Recombinant bacteria of double transcription unit mediated by cox and alginate lyase and application thereof
By constructing a double transcription unit recombinant strain in Pichia pastoris and using GAP and AOX promoters to express cooxygen protein and alginate lyase, the problem of oxygen supply limitation in high-density fermentation was solved, and the high-efficiency expression and high-density fermentation preparation of the target protein were achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- OCEAN UNIV OF CHINA
- Filing Date
- 2023-12-18
- Publication Date
- 2026-06-23
Smart Images

Figure CN117701410B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a recombinant bacterium with a dual transcription unit that mediates cooxygen protein and alginate lyase, and its application. Background Technology
[0002] Pichia pastoris has been successfully used as a basic strain to express more than 400 recombinant proteins for pharmaceutical, agricultural and other fields, making it one of the commonly used protein expression systems. Compared with Escherichia coli and Bacillus subtilis expression systems, it can achieve efficient secretory expression, without the need for extensive subsequent isolation and purification of target proteins. The exogenous gene is integrated into the genome for stable expression and can easily achieve high-density fermentation to prepare the target product.
[0003] Because Pichia pastoris is a highly aerobic microorganism, its cell density and the rate of methanol oxidative degradation are often limited by the oxygen supply capacity of the equipment during current high-density fermentation processes, thus affecting the expression level of the target protein. Vitreoscilla hemoglobin (VHb) is an intracellular soluble oxygen substance similar to human hemoglobin, with a molecular weight of approximately 15.47 kDa. Transduction of VHb into yeast can enhance the oxygen utilization capacity of VHb engineered bacteria in the low-oxygen environment of high-density fermentation, thereby increasing the expression level of the target protein.
[0004] The current main mode of expressing VHb protein in engineered Pichia pastoris involves tandemly linking the target protein and VHb protein genes, utilizing the alcohol oxidase promoter (AOX) on the vector to control the expression of the exogenous protein in the host. Expressing two genes in a single transcription unit can easily lead to insufficient expression of the target gene, which is far from the promoter. Summary of the Invention
[0005] This invention addresses the problem of insufficient expression of dual genes by a single promoter by providing a recombinant engineered bacterium expressing cooxygen protein VHb and alginate lyase using a dual transcription unit, and its application. By constructing a dual transcription unit expression pattern, the cloned *Vibrio hygroscopicus* hemoglobin gene Vgb is secreted extracellularly using the GAP promoter, and the alginate lyase gene is expressed using the AOX promoter, thereby improving the bacterial cell's ability to express VHb and ultimately increasing the yield of alginate lyase.
[0006] The objective of this invention is achieved through the following technical solution:
[0007] A recombinant bacterium with two transcription units mediating cooxygenin and alginate lyase, wherein the recombinant engineered bacterium consists of two transcription units, one being GAP-α-Vgb-AOX1TT and the other being AOX-α-102C300C-AOX1TT, and the two transcription units are expressed in tandem in the pPICZαA plasmid.
[0008] The nucleotide sequence of the cooxygenin Vgb gene is SEQ ID NO.1; the nucleotide sequence of the transcription unit GAP-α-AOX1TT is SEQ ID NO.2; and the nucleotide sequence of the alginate lyase is SEQ ID NO.3.
[0009] In one preferred embodiment, the recombinant bacteria are prepared by ligating the cooxygenin gene Vgb to the pGAPZαA plasmid to construct the pGAPZαA-Vgb recombinant plasmid, PCR amplifying the GAP-α-Vgb-AOX1TT fragment from the pGAPZαA-Vgb plasmid genome, and then ligating GAP-α-Vgb-AOX1TT to the BglII site of pPICZαA-102C300C to form a double transcription unit, which is then secreted and expressed in a eukaryotic expression system.
[0010] The eukaryotic expression system is preferably Pichia pastoris. More preferably, it is Pichia pastoris X33.
[0011] This invention also proposes the application of the recombinant bacteria in enhancing the secretion and expression of alginate lyase.
[0012] The advantages of this invention compared to the prior art are as follows:
[0013] 1. This invention expresses the co-expression vector of the co-oxygen protein Vgb gene (SEQ ID NO.1) and the alginate lyase gene (SEQ ID NO.3) using the GAP promoter, thereby improving the secretory expression of alginate lyase-producing engineered bacteria in a hypoxic environment.
