A benzimidazole compound, its preparation method and application
By synthesizing benzimidazole compounds with specific structures, the shortcomings of existing drugs in the treatment of chronic heart failure have been overcome, achieving direct or indirect improvement of myocardial function and providing an effective treatment option.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SUZHOU PHARMAVAN CANCER RES CENT CO LTD
- Filing Date
- 2022-09-09
- Publication Date
- 2026-06-02
Smart Images

Figure CN117720472B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of chemical and pharmaceutical technology, and relates to a benzimidazole compound, its preparation method, and its application. Background Technology
[0002] Heart failure is a clinical syndrome characterized by typical symptoms such as shortness of breath, ankle swelling, and fatigue, which may be accompanied by signs of structural and / or functional cardiac abnormalities (e.g., increased jugular venous pressure, pulmonary crackles, and peripheral edema), leading to decreased cardiac output and / or increased intracardiac pressure at rest or under stress. Heart failure is only present when symptoms are prominent.
[0003] Current medications primarily alleviate symptoms triggered by compensatory mechanisms such as the sympathetic-adrenergic system during heart failure. The release of the sympathetic-adrenergic system, the RAA (renin-angiotensin-aldosterone) system, and vasoactive peptides (natriuretic peptides) is regulated by myocardial injury, compensating for some myocardial function by increasing preload (edema), afterload reperfusion (vasoconstriction), and regulating myocardial cell calcium (myocardial hypertrophy). Overall, first-line treatments still cannot halt the progression of heart failure.
[0004] Therefore, in this field, the development of effective drugs for the treatment of chronic heart failure is a key research focus, including heart failure with preserved ejection fraction and heart failure with decreased ejection fraction. Summary of the Invention
[0005] To address the shortcomings of existing technologies, the present invention aims to provide a benzimidazole compound, its preparation method, and its application.
[0006] To achieve this objective, the present invention adopts the following technical solution:
[0007] One objective of this invention is to provide a benzimidazole compound having the structure shown in Formula A:
[0008]
[0009] Formula A
[0010] Wherein, R is a hydroxyl group or R1, R2, R3, and R5 are each independently hydrogen, halogen, nitro, amino, hydroxyl, cyano, carboxyl, C1-C4 straight-chain or branched alkoxycarbamoyl, carbamoyl, carbamoyl with N-substituted C1-C4 straight-chain or branched alkyl, C1-C4 straight-chain or branched alkyl, C1-C4 alkoxy, or C1-C4 alkylamino; R4 is fluorine, bromine, nitro, hydroxyl, cyano, carboxyl, alkoxycarbamoyl, carbamoyl, N-substituted carbamoyl, C1-C4 straight-chain or branched alkyl, non-halogenated C1-C4 alkoxy, or C1-C4 alkylamino; R6 is C1-C4 straight-chain or branched alkylene.
[0011] The benzimidazole compounds having the structure shown in Formula A according to the present invention have a therapeutic effect on chronic heart failure.
[0012] In some preferred embodiments, the benzimidazole compound has the structure shown in Formula I or Formula II:
[0013]
[0014] The constraints of R1, R2, R3, R4 and R5 are the same as in Equation A.
[0015] In some preferred embodiments, R1, R2, R3 and R5 are each independently any one of hydrogen, fluorine, chlorine, bromine, amino, hydroxyl, cyano, methoxyformyl, ethoxyformyl, dimethylcarbamoyl, diethylcarbamoyl, trifluoromethyl, methyl, ethyl, n-propyl, isopropyl, allyl, cyanomethyl, methoxy, trifluoromethoxy, ethoxy, methylamino, dimethylamino, ethylamino or diethylamino.
[0016] In some preferred embodiments, R4 is any one of fluorine, bromine, amino, hydroxyl, cyano, carboxyl, methoxyformyl, ethoxyformyl, carbamoyl, dimethylcarbamoyl, diethylcarbamoyl, trifluoromethyl, methyl, ethyl, n-propyl, isopropyl, allyl, cyanomethyl, methoxy, ethoxy, methylamino, dimethylamino, ethylamino, or diethylamino.
