. Seq_26 is the S protein of the Omicron BA.2 strain with SN mutation (two proline residues are substituted at positions 983 and 984 in the full-length amino acid sequence of the S protein in Seq_14), which has a higher expression level.

[0083] The novel coronavirus vaccine provided by this invention uses nucleic acid molecules as its main active ingredient. After administration to the body, this vaccine expresses and produces the S protein of the Delta variant and the Omeprone strain of the novel coronavirus. To further improve the immunogenicity of the vaccine, this invention also optimizes the nucleic acid molecules, the ratio of the two nucleic acids encoding the S protein, and the vaccine formulation.

[0084] Optimization of nucleic acid molecules:

[0085] The nucleic acid molecules contained in the novel coronavirus vaccine are preferably RNA, and the novel coronavirus vaccine is preferably an RNA vaccine.

[0086] In some preferred embodiments, the total GC% content of the open reading frame portion of the RNA is 30% to 70%, for example, but not limited to 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70%, or any range between any two points, preferably 50% to 60%, more preferably 54% to 60%. Simultaneously, the GC% content of any 60bp fragment within the open reading frame is not less than 40%. Experiments have shown that RNA meeting the above conditions exhibits higher expression levels of the novel coronavirus S protein.

[0087] In some preferred embodiments, the RNA further includes one or more of the following: a 5' cap, a 5' UTR, a 3' UTR, a polyA tail, a start region, a stop region, a signal sequence region, and a linker sequence; the preferred structure of the RNA in the novel coronavirus vaccine is as follows:

[0088] Optionally, the RNA comprises, from the 5' end to the 3' end, the following segments in sequence: 5' cap - 5' UTR - first open reading frame and / or second open reading frame - 3' UTR - 3' polyA tail; the segments in sequence indicate that the RNA contains the above segments from the 5' end to the 3' end, and each segment may or may not contain at least one ribonucleotide or a functional nucleic acid segment.

[0089] Optionally, the RNA contains both a first open reading frame and a second open reading frame, forming a fusion RNA. The preferred structure of the fusion RNA is as follows:

[0090] An optional example structure is as follows: 5' cap - 5' UTR - start region - first open reading frame - linker sequence - second open reading frame - 3' UTR - end region - 3' polyA tail;

[0091] Alternatively, 5' cap - 5' UTR - first open reading frame - linker sequence - second open reading frame - 3' UTR - 3' polyA tail;

[0092] An optional example structure is as follows: 5' cap - 5' UTR - start region - (first coding region - linker sequence)n - (linker sequence - second coding region)m - 3' UTR - end region - 3' polyA tail;

[0093] Alternatively, 5' cap - 5' UTR - (first coding region - linker sequence)n - (linker sequence - second coding region)m - 3' UTR - 3' polyA tail;

[0094] Where n is the number of repetitions in the segment "first coding region - linker sequence"; m is the number of repetitions in the segment "linker sequence - second coding region"; n and m are independent positive integers.

[0095] In the above example, the content of the open reading frames encoding the Delta variant S protein of the novel coronavirus and the Omeprung variant S protein can be adjusted by adjusting the repetition counts of the fragment "first coding region - linker sequence" and the fragment "linker sequence - second coding region", i.e., the values ​​of n and m, or by adjusting the ratio of n and m. This allows the organization to produce Delta variant S protein and Omeprung variant S protein in different amounts and proportions after RNA immunization of the host with the novel coronavirus.

[0096] Other preferred functional fragments in RNA are as follows:

[0097] The 5' cap structure is used to increase mRNA stability and prevent mRNA from being degraded by exonucleases. The preferred 5' cap structure is m7G(5')(2'-OMeA)pG.

[0098] The 5'UTR and 3'UTR are used to regulate mRNA translation.

[0099] The preferred 5'UTR sequence is: GGGAGAAAGCUUACC (as shown in Seq_1).

[0100] The preferred 3'UTR sequence is:

[0101] GGACUAGUUAUAAGACUGACUAGCCCGAUGGGCCUCCCCAACGGGCCCUCCUCCCCUCCUUGCACCGAGAUUAAU (as shown in Seq_2).

[0102] The 3' polyA tail is used to prevent mRNA from being degraded by exonucleases and to terminate transcription. The polyA length is preferably 100 bp, and the sequence is shown in Seq_3.

[0103] In some alternative embodiments, the linker sequence contains at least one portion encoding a protein cleavage signal, which may be, for example, but is not limited to, cleavage signals of substances with cleavage function such as: protein precursor convertases, hormone precursor convertases, thrombin, and factor Xa proteins. The protein cleavage signal preferably includes a furin cleavage site (FCS, reference US7374930B2). Furin cleavage sites are widely distributed in most cell types, and the aforementioned fusion RNA can efficiently express active peptides in almost any cell type in vivo. Therefore, using a furin cleavage site allows for the efficient cleavage of the active peptides expressed by the aforementioned fusion RNA in vivo, enabling the first and second open reading frames fused to the same RNA to express the Delta variant S protein and the Omeprone variant S protein, respectively.

[0104] The preferred DNA sequence for the Furin cleavage site is CGTCAACGTCGT (Seq_6); the preferred RNA sequence is CGUCAACGUCGU (Seq_7).

[0105] In some alternative implementations, the linker is a cleavable linker or a protease-sensitive linker. A cleavable linker is preferably a 2A peptide, a class of peptide fragments (2A self-cleaving peptides) of 18-22 amino acid residues that can induce self-cleavage of recombinant proteins containing the 2A peptide within the cell. Some viruses use 2A peptides to generate two proteins from a single transcript via ribosome jumping, weakening the normal peptide bond at the 2A peptide sequence, resulting in the production of two discontinuous proteins from a single translation event.

[0106] Examples of 2A peptides include, but are not limited to:

[0107] F2A connector (Foot-and-mouth disease virus (FMDV) 2A peptide):

[0108] The amino acid sequence is: (GSG)VKQTLNFDLLKLAGDVESNPGP (as shown in Seq_36 or Seq_37);

[0109] P2A adapter (Porcine Chancery Virus-1 2A peptide):

[0110] The amino acid sequence is: (GSG)ATNFSLLKQAGDVEENPGP (as shown in Seq_38 or Seq_39);

[0111] E2A connector (equine rhinitis A virus 2A peptide):

[0112] The amino acid sequence is: (GSG)QCTNYALLKLAGDVESNPGP (as shown in Seq_40 or Seq_41);

[0113] T2A connector (Mingmai flat-spotted moth virus 2A peptide):

[0114] The amino acid sequence is: (GSG)EGRGSLLTCGDVEENPGP (as shown in Seq_42 or Seq_43).

[0115] Adding a GSG (Gly-Ser-Gly, glycine, serine, glycine) sequence to the N-terminus of the 2A peptide sequence can improve the efficiency of induced cleavage of the 2A peptide.

[0116] The nucleotide sequences encoding peptide 2A include, but are not limited to, the following sequences, or, based on the following sequences, the polynucleotide sequences of peptide 2A modified or codon-optimized using methods described above and / or known in the art:

[0117] GGAAGCGGAGCUACUAACUUCAGCCUGCUGAAGCAGGCUGGAGACGUGGAGGAGAACCCUGGACCU (as shown in Seq_44); or,

[0118] UCCGGACUCAGAUCCGGGGAUCUCAAAAUUGUCGCUCCUGUCAACAAACUCUUAACUUUGAUUUACUCAAACUGGCTGGGGAUGUAGAAAGCAAUCCAGGTCCACUC (as shown in Seq_45).

[0119] The linker sequence in the segment "first coding region - linker sequence" and the linker sequence in the segment "linker sequence - second coding region" can be the same or different.

[0120] The preferred sequences and combinations of open reading frames are as follows:

[0121] In some alternative implementations, the nucleotide sequence encoding the first open reading frame of the novel coronavirus Delta variant S protein is shown in Seq_9, Seq_47, Seq_48, Seq_49, Seq_50, ​​Seq_51, Seq_52, Seq_53 or Seq_54.

[0122] In some alternative implementations, the second open reading frame encodes the BA.1 sub-variant of the novel coronavirus Omeprone strain, and the nucleotide sequence of the second open reading frame is shown in Seq_17.

[0123] In some alternative implementations, the second open reading frame encodes the BA.2 sub-variant of the novel coronavirus Omeprone variant, and the nucleotide sequence of the second open reading frame is shown as Seq_15, Seq_27, Seq_32, Seq_55, Seq_56, Seq_57, Seq_58, Seq_59, Seq_60 or Seq_46.

[0124] The first and second open reading boxes can be combined in the following ways:

[0125] In some optional embodiments, the nucleotide sequence of the first open reading frame is selected from one of the sequences shown in Seq_9, Seq_47, Seq_48, Seq_49, Seq_50, ​​Seq_51, Seq_52, Seq_53 or Seq_54 expressing the Delta variant S protein; and the nucleotide sequence of the second open reading frame is selected from the sequence shown in Seq_17 expressing the Omeprone BA.1 variant S protein.

[0126] Alternatively, the nucleotide sequence of the first open reading frame is selected from one of the following: Seq_9, Seq_47, Seq_48, Seq_49, Seq_50, ​​Seq_51, Seq_52, Seq_53, or Seq_54, which express the Delta variant S protein; and the nucleotide sequence of the second open reading frame is selected from one of the following: Seq_15, Seq_27, Seq_32, Seq_55, Seq_56, Seq_57, Seq_58, Seq_59, Seq_60, or Seq_46, which express the Omeprone BA.2 variant S protein.