[0014] 2. This invention provides a co-oxygen protein particle construction mode that can improve the utilization rate of oxygen by bacteria in a low-oxygen environment and achieve high expression of alginate lyase, especially providing an effective element for Pichia pastoris to express the alginate lyase gene. Attached Figure Description
[0015] Figure 1 This is a schematic diagram of the construction of the pPICZαA-102C300C-GAP-α-Vgb recombinant plasmid in Example 1;
[0016] Figure 2 This is an electrophoresis image of the amplified Vgb gene in Example 1; lane M: marker DNA; lane 1: Vgb gene fragment;
[0017] Figure 3This is an electrophoresis diagram of the GAP-α-Vgb-AOX1TT fragment amplified in Example 1; where lane M: marker DNA; lane 1 is the GAP-α-Vgb-AOX1TT fragment;
[0018] Figure 4 This is a comparison of the dry weight of the engineered bacteria that constructed the co-oxygen protein gene Vgb in Example 2 compared with the control group before modification;
[0019] Figure 5 This is a comparison of the activity of alginate lyase in the engineered bacteria with the co-oxygen protein gene Vgb constructed in Example 2 compared to the control group before modification. Detailed Implementation
[0020] The present invention will be further described in detail below with reference to embodiments, but the embodiments of the present invention are not limited thereto.
[0021] The molecular biology experimental techniques used in the following examples include PCR amplification, plasmid extraction, DNA fragment ligation, gel electrophoresis, etc. For details, please refer to "Molecular Cloning: A Laboratory Manual" (3rd Edition) (translated by Sambrook J, Russell DW, Janssen K, Argentine J, Huang Peitang et al., 2002, Beijing: Science Press).
[0022] Example 1: Construction and screening of recombinant engineered bacteria containing co-oxygen protein
[0023] The cooxygenin gene Vgb was constructed into the pGAPZαA plasmid using a one-step cloning method. The nucleotide sequence of the cooxygenin Vgb gene is shown in SEQ ID NO.1, forming the pGAPZαA-Vgb plasmid. Subsequently, the GAP-α-Vgb-AOX1TT fragment was amplified by PCR and ligated into the expression vector pPICZαA-102C300C plasmid for the alginate lyase gene, thus constructing the pPICZαA-102C300C-GAP-α-Vgb plasmid. Using high-throughput screening methods, the positive clone with the highest alginate lyase activity was obtained from the clones. The specific steps include:
[0024] (1) Extraction and purification of the Vgb gene: plasmid of pUC57-FHb strain was extracted ( Plasmid
[0025] The DNA Mini Kit D6942 was used to amplify the Vgb gene from the pUC57-Vgb plasmid genome using two artificially synthesized fragments, SEQ ID NO.4 (5'-agagaggctgaagctgaattcatgttggaccagcagaccatca-3') and SEQ ID NO.5 (5'-tgttctagaaagctggcggccgcttactcaacagcctgagcgtaca-3'). Nucleic acid electrophoresis was used for verification (see [link to kit]). Figure 2 ) and purify ( The Gel Extraction Kit recovers the target fragment for later use.
[0026] (2) Enzyme digestion of linearized pGAPZαA plasmid: The pGAPZαA plasmid was double-digested with NotI (TaKaRa) and EcoRI (TaKaRa) to obtain a linearized vector fragment. The linearized vector was digested with Fast Digest Dpn I, and the processed fragment was purified using a purification kit. The purified product (Cycle Pure Kit D6492) was then recycled for later use.
[0027] (3) Construction and validation of pGAPZαA-Vgb plasmid: Using the Clon Express II One-Step Cloning Kit, the recombinant gene and the linearized pGAPZαA fragment DNA were appropriately diluted and ligated. The ligated system was then transformed into E. coli DH5α by heat shock, and then plated on LB (Zeocin) plates for screening of positive recombinants. The constructed vector was validated by single-clone sequencing using universal primers for the pGAPZαA vector.