[0017] In some preferred embodiments, R1 and R2 are hydrogen or methyl.
[0018] In some preferred embodiments, R3 is cyano, fluorine, or hydrogen.
[0019] In some preferred embodiments, R4 is fluorine, allyl, n-propyl, cyanomethyl, carboxyl, methoxycarbamoyl, carbamoyl, or dimethylcarbamoyl.
[0020] In some preferred embodiments, R5 is hydrogen or methyl.
[0021] In this invention, the number of carbon atoms is defined when defining a group, such as C1~C4 straight-chain or branched alkyl, C1~C4 alkoxy, etc. The defined number of carbon atoms refers to all integer values within the defined range. For example, C1~C4 means that the number of carbon atoms can be 1, 2, 3 or 4.
[0022] In some preferred embodiments, the benzimidazole compound is any one of compounds having the following formulas: I-1 to I-47 and II-1 to II-144:
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030] .
[0031] A second objective of this invention is to provide a method for preparing the benzimidazole compound as described above. The method comprises the following steps: a brominated compound of formula B reacts with a boric acid compound of formula V under the action of a catalyst via a Suzuki reaction to obtain the benzimidazole compound of formula A. The reaction formula is as follows:
[0032]
[0033] The constraints for R, R1, R2, R3, R4, and R5 are the same as those above, and will not be repeated here.
[0034] Preferably, the molar ratio of the brominated compound shown in Formula B to the boric acid compound shown in Formula V is 1:0.8 to 1:3, for example, 0.8:3, 0.85:3, 0.88:3, 0.9:3, 0.95:3 or 1:3.
[0035] Preferably, the catalyst is any one or a combination of at least two of tetra(triphenylphosphine)palladium, 1,1-bis(diphenylphosphine)ferrocene palladium dichloride, or palladium acetate.
[0036] Preferably, the molar ratio of the catalyst to the boric acid compound shown in Formula V is 0.001:1 to 0.5:1, for example, 0.001:1, 0.005:1, 0.008:1, 0.1:1, 0.2:1, 0.3:1, 0.4:1 or 0.5:1.
[0037] Preferably, the Suzuki reaction is carried out in the presence of an alkaline substance.
[0038] Preferably, the alkaline substance is any one or a combination of at least two of potassium fluoride, potassium acetate, sodium carbonate, potassium carbonate, or potassium phosphate.
[0039] Preferably, the Suzuki reaction is carried out in an organic solvent, which is any one or a combination of at least two of DMF, toluene, ethanol, 1,4-dioxane, water, or THF.
[0040] Preferably, the temperature of the Suzuki reaction is 70°C to 150°C (e.g., 70°C, 75°C, 80°C, 90°C, 100°C, 110°C, 120°C, 130°C, 140°C, or 150°C), and the time is 0.25 h to 48 h (e.g., 0.25 h, 0.5 h, 1 h, 3 h, 8 h, 10 h, 13 h, 15 h, 18 h, 20 h, 24 h, 28 h, 33 h, 38 h, 40 h, 42 h, 45 h, or 48 h).
[0041] A third object of the present invention is to provide pharmaceutically acceptable salts of the benzimidazole compounds as described above.
[0042] In this invention, the pharmaceutically acceptable salt is an organic or inorganic acid salt of the benzimidazole compound.
[0043] Preferably, the organic acid salt is selected from any one of tartrate, stearate, oxalate, citrate, lactate, sorbate, fumarate, formate, acetate, benzoate, benzenesulfonate, ethanesulfonate, resin acid salt, trifluoroacetate, maleate, malate, L-malate, methanesulfonate, fumarate, amino acid salt, or nicotinate.
[0044] Preferably, the organic acid salt is selected from any one of tartrate, acetate, maleate, malate, L-malate or fumarate.
[0045] Preferably, the inorganic acid salt is selected from any one of phosphate, sulfate, nitrate, iodate, bromate, hydroiodate, hydrobromate or hydrochloride.
[0046] Preferably, the inorganic acid salt is selected from any one of phosphate, sulfate or hydrochloride.
[0047] A fourth objective of this invention is to provide solvates of the benzimidazole compounds as described above.