[0127] The specific combinations of the first open reading box and the second reading box can be, for example, but not limited to: Seq_9 and Seq_17, Seq_9 and Seq_27; Seq_47 and Seq_32; Seq_48 and Seq_55; Seq_49 and Seq_56; Seq_50 and Seq_57; Seq_51 and Seq_58; Seq_52 and Seq_59; Seq_53 and Seq_60; Seq_54 and Seq_46; Seq_54 and Seq_60; Seq_53 and Seq_55; Seq_52 and Seq_56; Seq_51 and Seq_57; Seq_50 and Seq_32; Seq_49 and Seq_59; Seq_48 and Seq_60; or, Seq_47 and Seq_58.

[0128] The proportion of nucleic acids encoding the S protein:

[0129] In some alternative implementations, the ratio of the two S proteins produced in the body after vaccine immunization is adjusted by regulating the content of nucleic acid encoding the Delta variant S protein and the content of S protein encoding the Omeprone variant in the novel coronavirus vaccine.

[0130] In some optional embodiments, the first open reading frame (OPF) and the second ORF are located in different nucleic acid molecules, and the mass ratio of the nucleic acid molecule encoding the first ORF to the nucleic acid molecule encoding the second ORF is (1:9) to (9:1); for example, it can be, but is not limited to, 1:9, 1:4, 1:3, 1:1, 3:1, 4:1 or 9:1, preferably (1:1) to (9:1), and more preferably 3:1. In this embodiment, the nucleic acid molecule is preferably an RNA molecule, and has a structure such that, from the 5' end to the 3' end, it sequentially includes: 5' cap - 5' UTR - first ORF and / or second ORF - 3' UTR - 3' polyA tail.

[0131] In some optional embodiments, the nucleic acid molecule is a fusion nucleic acid molecule, that is, the same nucleic acid molecule contains both a first open reading frame and a second open reading frame, and the repetition ratio of the first open reading frame and the second open reading frame in the fusion nucleic acid molecule is (1:9) to (9:1); for example, it can be, but is not limited to, 1:9, 1:4, 1:3, 1:1, 3:1, 4:1 or 9:1, preferably (1:1) to (9:1), and more preferably 3:1.

[0132] Vaccine formulation optimization:

[0133] It is understood that the novel coronavirus vaccine provided by the present invention may also contain other excipients or functional components acceptable in the art for the preparation of vaccines, including but not limited to at least one or more of vaccine adjuvants, delivery formulations, solvents, preservatives, stabilizers, pH adjusters, buffering substances and lyophilization protectants.

[0134] In some preferred embodiments, the vaccine further includes a delivery formulation, which is preferably a lipid component. The lipid component preferably forms nucleic acid lipid nanoparticles (LNPs) with the nucleic acid molecules of the novel coronavirus vaccine. LNPs are nanoparticles formed by encapsulating nucleic acids with a lipid component, which enables the encapsulated nucleic acids to be delivered into cells more effectively.

[0135] The vaccine preferably also includes a delivery formulation, which is preferably a lipid component. The lipid component and the nucleic acid molecules of the novel coronavirus vaccine preferably constitute nucleic acid lipid nanoparticles (LNPs). LNPs are nanoparticles formed by encapsulating nucleic acids with lipid components. LNPs enable the encapsulated nucleic acids to be delivered into cells more effectively.

[0136] The novel coronavirus vaccine may contain LNP in the following options: (a), (b), or (c):

[0137] (a) The first reading frame and the second reading frame are respectively contained in different nucleic acid molecules. The nucleic acid molecules containing the first reading frame and the nucleic acid molecules containing the second reading frame are respectively wrapped in different LNPs. That is, the novel coronavirus vaccine comprises: LNPs wrapped with nucleic acid molecules containing the first open reading frame, and LNPs wrapped with nucleic acid molecules containing the second open reading frame.

[0138] (b) The first reading frame and the second reading frame are respectively contained in different nucleic acid molecules. The nucleic acid molecules containing the first reading frame and the nucleic acid molecules containing the second reading frame are mixed and encapsulated in the same LNP. That is, the novel coronavirus vaccine comprises: an LNP containing a nucleic acid molecule containing a first open reading frame and a nucleic acid molecule containing a second open reading frame.

[0139] (c) The first reading frame and the second reading frame exist in the same nucleic acid molecule, which is encapsulated in an LNP, that is, the novel coronavirus vaccine comprises: an LNP encapsulating a nucleic acid molecule that simultaneously contains a first open reading frame and a second open reading frame.

[0140] The preferred lipid components for constituting the LNP are as follows: by molar percentage, the lipid components forming the LNP include 20–50% protonable cationic lipids, for example, but not limited to, 20%, 25%, 30%, 35%, 40%, 45%, or 50%; 20–50% structural lipids, for example, but not limited to, 20%, 25%, 30%, 35%, 40%, 45%, or 50%; 5–20% accessory lipids, for example, but not limited to, 5%, 10%, 15%, or 20%; and 1–5% surfactants, for example, but not limited to, 1%, 2%, 3%, 4%, or 5%. The total molar content of the protonable cationic lipids, structural lipids, accessory lipids, and surfactants is 100%.

[0141] The protonable cationic lipids preferably include at least one of DlinMC3-DMA, DODMA, C12-200 and DlinDMA.

[0142] The auxiliary lipids preferably include at least one of DSPC, DOPE, DOPC, DOPG, and DOPS.

[0143] Structural lipids preferably include cholesterol and / or cholesterol derivatives.

[0144] The surfactant preferably includes at least one of PEG-DMG, PEG-DSPE and TPGS.

[0145] In some preferred embodiments, the lipid components comprise, by molar percentage, 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG.

[0146] In some preferred embodiments, the lipid components comprise, by molar percentage, 50% Dlin-MC3-DMA, 20% DOPG, 29% cholesterol, and 1% PEG-DMG.

[0147] In some optional embodiments, the LNP in the vaccine is prepared by the following method: a mixture containing nucleic acid molecules is uniformly mixed with an organic phase containing the lipid component to obtain a mixture; the organic phase is removed and the concentration of nucleic acid molecules in the system is 1 to 100 μg / ml, for example, but not limited to 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 μg / ml, preferably 55 μg / ml, to obtain the nucleic acid lipid nanoparticles.

[0148] The mixing of the aqueous and organic phases is preferably carried out using a microfluidic device, with the flow rate controlled at >3 ml / min.

[0149] The preferred method for removing the organic phase is to first dilute the mixture 50 to 100 times with a buffer solution, for example, but not limited to 50, 60, 70, 80, 90 or 100 times, and then use tangential flow filtration (TFF) to remove the organic phase from the solution, and then concentrate the nucleic acid molecules in the system to the target concentration.

[0150] The aqueous phase is an aqueous buffer solution containing 0.08 to 1.2 mg / L of the nucleic acid molecules. The concentration of the nucleic acid molecules in the aqueous phase can be, for example, but not limited to, 0.08, 0.1, 0.2, 0.5, 0.8, 1.0, 1.1 or 1.2 mg / L. The aqueous buffer solution is a citrate buffer or a sodium acetate buffer.

[0151] The organic phase is an anhydrous C1-C4 low-carbon alcohol containing 5-7 mg / L of the lipid component. The concentration of the lipid component can be, for example, but not limited to, 5, 5.5, 6, 6.5 or 7 mg / ml. The anhydrous C1-C4 low-carbon alcohol is preferably ethanol.

[0152] The volume ratio of the aqueous phase to the organic phase is 1:2 to 4, for example, but not limited to 1:2, 1:3 or 1:4.

[0153] It should be noted that all the technical features and preferred features mentioned above in the optimization of nucleic acid molecules, the optimization of the proportion of nucleic acids encoding the S protein, and the optimization of vaccine formulations can be combined to form new technical solutions. For example, in the scheme for optimizing the proportion of nucleic acids encoding the S protein, LNPs can be prepared using methods (a), (b), or (c), and other delivery methods can be used or not. In the scheme for optimizing vaccine formulations, different combinations of first and second open reading frames can be used to prepare various LNPs encapsulating different nucleic acids. When other types of molecules are used for the nucleic acid molecules, such as expression cassettes or vectors integrated with DNA, LNPs encapsulating DNA can also be prepared using methods (a), (b), or (c) to serve as the main active ingredient of the vaccine. Specific examples include, but are not limited to:

[0154] In some optional embodiments, the novel coronavirus vaccine contains two RNA molecules, each containing a first reading frame and a second reading frame, respectively. The nucleotide sequence of the first reading frame is shown in Seq_9, and the nucleotide sequence of the second reading frame is shown in Seq_27. The sequence characteristics of the two RNA molecules also include a 5' cap (m7G(5')(2'-OMeA)pG), a 5' UTR (as shown in Seq_1), a 3' UTR (as shown in Seq_2), and a 3' tail with 100 polyA molecules (as shown in Seq_3). The mass ratio of the RNA molecule containing the first reading frame to the RNA molecule containing the second reading frame is (1:9) to (9:1); for example, it can be, but is not limited to, 1:9, 1:4, 1:3, 1:1, 3:1, 4:1, or 9:1. The two RNA molecules are first separately prepared into LNPs, and then mixed according to the formulation based on RNA mass to obtain the active ingredient in the novel coronavirus vaccine.