[0028] (4) Amplification and purification of the GAP-α-Vgb-AOX1TT fragment: plasmids were extracted from the pGAPZαA-Vgb strain ( The Plasmid DNAMini Kit D6942 was used to amplify the GAP-α-Vgb-AOX1TT fragment from the pGAPZαA-Vgb plasmid genome using two artificially synthesized fragments, SEQ ID NO. 6 (5'-tttggtcatgagatcagatcttttttgtagaaatgtcttggtgtcct-3') and SEQ ID NO. 7 (5'-tcgtctttggatgttagatctgcacaaacgaaggtctcacttaatc-3'). Nucleic acid electrophoresis was used for verification (see [link to kit]). Figure 3 ) and purify ( The Gel Extraction Kit recovers the target fragment for later use.
[0029] (5) Enzyme digestion of linearized pPICZαA-102C300C plasmid: The pPICZαA-102C300C plasmid was digested with BglII (TaKaRa) to obtain a linearized vector fragment. The linearized vector was digested with Fast Digest DpnI, and the processed fragment was purified using a purification kit. The purified product (Cycle Pure Kit D6492) was then recycled for later use.
[0030] (6) Construction and verification of pPICZαA-102C300C-GAP-α-Vgb plasmid: Using DNA seamless cloning (ClonExpress II One Step Cloning Kit), the DNA concentrations of the GAP-α-Vgb-AOX1TT fragment and the linearized pPICZαA-102C300C fragment were appropriately diluted and recombined. The ligated system was then transformed into E. coli DH5α by heat shock and then plated on LB (Zeocin) plates for screening of positive recombinants.
[0031] (7) Construction of Pichia pastoris strain X33-pPICZαA-102C300C-GAP-α-Vgb: Plasmids were extracted after activating correctly sequenced transformants. The Plasmid DNA Mini Kit D6942 was used to linearize the cloning vector and then electroporate it into Pichia pastoris strain X33 to construct the Pichia pastoris strain X33-pPICZαA-102C300C-GAP-α-Vgb.
[0032] (8) High-throughput screening of recombinant strains: Positive transformants were selected and cultured in 48-well deep-well plates, with 1 mL of BMGY liquid medium added to each well. Induction was performed at 30℃ and 200 rpm, with 1% methanol added every 24 h for 3 consecutive days. After centrifugation at 4000 rpm for 5 min, the supernatant was collected for alginate lyase activity detection to screen for strains with high enzyme activity.
[0033] Co-oxygenin gene Vgb SEQ ID NO.1
[0034] atgttggaccagcagaccatcaacatcatcaaggctaccgttccagtcttgaaagaacacggtgttactatcaccaccaccttctacaagaacctgttcgctaagcacccagaggttagaccactgttcgatatgggtagacaagagtctttggagcagcctaaggctttggctatgactgttttggctgctgctcagaacatcgagaacttgccagctattttgccagccgttaagaagatcgccgttaagcactgtcaagctggtgttgctgctgcacattacccaatcgttggtcaagagttgctgggtgccatcaaagaagttttaggcgacgctgctactgacgacattttggatgcttggggtaaagcctacggtgttatcgctgacgttttcatccaagttgaggctgacttgtacgctcaggctgttgagtaa。
[0035] Nucleotide sequence of transcription unit GAP-α-AOX1TT (SEQ ID N0.2):
[0036]
[0037] Nucleotide sequence of alginate lyase (SEQ ID NO.3):
[0038] actgaatctggttctggttcttcttctggtggttcttcctccggatcttcttcttcctcatcctcttccggtggatcatcctctggtggatcaggtggtagtagttcaggtggatctttggacccaaacttgccaccatcttccaacttcgatttgtccgcttggtacttgtccgttccaactgataacaacggtgacggtaaggccgactccatcaaagaaaacgatttgaacgctggttacgccgacggtacttacttttacactgctgctgatggtggtatggtgttcagatgtccaatctgtggttacaagacttctaccaacacctcctacaccagaaccgagttgagagaaatgctgagaagaggtgacacctccattgctactcaaggtgtcaacggtaacaactgggttttcggttctgctccagcttccgctagagaagctgctggtggtgtagatggtgttttgagagctactttggccgttaaccacgttactactactggtgactctggtcaggttggtagagttatcgttggtcagatccacgctaacaacgacgaaccattgagactgtactacagaaagttgccaggtcactccaagggttccgtttacattgctcatgaacctaacggtggttccgactcttggtacgacatgattggttctagatcctcctctgcttctgacccatctgacggtattgctttggacgaagtttggtcctacgaggttaaggttgtcggtaacactttgaccgtgaccatcttcagagctggtaaggacgacgttgttcaggttgttgacatgggtaactccggttacgatgttgctgaccagtaccagtacttcaaggccggtgtttacaaccagaacaatactggtaactgttccgactacgttcaggttactttctacgctttggagcaatctcacgatcatcatcaccatcaccactaa。
[0039] Example 2: Evaluation of growth and enzyme production levels of strains containing cooxygenin
[0040] (1) The strain X33-102C300C before construction and the strain X33-102C300C-GAP-α-Vgb-AOX1TT after construction were inoculated into 20 mL of liquid YPD medium and cultured at 37℃ and 200 r / min for 24 h to obtain seed culture.
