A strain of Pantoea pineapple FY611 and its application and biocontrol agent

Abstract

The present invention relates to the field of biological control technology, and in particular to a strain of Pantoea pineapple FY611 and its application and biocontrol agent. The Pantoea pineapple FY611 provided by the present invention is an indispensable and important bacterial resource, which can be used to create a biological pesticide preparation and has great application value in the green prevention and control of the recently outbreak of rice bacterial blight. The Pantoea pineapple FY611 was deposited in the China General Microbiological Culture Collection Center on November 6, 2023, with a deposit number of CGMCC No. 28885.

Description

Technical Field

[0001] The invention relates to the technical field of biological control, in particular to a Pantoea anacardiae FY611 strain and an application thereof and a biological control agent. Background Art

[0002] Pantoea ananatis is a Gram-negative enterobacterium that is widely found in water, soil, plant surfaces, plant seeds, wounds and body fluids of humans and animals. It is generally believed that Pantoea ananatis is a plant endophyte or saprophytic bacterium that can promote plant growth and increase plant yield; enhance plant systemic resistance and improve plant tolerance to biotic and abiotic adversities. However, studies in recent years have shown that Pantoea ananatis is also a very important plant pathogenic bacterium that can infect a variety of monocotyledonous and dicotyledonous plants such as pineapple, onion, cantaloupe, Pleurotus eryngii, eucalyptus, wheat, corn and rice, causing a variety of symptoms such as lesions, wilting, and fruit rot on leaves and stems, triggering the spread of new diseases.

[0003] Especially on rice, there are reports in China, Japan, South Korea, India, Thailand, Malaysia, Russia, Italy, Turkey, Australia, Benin, and Togo that Pantoea ananasinensis has caused rice leaf spots, wilt, stem necrosis, sheath rot, palea browning, grain discoloration and other symptoms. It is a newly emerging pathogen that can cause serious diseases in rice. However, there are also reports that Pantoea ananasinensis LY01 is effective against Xanthomonas oryzae pv.oryzae PXO99, the pathogen that causes rice bacterial leaf blight. A , Xanthomonas oryzae pv.oryzicola RS105 and Rhizoctonia solani Kühn YWK196, protecting rice from the three pathogens. The mechanism of the transformation of Pantoea pineapple between beneficial bacteria and pathogenic bacteria is not very clear, and may be affected by factors such as strain type, variety characteristics, physiological state and field microclimate conditions.

[0004] Rice bacterial blight is one of the most important rice bacterial diseases in the world, generally causing a 10%-30% reduction in yield, or a 50% reduction or even a total crop failure in severe cases. It was prevalent in various rice-growing areas in my country from the 1970s to the 1990s. After the 1990s, due to the widespread planting of disease-resistant varieties and the use of chemical agents for prevention and control, bacterial blight occurred sporadically. In recent years, due to the continuous evolution of pathogenic bacteria and the emergence of new epidemic strains, the varieties have lost their disease resistance, and bacterial blight has become a "new disease" and has broken out in the middle and lower reaches of the Yangtze River and the rice-growing areas of South China. On the other hand, the long-term use of chemical agents has produced drug resistance and polluted the environment. Biological control has the advantages of being environmentally friendly, low toxicity, low residue, and not easy to produce drug resistance. For the new epidemic strains of bacterial blight, screening specific microbial resources and creating microbial pesticides are the greenest and most effective ways to solve this production problem in my country, thereby providing effective support for ensuring national food security. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a strain of Pantoea anacardiae FY611 and its application and biocontrol agent. The Pantoea anacardiae FY611 provided by the present invention is an indispensable and important bacterial resource, which can be used to create a biological pesticide preparation and has great application value in the green prevention and control of the recently outbreak of rice bacterial blight.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides a strain of Pantoea ananatis FY611, which was deposited in the China General Microbiological Culture Collection Center on November 6, 2023, with a deposit number of CGMCC No.28885.