[0155] In this embodiment, the nucleotide sequence of the first reading frame may also be selected from any one of Seq_47, Seq_48, Seq_49, Seq_50, ​​Seq_51, Seq_52, Seq_53 or Seq_54; the nucleotide sequence of the second reading frame may also be selected from any one of Seq_17, Seq_15, Seq_32, Seq_55, Seq_56, Seq_57, Seq_58, Seq_59, Seq_60 or Seq_46.

[0156] In the above embodiments, the specific combination of the first open reading box and the second reading box can be, for example, but not limited to: Seq_9 and Seq_17, Seq_9 and Seq_27; Seq_47 and Seq_32; Seq_48 and Seq_55; Seq_49 and Seq_56; Seq_50 and Seq_57; Seq_51 and Seq_58; Seq_52 and Seq_59; Seq_53 and Seq_60; Seq_54 and Seq_46; Seq_54 and Seq_60; Seq_53 and Seq_55; Seq_52 and Seq_56; Seq_51 and Seq_57; Seq_50 and Seq_32; Seq_49 and Seq_59; Seq_48 and Seq_60; or, Seq_47 and Seq_58.

[0157] In some alternative embodiments, the novel coronavirus vaccine contains two RNA molecules, each containing a first reading frame and a second reading frame, respectively. The nucleotide sequence of the first reading frame is shown in Seq_9, and the nucleotide sequence of the second reading frame is shown in Seq_27. The sequence characteristics of the two RNA molecules also include a 5' cap (m7G(5')(2'-OMeA)pG), a 5' UTR (as shown in Seq_1), a 3' UTR (as shown in Seq_2), and a 3' tail with 100 polyA molecules (as shown in Seq_3). The mass ratio of the RNA molecule containing the first reading frame to the RNA molecule containing the second reading frame is (1:9) to (9:1); for example, it can be, but is not limited to, 1:9, 1:4, 1:3, 1:1, 3:1, 4:1, or 9:1. The two RNA molecules are first mixed according to the formulation, and then an LNP encapsulating the two RNA molecules is prepared to obtain the active ingredient in the novel coronavirus vaccine.

[0158] In the above embodiments, the nucleotide sequence of the first reading frame may also be selected from any one of Seq_47, Seq_48, Seq_49, Seq_50, ​​Seq_51, Seq_52, Seq_53 or Seq_54; the nucleotide sequence of the second reading frame may also be selected from any one of Seq_17, Seq_15, Seq_32, Seq_55, Seq_56, Seq_57, Seq_58, Seq_59, Seq_60 or Seq_46.

[0159] In the above embodiments, the specific combination of the first open reading box and the second reading box can be, for example, but not limited to: Seq_9 and Seq_17, Seq_9 and Seq_27; Seq_47 and Seq_32; Seq_48 and Seq_55; Seq_49 and Seq_56; Seq_50 and Seq_57; Seq_51 and Seq_58; Seq_52 and Seq_59; Seq_53 and Seq_60; Seq_54 and Seq_46; Seq_54 and Seq_60; Seq_53 and Seq_55; Seq_52 and Seq_56; Seq_51 and Seq_57; Seq_50 and Seq_32; Seq_49 and Seq_59; Seq_48 and Seq_60; or, Seq_47 and Seq_58.

[0160] In some alternative embodiments, the novel coronavirus vaccine contains a fusion RNA molecule, which contains two coding regions containing at least a first open reading frame and a second open reading frame, wherein the first open reading frame sequence is selected from the nucleotide sequence shown in Seq_9 and the second open reading frame sequence is selected from the nucleotide sequence shown in Seq_27.

[0161] The structure of the fusion RNA molecule is 5' cap - 5' UTR - (first coding region - linker sequence)n - (linker sequence - second coding region)m - 3' UTR - 3' polyA tail, where n and m are independent positive integers. The 5' cap is m7G(5')(2'-OMeA)pG, the 5' UTR is shown in Seq_1, the 3' UTR is shown in Seq_2, and the polyA tail is shown in Seq_3. The linker sequences are shown in Seq_45. The ratio of n to m is (1:9) to (9:1); for example, it can be, but is not limited to, 1:9, 1:4, 1:3, 1:1, 3:1, 4:1, or 9:1. The above fusion RNA molecule is used to prepare LNPs, which are used as the active ingredient in novel coronavirus vaccines.

[0162] In the above embodiments, the nucleotide sequence of the first open reading frame may also be selected from any one of Seq_47, Seq_48, Seq_49, Seq_50, ​​Seq_51, Seq_52, Seq_53 or Seq_54; the nucleotide sequence of the second open reading frame may also be selected from any one of Seq_17, Seq_15, Seq_32, Seq_55, Seq_56, Seq_57, Seq_58, Seq_59, Seq_60 or Seq_46.

[0163] In the above embodiments, the specific combination of the first open reading box and the second reading box can be, for example, but not limited to: Seq_9 and Seq_17, Seq_9 and Seq_27; Seq_47 and Seq_32; Seq_48 and Seq_55; Seq_49 and Seq_56; Seq_50 and Seq_57; Seq_51 and Seq_58; Seq_52 and Seq_59; Seq_53 and Seq_60; Seq_54 and Seq_46; Seq_54 and Seq_60; Seq_53 and Seq_55; Seq_52 and Seq_56; Seq_51 and Seq_57; Seq_50 and Seq_32; Seq_49 and Seq_59; Seq_48 and Seq_60; or, Seq_47 and Seq_58.

[0164] According to another aspect of the present invention, the present invention also provides a method for preparing the above-mentioned novel coronavirus vaccine, the method comprising mixing the nucleic acid molecules with optional excipients to obtain the novel coronavirus vaccine.

[0165] In some optional embodiments, the novel coronavirus vaccine comprises nucleic acid lipid nanoparticles, and the preparation method includes:

[0166] Nucleic acid lipid nanoparticles containing nucleic acid molecules with a first open reading frame and nucleic acid lipid nanoparticles containing a second open reading frame were prepared separately to obtain nucleic acid lipid nanoparticles containing different open reading frames. Then, the two types of nucleic acid lipid nanoparticles were mixed according to the formula amount.

[0167] Alternatively, nucleic acid molecules containing a first open reading frame and nucleic acid molecules containing a second open reading frame can be mixed according to the formula amount, and then nucleic acid lipid nanoparticles containing the two nucleic acid molecules can be prepared.

[0168] Alternatively, nucleic acid lipid nanoparticles can be prepared that encapsulate nucleic acid molecules containing both a first open reading frame and a second open reading frame.

[0169] The preferred method for preparing the above-mentioned nucleic acid lipid nanoparticles is the lipid nanoparticle (LNP) method described in the above-mentioned novel coronavirus vaccine technical solution, which will not be repeated here.

[0170] According to another aspect of the present invention, the present invention also provides the application of the above-mentioned novel coronavirus vaccine, or the method for preparing the above-mentioned novel coronavirus vaccine, in the preparation of products for the prevention or treatment of diseases caused by the novel coronavirus.

[0171] According to another aspect of the present invention, the present invention also provides a product for preventing or treating diseases caused by the novel coronavirus, the product comprising the aforementioned novel coronavirus vaccine.

[0172] The aforementioned products for the prevention or treatment of diseases caused by the novel coronavirus may be, for example, but not limited to, kits containing a device for administering the novel coronavirus vaccine; kits containing other preventive or therapeutic active ingredients; or kits containing substances for evaluating the effectiveness of the novel coronavirus vaccine, etc.

[0173] The technical solution and beneficial effects of the present invention will be further described below with reference to preferred embodiments.

[0174] Example 1

[0175] This embodiment provides a method for preparing lipid nanoparticles containing RNA, wherein the lipid nanoparticles comprise, by molar percentage: 50% Dlin-MC3-DMA, 20% DOPG, 29% cholesterol, and 1% PEG-DMG. The preparation method is as follows:

[0176] (a) Dissolve the RNA in a citrate buffer at pH 4 and adjust the concentration to 0.1 mg / ml to obtain the aqueous phase.

[0177] (b) Dissolve Dlin-MC3-DMA, DOPG, cholesterol and PEG-DMG in anhydrous ethanol according to the formulation amount, and adjust the concentration of lipid components in the organic phase to 6 mg / mL to obtain the organic phase.

[0178] (c) The aqueous phase from step (a) and the organic phase from step (b) were mixed at a volume ratio of 1:3 using a microfluidic device at a flow rate of 12 mL / min. The mixture was immediately diluted 100 times with PBS solution at pH 7.4, and ethanol was removed from the solution using tangential flow filtration (TFF). The mixture was then concentrated to a concentration of 55 μg / mL to obtain lipid nanoparticles containing RNA encoding SARS-CoV-2 viral antigens.

[0179] Example 2

[0180] In this embodiment, a series of mRNA sequences were designed, and the sequences of the reading frames are shown in Table 1. In addition to the reading frame sequences, the characteristics of this series of mRNA sequences also include a 5' cap, a 5' UTR (as shown in Seq_1), a 3' UTR (as shown in Seq_2), and a 3' tail with 100 polyA sequences (as shown in Seq_3).

[0181] Table 1 mRNA sequence design scheme

[0182]

[0183] The above-mentioned mRNAs were prepared into lipid nanoparticles according to the preparation method provided in Example 1.