[0048] Preferably, the solvate is a hydrate and / or alcohol of a benzimidazole compound. In this invention, the solvate of the benzimidazole compound is equivalent in effect to the benzimidazole compound itself.
[0049] The fifth objective of this invention is to provide a prodrug of the benzimidazole compound as described above.
[0050] In this invention, the prodrug refers to a compound obtained by chemically modifying a drug, which is inactive or has low activity in vitro, but releases an active drug in vivo through enzymatic or non-enzymatic conversion to exert its pharmacological effect.
[0051] In this invention, the prodrug of the benzimidazole compound is inactive or has low activity in vitro, but releases an active benzimidazole compound after undergoing metabolic changes in vivo, thereby exerting its effect.
[0052] A sixth objective of this invention is to provide tautomers or stereochemical isomers of the benzimidazole compounds as described above. Common tautomers include, but are not limited to, tautomers obtained by tautomerizing the double bonds in the benzimidazole ring of Formula I and Formula II.
[0053] A seventh objective of the present invention is to provide a pharmaceutical composition comprising, as described above, a benzimidazole compound.
[0054] Preferably, the pharmaceutical composition further comprises pharmaceutically acceptable excipients;
[0055] Preferably, the pharmaceutically acceptable excipient is any one of excipients, diluents, carriers, flavoring agents, binders, or fillers.
[0056] Preferably, the dosage form of the pharmaceutical composition is an oral preparation, a parenteral preparation, or a topical preparation.
[0057] For example, in this invention, the pharmaceutical composition can be prepared into solid, semi-solid, liquid or gaseous formulations, such as tablets, pills, capsules, powders, granules, ointments, emulsions, suspensions, suppositories, injections, inhalers, gels, microspheres and aerosols, etc.
[0058] Typical routes of administration for the compounds of this application or their pharmaceutically acceptable salts or pharmaceutical compositions thereof include, but are not limited to, oral, rectal, topical, inhalation, parenteral, sublingual, vaginal, intranasal, intraocular, intraperitoneal, intramuscular, subcutaneous, and intravenous administration.
[0059] An eighth object of the present invention is to provide the use of the benzimidazole compounds as described above, and their pharmaceutically acceptable salts, solvates, prodrugs, tautomers or stereochemical isomers or pharmaceutical compositions in the preparation of medicaments for the treatment of chronic heart failure.
[0060] A ninth objective of this invention is to provide the use of a substituted benzimidazole compound or its tautomer or its pharmaceutically acceptable salt or its solvate or its hydrate or a pharmaceutical composition thereof in the preparation of a medicament for treating chronic heart failure, wherein the substituted benzimidazole compound has the following structure:
[0061] .
[0062] Compared with the prior art, the present invention has the following beneficial effects:
[0063] The benzimidazole compounds of the present invention, as well as their pharmaceutically acceptable salts, solvates, prodrugs, tautomers or stereochemical isomers or pharmaceutical compositions, have therapeutic effects on chronic heart failure and have broad application prospects. Attached Figure Description
[0064] Figure 1 The 1H NMR spectrum of compound I-1 of this invention;
[0065] Figure 2 The 1H NMR spectrum of compound I-24 of this invention;
[0066] Figure 3 The above is the 1H NMR spectrum of compound I-25 of the present invention. Detailed Implementation
[0067] The technical solution of the present invention will be further illustrated below through specific embodiments. Those skilled in the art should understand that the embodiments described are merely illustrative of the present invention and should not be construed as limiting the invention in any way.
[0068] Example 1: Synthesis of Compound I-1
[0069] Under nitrogen protection, 2-bromo-4-fluorophenol (19.1 g, 0.1 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (17.6 g, 0.1 mol) were added to 1,4-dioxane (100 ml), followed by potassium acetate (19.6 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (3.6 g, 5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (2.8 g, 5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was complete, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as eluent to give 13.4 g of 4-fluoro-2-(2-methyl-1H-benzimidazol-5-yl)phenol, an off-white powder, with a yield of 55.3%. EI-MS M / Z 243.3 [M + ].