[0008] The present invention also provides the use of Pantoea anacardiae FY611 described in the above technical solution in preventing and controlling rice bacterial blight.

[0009] The present invention also provides the use of Pantoea ananas FY611 described in the above technical solution in inhibiting the pathogenic variety LA20 of Xanthomonas oryzae.

[0010] The present invention also provides the use of Pantoea ananas FY611 described in the above technical solution in inhibiting the growth of Xanthomonas oryzae pathological variant LA20.

[0011] The present invention also provides the use of Pantoea ananas FY611 described in the above technical solution in inhibiting the pathogenicity of Xanthomonas oryzae pathological strain LA20.

[0012] The present invention also provides a biocontrol agent for preventing and treating bacterial blight, wherein the biocontrol agent contains the Pantoea anacardiae FY611 described in claim 1.

[0013] Preferably, the concentration of the bacterial solution of Pantoea anacardiae FY611 in the biocontrol agent is not less than 1×10 8 cfu / mL.

[0014] The beneficial effects of the present invention are:

[0015] The Pantoea pineapple strain FY611 provided by the invention can significantly inhibit the growth and pathogenicity of LA20, and can be used for developing a disease prevention and control preparation for preventing and controlling bacterial blight. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Colony morphology of Pantoea ananas FY611 on NA medium;

[0017] Figure 2 Colony PCR amplified 16S rRNA, gyrB and rpoB genes of Pantoea ananas FY611, M: DNA 2000bp marker;

[0018] Figure 3 Inhibition of the growth and pathogenicity of Pantoea anacardiae FY611 on the new epidemic strain LA20 of Xanthomonas oryzae pv. oryzae. AB: The inhibition zone and size of FY611 on LA20 after 96 h of culture on NA medium; CD: The lesion and length of Zhongzao 39 two weeks after mixed inoculation of LA20 and FY611. Standard deviation is the mean square error of three biological replicates, **p<0.01, Student's t-test.

[0019] Biological Deposit Description

[0020] Pantoea ananatis FY611, Latin name Pantoea ananatis, was deposited in the China General Microbiological Culture Collection on November 6, 2023, with the deposit number CGMCC No.28885. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101. DETAILED DESCRIPTION

[0021] The present invention provides a strain of Pantoea ananatis FY611, which was deposited in the China General Microbiological Culture Collection Center on November 6, 2023, with a deposit number of CGMCC No.28885. In the present invention, the pineapple bacteria that inhibits the growth and pathogenicity of Xanthomonas oryzae pv. oryzae Strain, LA20 (Hou Y., et al.. Complete Genomic Sequence of Xanthomonas oryzae pv. oryzae Strain, LA20, for Studying Resurgence of Rice Bacterial Blight in the Yangtze River Region, China, Int. J. Mol. Sci., 2023, 24 (9): 8132.) is naturally isolated from rice leaves, and morphological and molecular identification is performed on it. The strain is named pineapple bacteria FY611, which belongs to the prokaryotes (procaryotae), bacteria (bacteria), gammaproteobacteria (gammaproteobacteria), Enterobacterales (Enterobacterales), Erwiniaceae (Erwiniaceae), Pantoea (Pantoea), and pineapple bacteria (Pantoea ananatis).

[0022] The present invention also provides the use of Pantoea anacardiae FY611 described in the above technical solution in preventing and controlling rice bacterial blight.

[0023] The present invention also provides the use of Pantoea ananas FY611 described in the above technical solution in inhibiting the pathogenic variety LA20 of Xanthomonas oryzae.

[0024] The present invention also provides the use of Pantoea ananas FY611 described in the above technical solution in inhibiting the growth of Xanthomonas oryzae pathological variant LA20.

[0025] The present invention also provides the use of Pantoea ananas FY611 described in the above technical solution in inhibiting the pathogenicity of Xanthomonas oryzae pathological strain LA20.