[0184] Experiment A: Normal cynomolgus monkeys aged 5–8 years were selected for vaccine immunogenicity evaluation. The animals were randomly divided into 5 groups: the original strain group (Seq_13) (50 μg / animal), the Delta group (Seq_9) (50 μg / animal), the Beta group (Seq_5) (50 μg / animal), the Omicron group (Seq_11) (50 μg / animal), and the negative control group, with 12 animals in each group, half male and half female.

[0185] The mRNA LNP preparation prepared in Example 2 was used in cynomolgus monkey immunization experiments. Each cynomolgus monkey received an intramuscular injection of 50 micrograms (based on mRNA) via the hind leg thigh. The corresponding test vaccine and control vaccine were injected intramuscularly via the hind leg thigh on D0 (the day of administration) and D21, respectively. The negative control group received 0.5 mL of PBS. Twenty-eight days after the initial immunization, cynomolgus monkey serum was collected and sent to a third-party laboratory for SARS-CoV-2 pseudovirus neutralization activity testing. Cynomolgus monkey serum was diluted at different ratios (initial dilution factor 30) in 96-well plates, and SARS-CoV-2 infective pseudovirus was added. Cell controls and virus controls were also set up. After incubation for 1 hour, pre-prepared cells were added, and the plates were cultured in a cell culture incubator for 20–28 hours. A portion of the supernatant was discarded, and luciferase assay reagent was added. After reaction at room temperature in the dark, the cells were repeatedly blown and aspirated from the wells to ensure complete cell lysis. The cells were then placed in a chemiluminescence detector to read the luminescence value. Ensuring the validity of the virus control and cell control, the EC50 value was calculated using the Reed-Muench method. Serum corresponding group numbers and results are as follows Figure 1-1 As shown.

[0186] from Figure 1-1 It can be seen that:

[0187] (1) The vaccine preparation made from four antigens can stimulate cynomolgus monkeys to produce antibodies that have the ability to neutralize the target strain of pseudovirus.

[0188] (2) The antibodies produced by the mRNA (Seq_9) vaccine formulation encoding the S protein of the Delta variant of the novel coronavirus stimulated by cynomolgus monkeys have strong neutralizing activity against six pseudoviruses of the novel coronavirus, including the original strain, Alpha variant, Beta variant, Gamma variant, Delta variant and Omicron variant.

[0189] The antibodies produced by cynomolgus monkeys stimulated by the mRNA (Seq_13) vaccine formulation encoding the S protein of the original SARS-CoV-2 strain showed strong neutralizing activity against five pseudovirus strains of SARS-CoV-2, including the original strain, Alpha variant, Beta variant, Gamma variant, and Delta variant, but weak neutralizing activity against the Omicron variant.

[0190] The mRNA (Seq_5) vaccine formulation encoding the S protein of the Beta variant of SARS-CoV-2 stimulated the production of antibodies in cynomolgus monkeys. These antibodies exhibited strong neutralizing activity against three pseudoviruses of SARS-CoV-2: the Beta variant, the Gamma variant, and the Delta variant, while their neutralizing activity against the original strain, the Alpha variant, and the Omicron variant was weaker.

[0191] Based on the neutralizing activity of antibodies produced by cynomolgus monkeys against pseudoviruses of various SARS-CoV-2 strains and variants, antibodies produced by mRNA vaccine formulations encoding the Delta variant of SARS-CoV-2 and the S protein of the original SARS-CoV-2 strain exhibit broader neutralizing activity.

[0192] Experiment B: Normal cynomolgus monkeys aged 5-8 years were selected for vaccine immunogenicity evaluation. Animals were randomly divided into three groups: the original strain group (Seq_13) (50 μg / animal), the Delta group (Seq_9) (50 μg / animal), and a negative control group, with 36 animals in each group (half male and half female). The neutralizing activity of the SARS-CoV-2 pseudovirus was tested according to the method described in Experiment A. EC50 values ​​were calculated using the Reed-Muench method, ensuring the validity of both the virus and cell controls. Serum group numbers and results are as follows. Figure 1-2 As shown. The mRNA vaccine formulation sample encoding the S protein of the Delta variant of SARS-CoV-2 is designated as Sample 1-1, and the mRNA vaccine formulation sample encoding the S protein of the original SARS-CoV-2 strain is designated as Sample 1-2.

[0193] mRNA vaccine formulations encoding the S protein of the Delta variant of SARS-CoV-2 have better neutralizing activity against circulating strains such as the Beta variant and the Omicron variant.

[0194] Example 3

[0195] Screening of the S protein of Omicron strain subtypes:

[0196] This embodiment designs a series of mRNA sequence information, where the reading frame sequences are shown in Table 2; in addition to the reading frame sequences, the features of this series of mRNA sequences also include a 5' cap, a 5' UTR (as shown in Seq_1), a 3' UTR (as shown in Seq_2), and a 3' tail with 100 polyA sequences (as shown in Seq_3).

[0197] Table 2 mRNA sequence design scheme

[0198]

[0199] In Table 2, the three sub-variant strains of Omicron are Omicron BA.1, Omicron BA.2, and Omicron BA.3.

[0200] Six different antigens, samples 1-6, were prepared into vaccines according to the method in Example 1. The mRNA mixtures of different groups were prepared into LNP preparations. The encapsulation rate of the LNP preparations was tested to be over 90%, and the particle size was about 70 nm.

[0201] The prepared mRNA LNP formulation was used in an immunization experiment in C57 mice. Each mouse received a 5 μg injection (based on mRNA) via intramuscular injection into the lateral thigh of the hind limb. A second immunization was performed 7 days later, with 3 mice per group. Fourteen days after the first immunization, mouse serum was collected and sent to a third-party laboratory for SARS-CoV-2 pseudovirus neutralization activity testing. Mouse serum was diluted at different ratios (initial dilution factor 30) in 96-well plates, and SARS-CoV-2 infective pseudoviruses were added. Cell controls and virus controls were also included. After incubation for 1 hour, pre-prepared cells were added, and the plates were cultured in a cell culture incubator for 20–28 hours. A portion of the supernatant was discarded, and luciferase assay reagent was added. After reaction at room temperature in the dark, the cells were repeatedly pipetted and aspirated to ensure complete cell lysis. The cells were then placed in a chemiluminescence analyzer to read the luminescence value. Ensuring the validity of the virus and cell controls, the EC50 value was calculated using the Reed-Muench method. The EC50 values ​​of the pseudovirus strains with different antigens prepared for samples 1–6 are shown in the table below. Figure 2 As shown.

[0202] from Figure 2 The results show that:

[0203] (1) Because the S protein of the two sub-variants BA.1 and BA.2 of the Omeprone strain of the novel coronavirus has more site mutations compared with the S protein of the Delta strain of the novel coronavirus, the vaccine preparation prepared when the amino acid sequence of the S protein encoded by the reading frame of the mRNA vaccine is as shown in Seq_14, Seq_16, Seq_18, Seq_20, Seq_22 and Seq_24 has low activity in stimulating mice to produce neutralizing antibodies when neutralizing the pseudovirus of the Delta strain of the novel coronavirus.

[0204] (2) Vaccine preparations made when the amino acid sequence of the S protein encoded by the reading frame of the mRNA vaccine is shown in Seq_14, Seq_16, Seq_18, Seq_20, Seq_22 and Seq_24 can stimulate mice to produce neutralizing antibodies against the two SARS-CoV-2 Omicron variant pseudoviruses BA.1 and BA.2.

[0205] (3) In vaccine formulations prepared by encoding different S proteins (amino acid sequences as shown in Seq_14, Seq_16, Seq_18, Seq_20, Seq_22 and Seq_24) in mRNA vaccine reading frames, mRNA vaccines encoding S proteins with amino acid sequences such as Seq_14 (encoding the S protein of the SARS-CoV-2 Omicron BA.2 strain) can stimulate mice to produce neutralizing antibodies against the BA.1 and BA.2 SARS-CoV-2 Omicron sub-variant pseudoviruses.

[0206] Example 4

[0207] Based on the characteristic mutation sequence of the S protein reading frame of the Omicron strain of SARS-CoV-2 and other mutations such as SN and SM mentioned in other patents and literature that can improve precursor stability, a series of mRNA sequences were designed in this embodiment. The reading frame information is shown in Table 3 below.

[0208] In addition to the reading frames in Table 3, the mRNA sequence features of this series also include a 5' cap, a 5' UTR (as shown in Seq_1), a 3' UTR (as shown in Seq_2), and a 3' tail with 100 polyA lines (as shown in Seq_3).

[0209] Table 3. mRNA sequence design scheme and relative expression level

[0210]

[0211] In Table 3:

[0212] The SN mutation results in two proline residue substitutions at positions 983 and 984 in the full-length S protein amino acid sequence Seq_14.

[0213] The SM mutation produces a full-length SARS-CoV-2 protein with proline residue substitutions at positions 813, 889, 886, 939, 983, and 984 in the amino acid sequence Seq_14 of the full-length S protein.

[0214] The SL mutation at positions 682, 683, 684, and 685 of the full-length S protein amino acid sequence Seq_14 results in the RRAR mutation of the full-length SARS-CoV-2 protein GSGG.