[0041] (2) Add 1 mL of seed culture to 20 mL of BMGY medium. Add 1% methanol every 24 h to induce enzyme production. Induce production for a total of 5 times. For the first four days, culture at 30℃ and 200 r / min with shaking. For the next two days, culture at 30℃ and 50 r / min with shaking. Every 24 h, take 2 mL of bacterial culture and centrifuge at 5000 r / min for 5 min. Measure the dry weight of the precipitate and determine the enzyme activity of the supernatant. In this example, a low-oxygen environment was created by reducing the shaking speed during fermentation.
[0042] (3) Take a clean, flat glass weighing bottle, place it in a 105℃ drying oven, with the bottle cap tilted against the side of the bottle, heat for 2 hours, take it out and cover it, place it in a desiccator to cool for 0.5 hours, weigh it, and repeat the drying process until the difference between the two weighings does not exceed 2 mg, which is constant weight.
[0043] (4) The enzyme activity of alginate lyase was determined by the DNS method. The enzyme activity unit is defined as: 1 enzyme activity unit (U) is defined as the amount of enzyme required to produce 1 μmol of reducing sugar per 1 min.
[0044] (5) Determination of dry weight of Pichia pastoris cells and activity of alginate lyase: Compared with the control group (15.575 g / L), the dry weight of the engineered Pichia pastoris strain producing alginate lyase mediated by the dual promoter expression system was 19.2 g / L after 144 h of fermentation. As the fermentation speed decreased after 96 h, the cell mass of the modified strain showed an increasing trend compared with the original strain (see...). Figure 4 Co-oxygen protein VHb increased the production of alginate lyase in Pichia pastoris from 12.3015 U / mL to 14.5736 U / mL in a hypoxic environment, an increase of 15.6% (see [link to relevant documentation]). Figure 5 ).
Claims
1. A recombinant bacterium with a dual transcription unit mediating cooxygenase and alginate lyase. , Its features are, The recombinant engineered bacteria consist of two transcription units, one of which is GAP-α- Vgb -AOX1TT, another transcription unit is AOX-α-102C300C-AOX1TT, and the two transcription units are expressed in tandem in the pPICZαA plasmid; cooxygenin Vgb The nucleotide sequence of the gene is SEQ ID NO.1; the nucleotide sequence of the transcription unit GAP-α-AOX1TT is SEQ ID NO.2; and the nucleotide sequence of the alginate lyase is SEQ ID NO.
3. The method for preparing the recombinant bacteria is to extract the gene of cooxygenin. Vgb Linked to pGAPZαA plasmid to construct pGAPZαA- Vgb Recombinant plasmid, from pGAPZαA- Vgb PCR amplification of GAP-α- in plasmid genome Vgb -AOX1TT fragment, then GAP-α- Vgb- AOX1TT connects to pPICZαA- 102C300C At the BglII site, a double transcription unit is formed, which is then secreted and expressed in a eukaryotic expression system; the eukaryotic expression system is Pichia pastoris X33.
2. The application of the recombinant bacteria according to claim 1 in enhancing the secretion and expression of alginate lyase.