[0026] The present invention also provides a biocontrol agent for preventing and controlling bacterial blight, wherein the biocontrol agent contains the Pantoea anacardiae FY611 described in claim 1. In the present invention, the bacterial liquid concentration of the Pantoea anacardiae FY611 in the biocontrol agent is preferably not less than 1×10 8 The present invention has no special limitation on the preparation method of the biocontrol agent, and a conventional method for culturing Pantoea ananas can be used.

[0027] In order to further illustrate the present invention, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0028] The culture medium and reagent components involved in the following embodiments include:

[0029] NA solid medium: 5 g polypeptone, 1 g yeast powder, 3 g beef extract, 15 g sucrose, 15 g agar, distilled water to 1 L. Autoclave at 121°C for 20 min.

[0030] M210 liquid medium: 4g yeast extract, 8g casein hydrolyzate, 5g sucrose, 0.3g MgSO4.7H2O, distilled water to 1L. 121℃, autoclave for 20min.

[0031] Example 1

[0032] Isolation, identification, purification and preservation of strain FY611

[0033] 1. Isolation of strain FY611

[0034] In 2021, bacterial blight broke out in a large area of ​​Zhejiang's main rice varieties, such as Yongyou 1540. Collect leaves of rice varieties that are not diseased, cut 2-3 cm, put them in 75% alcohol for 1 minute, 1% sodium hypochlorite solution for 3-5 minutes, and then rinse them three times with sterile water; then add 1 mL of sterile water, squeeze the cut leaves with tweezers, and absorb 100 μL of the squeezed liquid according to 10 1 -10 8 Finally, spread 100 μL of each gradient isocratic dilution on NA medium plates, culture at 28°C for 16-24h, and observe and record the characteristics of single colonies.

[0035] 2. Identification of strain FY611

[0036] (1) Morphological identification

[0037] After 16-24h of culture on NA medium, the single colonies of strain FY611 were yellow, round and convex with smooth edges ( Figure 1 The cells are rod-shaped, 1.0μm to 3.0μm long, 0.5μm to 1.0μm wide, and have flagella around their peritrichous. According to the eighth edition of Bergey's Manual of Bacterial Identification (RE Buchanan et al., Beijing: Science Press, 1984), FY611 meets the growth characteristics of Pantoea, and it is preliminarily confirmed that the strain belongs to the genus Pantoea (Pantoea spp.).

[0038] (2) Molecular identification

[0039] Using the single colony formed by strain FY611 on the plate as a template, colony PCR reaction was used to quickly and specifically amplify the 16S rRNA (1534bp), gyrB (1227bp) and rpoB (944bp) genes, and the species of strain FY611 was identified by the sequence homology of the obtained amplified fragments.

[0040] Template for PCR reaction: FY611 was cultured in NA solid medium for 16-24h, and a single colony was picked and dissolved in 8.5μLddH2O; or FY611 was cultured in NA liquid medium at 28°C, 200rpm for 24h, and 1μL of bacterial solution was dissolved in 7.5μL ddH2O.

[0041] Primers for PCR reaction: see Table 1.

[0042] Table 1 Primer sequences used for identification of Pantoea anacardiae isolates

[0043]

[0044]

[0045] PCR reaction system (20 μL): 10 μL of 2x KOD FX buffer, 0.5 μL of 10 μM forward and reverse primers, 0.5 μL of KOD FX DNA polymerase, and 8.5 μL of ddH2O solution containing template.

[0046] PCR reaction conditions: pre-denaturation at 95°C for 5 min; denaturation at 98°C for 10 s, annealing at 55°C for 20 s, extension at 68°C for 30 s, 35 cycles; finally, extension at 68°C for 7 min and storage at 4°C.

[0047] Detection of PCR products: The amplified products were electrophoresed by 1.5% agarose gel and observed by gel imaging. The target fragments were approximately 1534 bp, 1227 bp and 944 bp ( Figure 2 ).