[0215] Cells were transfected with the mRNAs shown in Table 3, and the expression of the full-length S protein in the cells was detected. The results are shown in Table 3. The detailed method is as follows: HEK293 cells transfected with each mRNA for 24 hours were lysed. At a sample loading rate of 10 μg total protein, SDS-PAGE immunoblotting was used to specifically detect the target protein. In this embodiment, anti-SARS-S1 protein antibody was used as the primary antibody, and goat anti-mouse-HRP antibody was used as the secondary antibody for incubation, followed by color development. When analyzing the protein expression results, β-actin was used as an internal control for standardized quantification. Cells not transfected with mRNA were set up as a negative control to compare the differences in protein expression levels after cell transfection with different mRNAs. The detection results showed that the expression of the full-length S protein and the S1 subunit could be detected in all cases. The expression levels of each sequence were measured as relative OD values, as shown in Table 3. The relative OD value was calculated as: (sample OD value - average value of negative control) / (OD value of sample 1 - average value of negative control).

[0216] As can be seen from the table above:

[0217] (1) The S protein was expressed in cells transfected with mRNA designed with four different sequences.

[0218] (2) After transfecting cells with SM mutation sample 3 and SL mutation sample 4, the S protein content was lower than that of other mRNA transfected samples under the same conditions, indicating that SM mutation and SL mutation will lead to a decrease in S protein expression.

[0219] (3) After transfecting cells with sample 2 containing the SN mutation, the S protein content was higher than that of sample 1 without the SN mutation under the same conditions, indicating that the SN mutation significantly increased the expression of the S protein in the transfected cell experiment. Therefore, the amino acid sequence Seq_26 and the corresponding mRNA sequence Seq_27 of sample 2 with the SN mutation are more suitable as potential vaccine candidates than other samples.

[0220] The inventors also mutated other sites of Seq_5, such as G614S, based on other publicly reported findings, and designed corresponding mRNA sequences based on the Seq_15 sequence. They detected the protein expression of the mRNA after transfection into cells using Western blot analysis and found that these mutations and the corresponding optimized mRNA sequences led to a decrease in expression levels compared to the Seq_27 and Seq_15 mRNA sequences.

[0221] Based on the full-length S protein mRNA of SARS-CoV-2 published in WOUS21032609, GB2002166, and WOUS21016979, as well as the optimization methods of Seq_17 mRNA and Seq_19 mRNA, we designed a method to detect the protein expression of mRNA transfected cells using Western blot. We found that these mutations and the corresponding mRNA sequence optimizations led to a decrease in expression levels compared to the Seq_15 mRNA and Seq_17 mRNA sequences.

[0222] Example 5

[0223] Optimization of the mRNA sequence encoding the S protein of the BA.2 sub-mutant strain:

[0224] This embodiment designed a series of mRNA sequences based on the optimization principles of the S protein (amino acid sequence as shown in Seq_26) and mRNA sequence of the Omicron strain of SARS-CoV-2. The reading frame information is shown in Table 4 below, and the GC content is as follows. Figures 3-7 As shown, Figures 3-7 The horizontal axis represents the local GC% content.

[0225] In addition to the reading frames in Table 4, the mRNA sequence features of this series also include a 5' cap, a 5' UTR (as shown in Seq_1), a 3' UTR (as shown in Seq_2), and a 3' tail with 100 polyA lines (as shown in Seq_3).

[0226] Table 4. mRNA sequence design scheme and relative expression level

[0227]

[0228] Table 4 shows the "local GC% content": the GC% content in a local sequence with a window size of 60bp, from the 3' end to the 5' end of the ORF.

[0229] Cells were transfected with the mRNAs shown in Table 4, and the expression of the full-length S protein in the cells was detected. The results are shown in Table 4. The detailed method is as follows: HEK293 cells transfected with each mRNA for 24 hours were lysed. At a sample loading rate of 10 μg total protein, SDS-PAGE immunoblotting was used to specifically detect the target protein. In this embodiment, anti-SARS-S1 protein antibody was used as the primary antibody, and goat anti-mouse-HRP antibody was used as the secondary antibody for incubation, followed by color development. When analyzing the protein expression levels, β-actin was used as an internal control for standardized quantification. Cells not transfected with mRNA were set up as a negative control to compare the differences in protein expression levels after cell transfection with different mRNAs. The results showed that the expression of the full-length S protein and the S1 subunit could be detected in all cases. The expression levels of each sequence were measured as relative OD values, as shown in Table 4; the relative OD value was calculated as: sample OD value / OD value of sample 1.

[0230] As can be seen from Table 4:

[0231] (1) S protein was expressed in cells transfected with mRNA designed with four different sequences.

[0232] (2) When the overall GC% content of the mRNA reading frame sequence is 54-60%, and the local GC% content is not less than 40%, the relative expression level of S protein is high (see Seq_27 and 32).

[0233] When the overall GC% content of the mRNA reading frame is less than 54% and the GC% content of the local sequence is not less than 40%, the relative expression level of the S protein is low (see Seq_33);

[0234] When the overall GC% content of the mRNA reading frame is higher than 60% and the GC% content of the local sequence is not lower than 40%, the relative expression level of the S protein is low (see Seq_34);

[0235] When the overall GC% content of the mRNA reading frame is 54-60%, and the GC% content of a local sequence is less than 40%, the relative expression level of the S protein is low (see Seq_35).

[0236] (3) When the overall GC% content of the mRNA reading frame sequence is 54-60%, and the local GC% content is not less than 40%, the expression level of the S protein with the mRNA reading frame sequence Seq_27 is higher than that of the mRNA reading frame sequence Seq_32.

[0237] Example 6

[0238] Two different antigens, samples 1 and 2 from Example 5, were prepared into vaccines according to the method in Example 1. Different mRNA mixtures were prepared into LNP formulations. The encapsulation efficiency of the LNP formulations was found to be above 90%, with a particle size of approximately 70 nm. The two vaccine formulations were used in an immunization experiment on C57 mice. Each mouse received a 5 microgram (based on mRNA) intramuscular injection in the lateral thigh of the hind limb. A second immunization was performed 7 days later, with 3 mice in each group. Fourteen days after the first immunization, mouse serum was collected and sent to a third-party laboratory for SARS-CoV-2 pseudovirus neutralization activity testing. Mouse serum was diluted at different ratios (initial dilution factor 30) in 96-well plates, and SARS-CoV-2 infective pseudovirus was added. Cell controls and virus controls were also set up. After incubation for 1 hour, pre-prepared cells were added, and the plates were cultured in a cell culture incubator for 20–28 hours. A portion of the supernatant was discarded, and luciferase detection reagent was added. After reaction at room temperature in the dark, the cells were repeatedly blown and aspirated from the wells to ensure complete cell lysis. The plates were then placed in a chemiluminescence detector to read the luminescence value. Assuming the virus and cell controls are valid, the Reed-Muench method was used to calculate the EC50 value. Serum group numbers and results are as follows: Figure 8 As shown.

[0239] from Figure 8 As can be seen from the results, vaccine formulations prepared when the nucleotide sequences of the mRNA vaccine reading frames are shown in Seq_27 and Seq_32 can stimulate mice to produce antibodies with neutralizing ability against the five pseudoviruses of the Omega SARS-CoV-2 Omega variant, namely BA.1, BA.2, BA.2.12.1, BA.4, and BA.5 (Note: The BA.4 and BA.5 sub-variants of the Omega SARS-CoV-2 Omega variant have the same mutations on the S protein compared to the original strain).

[0240] When the overall GC% content of the mRNA reading frame sequence is 54-60%, and the local GC% content is not less than 40%, the mRNA vaccine formulations can stimulate mice to produce antibodies with neutralizing ability against the pseudoviruses of the two Omicron variants of SARS-CoV-2, BA.1 and BA.2. The neutralizing ability of the antibodies is slightly lower than that of the vaccine formulations prepared according to Seq ID NO.27 and Seq ID NO.32. However, due to the high expression level of mRNA sequence Seq ID NO.27, the mRNA vaccine formulation prepared from mRNA sequence Seq ID NO.27 produces the best antibody neutralizing ability.

[0241] Example 7

[0242] This embodiment provides a series of bivalent COVID-19 vaccines, and the preparation method is as follows:

[0243] The bivalent COVID-19 vaccine provided in this embodiment contains lipid nanoparticles encoding RNA for antigen 1 and antigen 2, wherein the lipid nanoparticles comprise, by molar percentage, 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG.

[0244] The preparation method is as follows:

[0245] (a) Dissolve RNA encoding different antigens in citrate buffer at pH 4 and adjust the concentration to 0.1 mg / ml to obtain an aqueous phase; the sequences of RNA encoding different antigens and the mixing ratios are shown in Table 5.

[0246] (b) Dissolve Dlin-MC3-DMA, DOPG, cholesterol and PEG-DMG in anhydrous ethanol according to the formulation amount, and adjust the concentration of lipid components in the organic phase to 6 mg / mL to obtain the organic phase.

[0247] (c) The aqueous phase from step (a) and the organic phase from step (b) were mixed at a volume ratio of 1:3 using a microfluidic device at a flow rate of 12 mL / min. The mixture was immediately diluted 100 times with PBS solution at pH 7.4, and the ethanol component in the solution was removed by tangential flow filtration (TFF). The mixture was then concentrated to a concentration of 0.55 mg / mL of mRNA to obtain lipid nanoparticles containing RNA encoding antigen 1 and antigen 2.