[0048] Sequence comparison of PCR products: The amplified PCR products were directly sent to Qingke Biotechnology Co., Ltd. for Sanger sequencing. The three gene sequences obtained by sequencing are shown as SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3. The three sequences obtained were subjected to BLAST analysis in the NCBI database (http: / / blast.ncbi.nlm.nih.gov / ). The results showed that SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3 of strain FY611 were consistent with the typical strain of Pantoea ananas LMG 2665 TThe 16S rRNA, gyrB and rpoB gene sequences of the strains were highly consistent, with 98.8%, 99.8% and 100% homologies respectively. Combining the results of morphological and molecular biological identification, it was found that strain FY611 was Pantoea ananas, and its classification name was Pantoea ananas.

[0049] SEQ ID No.1:

[0050]

[0051] SEQ ID No.2:

[0052]

[0053] SEQ ID No.3:

[0054] GGCTGAAAACCAGTTCCGCGTCGGTCTGGTCCGTGTTGAGCGTGCAGTGAAAGAGCGTCTTTCTCTGGGCGATCTCGATACGCTGATGCCACAGGACATGATCAACGCCAAGCCAATTTCGGCGGCGGTGAAAGAGTTCTTTGGTTCCAGCCAGCTGTCTCAGTTTATGGATCAGAACAACCCCTTGTCAGAGATTACGCACAAGCGTCGTATCTCTGCTCTCGGCCCGGGCGGTTTAACCCGTGAGCGTGCCGGCTTCGAAGTGCGTGACGTACACCCAACGCACTACGGTCGTGTCTGCCCAATCGAAACCCCTGAAGGTCCGAACATCGGTCTGATCAACTCCTTGTCTGTGTACGCGCAGACGAACGAGTACGGTTTCCTGGAAACCCCTTATCGTCGCGTTATTGACGGTGTGGTTTCCGATGAAATTCATTACCTTTCTGCAATCGAAGAAGGTAACTACGTTATCGCGCAGGCGAACACCAATCTGTCAGAAGAAGGTGCGTTCGTTGATGACCTGGTCACCTGCCGTAGCAAAGGCGAATCAAGTCTGTTCAGCCGCGATCAGGTTGACTACATGGACGTTTCCACCCAGCAGGTGGTTTCTGTCGGTGCGTCACTGATTCCGTTCCTGGAACACGATGATGCTAACCGCGCCCTGATGGGTGCGAACATGCAACGTCAGGCCGTTCCTACTCTGCGTGCTGATAAGCCGCTGGTAGGTACCGGTATGGAGCGCGCTGTAGCCGTTGACTCCGGTGTTACCGCTGTTGCGAAACGTGGTGGTACCGTTCAGTACGTTGATGCATCACGTATCGTTATTAAAGTTAACGAAGACGAGATGTACCCGGGCGAAGCGGGTATCGACATCTACAACCTGACCAAATACACCCGTTCTAACCAGAACACCTGTATCAATCAGATGCCGTGTGTCTCTCTGG。

[0055] 3. Purification and Preservation of Strain FY611

[0056] After FY611 was identified as Pantoea ananas, a single colony was picked from the NA medium and placed in M210 liquid medium, cultured at 200 rpm at 28°C for 24 hours, and the bacterial solution was mixed with 50% sterilized glycerol in a 1:1 ratio and stored in a -80°C refrigerator for later use. It was also preserved in the China General Microbiological Culture Collection (address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101), with a preservation date of November 6, 2023, and a preservation number of CGMCC No. 28885.

[0057] Example 2

[0058] Antibacterial effect of strain FY611 on Xanthomonas oryzae pv. LA20

[0059] 1. Preparation of LA20-containing plates

[0060] Take the -80℃ frozen strain LA20 and streak it on the NA medium plate for 72h, pick a single colony and put it into about 2-3mL M210 liquid medium, culture it at 28℃ and 200rpm for 48h, and then transfer it to new M210 liquid medium at a ratio of 1:100 to expand the culture until OD 600 The value is about 1.0. Prepare 60 mL of NA liquid medium, add 1% agarose and sterilize by high temperature and high pressure, cool to 50°C, add 6 mL of the LA20 bacterial solution prepared above, mix quickly and evenly, and pour into plates, about 15 mL per plate.