[0248] The mRNA sequences encoding antigen 1 and antigen 2 were mixed according to Table 5, where the reading frame information is shown in Table 5. In addition to the reading frames in the table, the characteristics of this series of mRNA sequences also include a 5' cap, a 5' UTR (as shown in Seq_1), a 3' UTR (as shown in Seq_2), and a 3' tail with 100 polyA sequences (as shown in Seq_3). M1 and M2 are the mRNA masses encoding antigen 1 and antigen 2, respectively, including the 5' cap, 5' UTR, reading frame, 3' UTR, and 3' tail.

[0249] Table 5

[0250]

[0251]

[0252] The 22 samples prepared above were used for immunization experiments in C57 mice. Each mouse received a 5 microgram (mRNA) injection via intramuscular injection in the lateral thigh of the hind limb. A second immunization was performed 7 days later, with 3 mice in each group. Fourteen days after the first immunization, mouse serum was collected and sent to a third-party laboratory for SARS-CoV-2 pseudovirus neutralization activity testing. Mouse serum was diluted at different ratios (initial dilution factor 30) in 96-well plates, and SARS-CoV-2 infective pseudovirus was added. Cell controls and virus controls were also set up. After incubation for 1 hour, pre-prepared cells were added, and the plates were cultured in a cell culture incubator for 20–28 hours. A portion of the supernatant was discarded, and luciferase assay reagent was added. After reaction at room temperature in the dark, the cells were repeatedly pipetted and aspirated to ensure complete cell lysis. The cells were then placed in a chemiluminescence analyzer to read the luminescence value. The Reed-Muench method was used to calculate the EC50 value, ensuring the validity of the virus and cell controls. Serum group numbers and results are as follows. Figure 9 and Figure 10 As shown.

[0253] (a) Samples 1-11 are mRNA lipid nanoparticle vaccines encoding the Omicron BA.2 variant of SARS-CoV-2 and the Delta variant of SARS-CoV-2, respectively. Samples 1-11 are bivalent mRNA vaccines for SARS-CoV-2.

[0254] When the EC50 value of the pseudovirus strain is not lower than 200, the tested vaccine is considered to produce antibodies with better neutralizing activity. Figure 9 The bar chart shows the EC50 values ​​of the pseudovirus strains in samples 1-11; the dashed line is an indicator line, pointing to the position where the EC50 value of the pseudovirus strain is 200. From Figure 9 It can be seen from this:

[0255] (1) The bivalent mRNA vaccine for COVID-19 prepared from samples 3-9 stimulated mice to produce antibodies against the popular COVID-19 Delta variant, COVID-19 Omicron BA.1 variant and COVID-19 Omicron BA.2 variant, which showed good neutralizing activity. The EC50 values ​​of the pseudovirus strains of the three strains were all higher than 200.

[0256] (2) As the proportion of mRNA encoding the S protein of the Omicron BA.2 variant of SARS-CoV-2 decreased and the proportion of mRNA encoding the S protein of the Delta variant of SARS-CoV-2 increased, the bivalent mRNA vaccines of SARS-CoV-2 prepared from samples 1-2 stimulated mice to produce antibodies against the popular Omicron BA.1 and Omicron BA.2 variants of SARS-CoV-2 with low neutralizing activity (<200), and antibodies against the Delta variant of SARS-CoV-2 with high neutralizing activity.

[0257] (3) As the proportion of mRNA encoding the S protein of the Delta variant of SARS-CoV-2 decreased and the proportion of mRNA encoding the S protein of the Omicron BA.2 variant of SARS-CoV-2 increased, the bivalent mRNA vaccine of SARS-CoV-2 prepared in samples 10-11 showed low neutralizing activity (<200) against antibodies against the popular Delta variant of SARS-CoV-2 in mice, and high neutralizing activity against antibodies against the Omicron BA.1 and Omicron BA.2 variants of SARS-CoV-2.

[0258] In summary, when the M1:M2 ratio was (1:9) to (9:1) (samples 3-9), the antibodies produced in mice stimulated by the bivalent mRNA vaccine for COVID-19 showed good neutralizing activity against the prevalent Delta variant, Omicron BA.1 variant, and Omicron BA.2 variant of COVID-19. Among these, the neutralizing activity was even better when the M1:M2 ratio was (1:1) to (9:1) (samples 6-9).

[0259] (II) Samples 12–22 are mRNA lipid nanoparticle vaccines encoding the Omicron BA.1 variant and the Delta variant of SARS-CoV-2, respectively, and are bivalent mRNA vaccines against SARS-CoV-2. Figure 10 It can be seen that:

[0260] (1) The bivalent mRNA vaccines for SARS-CoV-2 prepared from samples 14 to 20 can all stimulate mice to produce antibodies with neutralizing activity against the popular SARS-CoV-2 Delta variant, SARS-CoV-2 Omicron BA.1 variant and SARS-CoV-2 Omicron BA.2 variant.

[0261] (2) As the proportion of mRNA encoding the S protein of the Omicron BA.1 variant of SARS-CoV-2 decreased and the proportion of mRNA encoding the S protein of the Delta variant of SARS-CoV-2 increased, the bivalent mRNA vaccine of SARS-CoV-2 prepared from samples 12-13 stimulated mice to produce antibodies against the popular Omicron BA.1 and Omicron BA.2 variants of SARS-CoV-2 with low neutralizing activity (<200), and antibodies against the Delta variant of SARS-CoV-2 with high neutralizing activity.

[0262] (3) As the proportion of mRNA encoding the S protein of the Delta variant of SARS-CoV-2 decreased and the proportion of mRNA encoding the S protein of the Omicron BA.1 variant of SARS-CoV-2 increased, the bivalent mRNA vaccine of SARS-CoV-2 prepared in samples 21-22 showed low neutralizing activity (<200) against antibodies against the popular Omicron BA.1 variant and Delta variant of SARS-CoV-2, and high neutralizing activity against antibodies against the Omicron BA.2 variant of SARS-CoV-2.

[0263] In summary, when M1:M2 was (1:9) to (9:1) (samples 14 to 20), the antibodies produced by mice stimulated by the bivalent mRNA vaccine against the prevalent Delta variant, Omicron BA.1 variant, and Omicron BA.2 variant of SARS-CoV-2 showed good neutralizing activity; among them, when M1:M2 was (1:1) to (9:1) (samples 17 to 20), the neutralizing activity of the antibodies was even better.

[0264] (III) Samples of bivalent SARS-CoV-2 mRNA vaccines that exhibited good neutralizing activity against the prevalent Delta variant, Omicron BA.1 variant, and Omicron BA.2 variant of SARS-CoV-2 were selected from each experimental group. These samples included samples 6-9 and 17-20. The results were cross-compared. Figure 11 As shown.

[0265] The antibodies produced by mice stimulated by Sample 7 (M1:M2 = 3:1) and Sample 18 (M1:M2 = 3:1) showed good neutralizing activity against the prevalent SARS-CoV-2 Delta variant, SARS-CoV-2 Omicron BA.1 variant, and SARS-CoV-2 Omicron BA.2 variant. However, the neutralizing activity of the antibodies produced by Sample 7 against each mutant strain was superior to that of Sample 18. The mRNA encoding the S protein of the SARS-CoV-2 Omicron BA.2 variant is more advantageous than the mRNA encoding the S protein of the SARS-CoV-2 Omicron BA.1 variant in the preparation of bivalent mRNA vaccines for SARS-CoV-2.

[0266] Example 8

[0267] This embodiment provides a series of bivalent COVID-19 vaccines, and the preparation method is as follows:

[0268] (a) Prepared a lipid nanoparticle sample encoding the S protein of the Omicron BA.2 variant of SARS-CoV-2 according to the method of Example 1 (Seq_27).

[0269] (b) Prepared a lipid nanoparticle sample encoding the S protein of the Delta variant of SARS-CoV-2 according to the method in Example 1.2;

[0270] (c) Samples 2-1 to 2-11 of the bivalent mRNA vaccine for COVID-19 were prepared by mixing samples 2.1 and 2.2 in 11 ratios (1:15) to (15:1) as set in Example 7.

[0271] The aforementioned mRNA sequence features also include a 5' cap, a 5' UTR (as shown in Seq_1), a 3' UTR (as shown in Seq_2), and a 3' tail with 100 polyA lines (as shown in Seq_3).

[0272] The EC50 values ​​of the pseudovirus strains in samples 2-1 to 2-11 of the bivalent mRNA COVID-19 vaccine prepared in this example were tested according to the method in Example 7. The experimental results are as follows: Figure 12 As shown.

[0273] Example 9

[0274] This embodiment provides a series of bivalent COVID-19 vaccines, and the preparation method is as follows:

[0275] (a) Prepare a lipid nanoparticle sample encoding the S protein of the Omicron BA.1 variant of SARS-CoV-2 using the method described in Example 1 (Seq_17).

[0276] (b) Prepare mRNA (Seq_9) lipid nanoparticle samples encoding the S protein of the Delta variant of SARS-CoV-2 according to the method of Example 1 3.2;

[0277] (c) Samples 3.1 and 3.2 were mixed in 11 ratios (1:15) to (15:1) as set in Example 7 to prepare SARS-CoV-2 bivalent mRNA vaccine samples 2-12 to 2-22.

[0278] The aforementioned mRNA sequence features also include a 5' cap, a 5' UTR (as shown in Seq_1), a 3' UTR (as shown in Seq_2), and a 3' tail with 100 polyA lines (as shown in Seq_3).

[0279] The EC50 values ​​of the pseudovirus strains (samples 2-12 to 2-22) of the bivalent SARS-CoV-2 mRNA vaccine prepared in this example were tested according to the method in Example 7. The experimental results are as follows: Figure 13 As shown.

[0280] Example 10

[0281] Two samples of novel coronavirus vaccine lipid nanoparticles with an M1:M2 ratio of 3:1 were prepared according to the method described in Example 7. The two samples of novel coronavirus vaccine lipid nanoparticles contained 1) mRNA encoding the S protein of the Delta variant of the novel coronavirus (Seq_9) and mRNA encoding the S protein of the Omicron BA.2 variant of the novel coronavirus (Seq_27), respectively, denoted as sample a; 2) mRNA encoding the S protein of the Delta variant of the novel coronavirus (Seq_9) and mRNA encoding the S protein of the Omicron BA.1 variant of the novel coronavirus (Seq_17), denoted as sample b.

[0282] Lipid nanoparticles for the novel coronavirus vaccine with an M1:M2 ratio of 3:1 were prepared according to the method described in Example 8, and denoted as sample c.

[0283] Lipid nanoparticles for the novel coronavirus vaccine with an M1:M2 ratio of 1:1 were prepared according to the method described in Example 9, and denoted as sample d.

[0284] The aforementioned mRNA sequence features also include a 5' cap, a 5' UTR (as shown in Seq_1), a 3' UTR (as shown in Seq_2), and a 3' tail with 100 polyA lines (as shown in Seq_3).

[0285] The EC50 values ​​of the pseudovirus strains in the bivalent mRNA COVID-19 vaccine samples a, b, c, and d prepared in this example were tested according to the method in Example 7. The experimental results are as follows: Figure 14 As shown.

[0286] Example 11

[0287] The RNA molecule in the novel coronavirus vaccine provided in this embodiment has a fusion RNA structure, as shown below:

[0288] 5' cap - 5' UTR - (first coding region - linker sequence)n - (linker sequence - second coding region)m - 3' UTR - 3' polyA tail; n = 3, m = 1;

[0289] The nucleotide sequence of the first coding region is shown in Seq_9; the nucleotide sequence of the second coding region is shown in Seq_27.

[0290] The 5' cap is m7G(5')(2'-OMeA)pG; the 5' UTR is shown in Seq_1; the 3' UTR is shown in Seq_2; the 3' tail of 100 polyA is shown in Seq_3;

[0291] The linker sequences are all shown in Seq_45.

[0292] The above-mentioned fusion RNA was prepared into LNPs according to the preparation method provided in Example 1. The EC50 values ​​of the pseudovirus strains 2.3-1 to 2.3-11 of the bivalent SARS-CoV-2 mRNA vaccine samples prepared in this example were tested according to the method in Example 7. The experimental results are as follows: Figure 15 As shown.

[0293] Example 12

[0294] This embodiment provides a series of bivalent COVID-19 vaccines prepared according to the method described in Example 8. The mRNA reading frame sequences encoding the S protein of the Omicron BA.2 variant of COVID-19 and the mRNA reading frame sequences encoding the S protein of the Delta variant of COVID-19, as well as the M1:M2 values, are shown in the table below:

[0295] Table 6

[0296]

[0297] The EC50 values ​​of the pseudovirus strains in samples 2-1 to 2-11 of the bivalent mRNA COVID-19 vaccine prepared in this example were tested according to the method in Example 7. The experimental results are as follows: Figure 16 As shown.

[0298] Example 13

[0299] This embodiment provides a series of bivalent COVID-19 vaccines prepared according to the method described in Example 8. The mRNA reading frame sequences encoding the S protein of the Omicron BA.2 variant of COVID-19 and the mRNA reading frame sequences encoding the S protein of the Delta variant of COVID-19, as well as the M1:M2 values, are shown in the table below:

[0300] Table 7

[0301]

[0302] The EC50 values ​​of the pseudovirus strains in samples 2-1 to 2-11 of the bivalent mRNA COVID-19 vaccine prepared in this example were tested according to the method in Example 7. The experimental results are as follows: Figure 17 As shown.

[0303] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A SARS-CoV-2 vaccine, characterized in that, The SARS-CoV-2 vaccine comprises nucleic acid molecules containing a first open reading frame and a second open reading frame; The first open reading frame encodes the full-length S protein of the SARS-CoV-2 Delta variant, and the amino acid sequence of the full-length S protein is shown in SEQ ID NO.8; The second open reading frame encodes the full-length S protein of the SARS-CoV-2 Omeprón BA.2 variant, the amino acid sequence of which is shown in SEQ ID NO.26; The nucleic acid molecule is RNA, and the total GC content of the open reading frame portion of the RNA is 54%~60%, and the GC content of any 60bp fragment in the open reading frame is not less than 40%.

2. The SARS-CoV-2 vaccine according to claim 1, characterized in that, The SARS-CoV-2 vaccine comprises: a nucleic acid molecule containing a first open reading frame; and a nucleic acid molecule containing a second open reading frame; Alternatively, the SARS-CoV-2 vaccine may comprise a fusion nucleic acid molecule containing both a first open reading frame and a second open reading frame.

3. The SARS-CoV-2 vaccine according to claim 1, characterized in that, The RNA also includes one or more of the following: 5' cap, 5' UTR, 3' UTR, polyA tail, start region, stop region, signal sequence region, and linker sequence.

4. The SARS-CoV-2 vaccine according to claim 3, characterized in that, The RNA comprises, from the 5' end to the 3' end, the following sequence: 5' cap - 5' UTR - first open reading frame and / or second open reading frame - 3' UTR - 3' polyA tail.

5. The SARS-CoV-2 vaccine according to claim 3, characterized in that, The RNA contains a first open reading frame and a second open reading frame.

6. The SARS-CoV-2 vaccine according to claim 5, characterized in that, The RNA, from the 5' end to the 3' end, includes the following sequence: 5' cap - 5' UTR - start region - first open reading frame - linker sequence - second open reading frame - 3' UTR - stop region - 3' polyA tail.

7. The SARS-CoV-2 vaccine according to claim 5, characterized in that, The RNA comprises, from the 5' end to the 3' end, the following sequence: 5' cap - 5' UTR - (first open reading frame - linker sequence) n - (linker sequence - second open reading frame) m - 3' UTR - 3' polyA tail; n is the number of repetitions in the linker sequence of the first coding region of the segment; m is the number of repetitions in the linker sequence of the second coding region of the segment; n and m are independent positive integers.

8. The SARS-CoV-2 vaccine according to claim 3, characterized in that, The 5' cap is: m7G(5')(2'-OMeA)pG.

9. The SARS-CoV-2 vaccine according to claim 3, characterized in that, The sequence of the 5'UTR is shown in SEQ ID NO.

1.

10. The SARS-CoV-2 vaccine according to claim 3, characterized in that, The sequence of the 3'UTR is shown in SEQ ID NO.

2.

11. The SARS-CoV-2 vaccine according to claim 3, characterized in that, The sequence of the 3' polyA tail is shown in SEQ ID NO.

3.

12. The SARS-CoV-2 vaccine according to claim 3, characterized in that, The linker sequence contains protein cleavage signals.

13. The SARS-CoV-2 vaccine according to claim 12, characterized in that, The protein cleavage signal includes at least one cleavage signal from protein precursor convertase, hormone precursor convertase, thrombin, and factor Xa protease.

14. The SARS-CoV-2 vaccine according to claim 13, characterized in that, The protein cleavage signal is the Furin cleavage site.

15. The SARS-CoV-2 vaccine according to claim 14, characterized in that, The RNA nucleotide sequence of the Furin cleavage site is shown in SEQ ID NO.

7.

16. The SARS-CoV-2 vaccine according to claim 3, characterized in that, The linker sequence is a cleavable linker or a protease-sensitive linker.

17. The SARS-CoV-2 vaccine according to claim 16, characterized in that, The cuttable connector includes an F2A connector, a P2A connector, a T2A cuttable connector, or an E2A cuttable connector.

18. The SARS-CoV-2 vaccine according to claim 3, characterized in that, The nucleotide sequence of the first open reading frame is shown in SEQ ID NO.9, SEQ ID NO.47, SEQ ID NO.48, SEQ ID NO.49, SEQ ID NO.50, SEQ ID NO.51, SEQ ID NO.52, SEQ ID NO.53 or SEQ ID NO.

54.

19. The SARS-CoV-2 vaccine according to claim 3, characterized in that, The second open reading frame encodes the SARS-CoV-2 Omeprón variant as the BA.2 sub-variant; the nucleotide sequence of the second open reading frame is shown in SEQ ID NO.15, SEQ ID NO.27, SEQ ID NO.32, SEQ ID NO.55, SEQ ID NO.56, SEQ ID NO.57, SEQ ID NO.58, SEQ ID NO.59, SEQ ID NO.60 or SEQ ID NO.

46.

20. The SARS-CoV-2 vaccine according to claim 3, characterized in that, The nucleotide sequence of the first open reading frame is selected from one of SEQ ID NO. 9, SEQ ID NO. 47, SEQ ID NO. 48, SEQ ID NO. 49, SEQ ID NO. 50, SEQ ID NO. 51, SEQ ID NO. 52, SEQ ID NO. 53 or SEQ ID NO. 54 expressing the Delta variant S protein; and the nucleotide sequence of the second open reading frame is selected from one of SEQ ID NO. 15, SEQ ID NO. 27, SEQ ID NO. 32, SEQ ID NO. 55, SEQ ID NO. 56, SEQ ID NO. 57, SEQ ID NO. 58, SEQ ID NO. 59, SEQ ID NO. 60 or SEQ ID NO. 46 expressing the Omega BA.2 variant S protein.