[0061] 2. Growth Inhibition Assay

[0062] Take 100 μL of FY611 bacterial solution stored at -80℃ and streak it on NA plate, incubate it at 28℃ for 16-24h, use a sterilized puncher to take bacterial blocks with a diameter of about 5mm and small pieces of NA culture medium and place them on the above-prepared LA20 plate, and use the small pieces of NA culture medium as control CK, incubate it at 28℃ for 72-96h, observe the growth of LA20 in NA plate and measure the size of inhibition zone. Figure 3 As shown in AB, FY611 had a significant inhibitory effect on the growth of LA20. After LA20 was cultured on the NA plate for 96 hours, the diameter of the inhibition zone reached 27.6 mm, while the control CK did not form an inhibition zone.

[0063] 3. Pathogenicity Inhibition Assay

[0064] LA20 and FY611 stored at -80°C were streaked on NA medium plates for 72 h and 24 h, respectively. Single colonies were picked into about 2-3 mL of M210 liquid medium and cultured at 200 rpm at 28°C for 48 h. Then, they were transferred to new M210 liquid medium at a ratio of 1:100 and 1:1000, respectively, and cultured at 200 rpm at 28°C until the OD600 value was about 0.5, that is, the concentration reached at least 1×10 8 cfu / mL, LA20 and FY611 fresh bacterial suspensions were mixed in a ratio of 1:1 and inoculated into the indica rice variety Zhongzao 39 by the leaf cutting method.

[0065] Each bacterial solution (LA20, LA20+FY611, FY611) was inoculated with at least 30 leaves of Zhongzao 39 grown for 8 weeks. The inoculation test was repeated 3 times. The disease was investigated 14 days after inoculation, the disease of the inoculated materials was observed, and the length of the lesions was measured. The length of the lesions on 12 leaves of each treatment was measured, and the differences in the length of the lesions were compared and statistically analyzed. Figure 3 As shown in CD, when LA20 was inoculated alone, the lesion length could reach 20 cm, and Zhongzao 39 was extremely susceptible to the disease; when LA20 and FY611 were mixed in a ratio of 1:1 and inoculated, the lesion hardly extended, and Zhongzao 39 was extremely resistant to the disease; when FY611 was inoculated alone, the results were consistent with those of the mixed inoculation of LA20 and FY611. The above results show that FY611 significantly inhibits the pathogenicity of LA20.

[0066] LA20 is a new and mandatory disease strain of rice bacterial blight in recent years. It can overcome the resistance of disease-resistant genes Xa4, xa5, Xa7 and xa13, resulting in new outbreaks of old diseases. Currently, there is no efficient and green prevention and control method. The isolated and identified Pantoea ananas strain FY611 can significantly inhibit the growth and pathogenicity of LA20 and can be used to develop hair control agents to prevent and control bacterial blight.

[0067] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A strain of Pantoea ananatis FY611, which was deposited in the China General Microbiological Culture Collection Center on November 6, 2023, with the deposit number being CGMCC No. 28885.

2. Use of the Pantoea anacardiae FY611 described in claim 1 in preventing and treating rice bacterial blight.

3. Use of the Pantoea anacardiae FY611 described in claim 1 in inhibiting the growth of Xanthomonas oryzae pathological variant LA20.

4. Use of the Pantoea ananas FY611 described in claim 1 in inhibiting the pathogenicity of Xanthomonas oryzae pv. LA20.

5. A biocontrol agent for preventing and treating bacterial blight, characterized in that: The biocontrol agent contains the Pantoea anacardiae FY611 described in claim 1.

6. The biocontrol agent according to claim 5, characterized in that The concentration of the bacterial solution of Pantoea pineapple FY611 in the biocontrol agent is not less than 1×10 8 cfu / mL.

Images