21. The SARS-CoV-2 vaccine according to claim 3, characterized in that, The combination of the first open reading frame and the second reading frame is selected from: SEQ ID NO.9 and SEQ ID NO.27; SEQ ID NO.47 and SEQ ID NO.32; SEQ ID NO.48 and SEQ ID NO.55; SEQ ID NO.49 and SEQ ID NO.56; SEQ ID NO.50 and SEQ ID NO.57; SEQ ID NO.51 and SEQ ID NO.58; SEQ ID NO.52 and SEQ ID NO.59; SEQ ID NO.53 and SEQ ID NO.60; SEQ ID NO.54 and SEQ ID NO.46; SEQ ID NO.54 and SEQ ID NO.60; SEQ ID NO.53 and SEQ ID NO.55; SEQ ID NO.52 and SEQ ID NO.56; SEQ ID NO.51 and SEQ ID NO.57; SEQ ID NO.50 and SEQ ID NO.32; SEQ ID NO.49 and SEQ ID NO.59; SEQ ID NO.48 and SEQ ID NO.60; or, SEQ ID NO.47 and SEQ ID NO.27; SEQ ID NO.47 and SEQ ID NO.32; SEQ ID NO.49 and SEQ ID NO.59; SEQ ID NO.48 and SEQ ID NO.60; or, SEQ ID NO.47 and SEQ ID NO.27; SEQ ID NO.47 and SEQ ID NO.32; SEQ ID NO.49 and SEQ ID NO.59; SEQ ID NO.48 and SEQ ID NO.60; or, SEQ ID NO.47 and SEQ ID NO.27; SEQ ID NO.48 ...59; SEQ ID NO.49 NO.

58.

22. The SARS-CoV-2 vaccine according to any one of claims 1-21, characterized in that, The mass ratio of nucleic acid molecules containing the first open reading frame to nucleic acid molecules containing the second open reading frame is (1:9) to (9:1).

23. The SARS-CoV-2 vaccine according to claim 22, characterized in that, The mass ratio of nucleic acid molecules containing the first open reading frame to nucleic acid molecules containing the second open reading frame is (1:1) to (9:1).

24. The SARS-CoV-2 vaccine according to claim 23, characterized in that, The mass ratio of nucleic acid molecules containing the first open reading frame to nucleic acid molecules containing the second open reading frame is 3:

1.

25. The SARS-CoV-2 vaccine according to any one of claims 1-21, characterized in that, The nucleic acid molecule is a fusion nucleic acid molecule, and the number of repetitions of the first open reading frame and the second open reading frame in the fusion nucleic acid molecule is (1:9) to (9:1).

26. The SARS-CoV-2 vaccine according to claim 25, characterized in that, The number of repetitions of the first and second open reading frames in the fusion nucleic acid molecule is (1:1) to (9:1).

27. The SARS-CoV-2 vaccine according to claim 26, characterized in that, The ratio of the first open reading frame to the second open reading frame in the fused nucleic acid molecule is 3:

1.

28. The SARS-CoV-2 vaccine according to any one of claims 1-21, characterized in that, The vaccine also includes a delivery formulation.

29. The SARS-CoV-2 vaccine according to claim 28, characterized in that, The SARS-CoV-2 vaccine contains nucleic acid lipid nanoparticles composed of the nucleic acid molecules and lipid components.

30. The SARS-CoV-2 vaccine according to claim 29, characterized in that, The SARS-CoV-2 vaccine mentioned is selected from (a), (b), or (c): (a) The SARS-CoV-2 vaccine comprises: nucleic acid lipid nanoparticles encapsulating nucleic acid molecules containing a first open reading frame, and nucleic acid lipid nanoparticles encapsulating nucleic acid molecules containing a second open reading frame; (b) The SARS-CoV-2 vaccine comprises: nucleic acid lipid nanoparticles encapsulating a nucleic acid molecule containing a first open reading frame and a nucleic acid molecule containing a second open reading frame; (c) The SARS-CoV-2 vaccine comprises: nucleic acid lipid nanoparticles encapsulating fusion nucleic acid molecules containing both a first open reading frame and a second open reading frame.

31. The SARS-CoV-2 vaccine according to claim 30, characterized in that, The mass ratio of nucleic acid molecules containing the first open reading frame to nucleic acid molecules containing the second open reading frame is (1:9) to (9:1).

32. The SARS-CoV-2 vaccine according to claim 31, characterized in that, The mass ratio of nucleic acid molecules containing the first open reading frame to nucleic acid molecules containing the second open reading frame is (1:1) to (9:1).

33. The SARS-CoV-2 vaccine according to claim 32, characterized in that, The mass ratio of nucleic acid molecules containing the first open reading frame to nucleic acid molecules containing the second open reading frame is 3:

1.

34. The SARS-CoV-2 vaccine according to claim 30, characterized in that, The nucleic acid molecule is a fusion nucleic acid molecule, and the number of repetitions of the first open reading frame and the second open reading frame in the fusion nucleic acid molecule is (1:9) to (9:1).

35. The SARS-CoV-2 vaccine according to claim 34, characterized in that, The number of repetitions of the first and second open reading frames in the fusion nucleic acid molecule is (1:1) to (9:1).

36. The SARS-CoV-2 vaccine according to claim 35, characterized in that, The ratio of the first open reading frame to the second open reading frame in the fused nucleic acid molecule is 3:

1.

37. The SARS-CoV-2 vaccine according to claim 30, characterized in that, The lipid composition, by molar percentage, comprises 20%–50% protonable cationic lipids, 20%–50% structural lipids, 5%–20% accessory lipids, and 1%–5% surfactants, wherein the total molar content of protonable cationic lipids, structural lipids, accessory lipids, and surfactants is 100%.

38. The SARS-CoV-2 vaccine according to claim 37, characterized in that, The protonable cationic lipids include at least one of DlinMC3-DMA, DODMA, C12-200, and DlinDMA.

39. The SARS-CoV-2 vaccine according to claim 37, characterized in that, The assisting lipids include at least one of DSPC, DOPE, DOPC, DOPG, and DOPS.

40. The SARS-CoV-2 vaccine according to claim 37, characterized in that, The structural lipids include cholesterol.

41. The SARS-CoV-2 vaccine according to claim 37, characterized in that, The surfactant includes at least one of PEG-DMG, PEG-DSPE and TPGS.

42. The SARS-CoV-2 vaccine according to claim 37, characterized in that, The lipid composition, by molar percentage, includes 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG.

43. The SARS-CoV-2 vaccine according to claim 37, characterized in that, The lipid composition comprises, by molar percentage, 50% Dlin-MC3-DMA, 20% DOPG, 29% cholesterol, and 1% PEG-DMG.

44. The method for preparing the SARS-CoV-2 vaccine according to any one of claims 1-43, characterized in that, This includes mixing the nucleic acid molecules to obtain the SARS-CoV-2 vaccine.

45. The method for preparing the SARS-CoV-2 vaccine according to claim 44, characterized in that, This includes mixing the nucleic acid molecules with excipients to obtain the SARS-CoV-2 vaccine.

46. ​​The preparation method according to claim 45, characterized in that, The SARS-CoV-2 vaccine comprises nucleic acid lipid nanoparticles, and the preparation method includes: Nucleic acid lipid nanoparticles containing nucleic acid molecules with a first open reading frame and nucleic acid lipid nanoparticles containing nucleic acid molecules with a second open reading frame were prepared separately; then the two types of nucleic acid lipid nanoparticles were mixed according to the formulation amount. Alternatively, nucleic acid molecules containing a first open reading frame and nucleic acid molecules containing a second open reading frame can be mixed according to the formula amount, and then nucleic acid lipid nanoparticles containing the two nucleic acid molecules can be prepared. Alternatively, prepare nucleic acid lipid nanoparticles containing nucleic acid molecules that simultaneously contain a first open reading frame and a second open reading frame.

47. The preparation method according to claim 46, characterized in that, The nucleic acid lipid nanoparticles were prepared according to the following method: A mixture containing nucleic acid molecules and an organic phase containing lipid components are mixed evenly to obtain a mixture. After removing the organic phase, the concentration of RNA in the system is adjusted to 1~100 μg / ml to obtain the nucleic acid lipid nanoparticles. The aqueous phase is an aqueous buffer containing 0.08~1.2 mg / L nucleic acid molecules, and the aqueous buffer is citrate buffer or sodium acetate buffer. The organic phase is an anhydrous C1-C4 low carbon alcohol containing 5-7 mg / L of the lipid component; The volume ratio of the aqueous phase to the organic phase is 1:2~4.

48. The use of the SARS-CoV-2 vaccine according to any one of claims 1-43 or the SARS-CoV-2 vaccine prepared by the preparation method according to any one of claims 44-47 in the preparation of products for the prevention of disease caused by SARS-CoV-2.

49. A product for the prevention of disease caused by SARS-CoV-2, characterized in that, It includes the SARS-CoV-2 vaccine as described in any one of claims 1-43.

Images