[0070] 1 1H-NMR (DMSO-d6, 400MHz): 2.49 (3H, s), 6.86–7.02 (2H, m), 7.10 (1H, dd, J=9.7, 2.4Hz), 7.30 (1H, d, J=8.3Hz), 7.45 (1H, d, J=6.3Hz), 7.63 (1H, s), 9.46 (1H, s), 12.20 (1H, s). The 1H NMR spectrum is shown below. Figure 1 .
[0071] Note: (2-methyl-1H-benzimidazole-5-yl)boronic acid was obtained from commercially available 5-bromo-1H-benzimidazole via a conventional Miyaura borylation reaction. The arylboronic acids in other examples were obtained using the same preparation method or principle. Other starting materials can generally be obtained directly through commercial means, or can be obtained by those skilled in the art using commercially available materials via conventional chemical synthesis methods.
[0072] Example 2: Synthesis of Compound I-2
[0073] Under nitrogen protection, 2-bromo-4,6-difluorophenol (2.08 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.54 g of 2,4-difluoro-6-(2-methyl-1H-benzimidazol-5-yl)phenol, a white powder solid, with a yield of 59.2%. EI-MS M / Z 261.2[M + ].
[0074] Example 3: Synthesis of Compound I-3
[0075] Under nitrogen protection, 3-bromo-5-fluoro-2-hydroxybenzonitrile (2.16 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.18 g of 5-fluoro-2-hydroxy-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile, an off-white powder, with a yield of 44.2%. EI-MS M / Z 268.3 [M + ].
[0076] Example 4: Synthesis of Compounds I-4
[0077] Under nitrogen protection, 3-bromo-4-hydroxybenzamide (2.16 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.88 g of 4-hydroxy-3-(2-methyl-1H-benzimidazol-5-yl)benzamide as a white powder solid, with a yield of 32.9%. EI-MS M / Z 268.3[M + ].
[0078] Example 5: Synthesis of Compounds I-5
[0079] Under nitrogen protection, 3-bromo-5-fluoro-4-hydroxybenzamide (2.34 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.89 g of 3-fluoro-4-hydroxy-5-(2-methyl-1H-benzimidazol-5-yl)benzamide, an off-white powder solid, with a yield of 31.2%. EI-MS M / Z 286.3 [M + ].
[0080] Example 6: Synthesis of Compounds I-6
[0081] Under nitrogen protection, 3-bromo-5-cyano-4-hydroxybenzamide (2.41 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.81 g of 3-cyano-4-hydroxy-5-(2-methyl-1H-benzimidazol-5-yl)benzamide, an off-white powder solid, with a yield of 27.6%. EI-MS M / Z 293.3 [M+].
[0082] Example 7: Synthesis of Compounds I-7
[0083] Under nitrogen protection, 3-bromo-4-hydroxy-N,N-dimethylbenzamide (2.16 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.18 g of 4-hydroxy-N,N-dimethyl-3-(2-methyl-1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 39.9%. EI-MS M / Z 296.3 [M + ].
[0084] Example 8: Synthesis of compounds of formulas I-8
[0085] Under nitrogen protection, 3-bromo-5-fluoro-4-hydroxy-N,N-dimethylbenzamide (2.60 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.19 g of 3-fluoro-4-hydroxy-N,N-dimethyl-5-(2-methyl-1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 38.0%. EI-MS M / Z 314.3 [M + ].
[0086] Example 9: Synthesis of compounds of formulas I-9
[0087] Under nitrogen protection, 3-bromo-5-cyano-4-hydroxy-N,N-dimethylbenzamide (2.69 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 1.15 g of 3-cyano-4-hydroxy-N,N-dimethyl-5-(2-methyl-1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 35.9%. EI-MS M / Z 321.4 [M+].
[0088] Example 10 Synthesis of compound I-48
[0089] Under nitrogen protection, 3-bromo-4-hydroxybenzoic acid (2.17 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.78 g of 4-hydroxy-3-(2-methyl-1H-benzimidazol-5-yl)benzoic acid as a white powder, with a yield of 26.1%. EI-MS M / Z 269.3[M + ].
[0090] Example 11 Synthesis of compounds of formula I-10
[0091] Under nitrogen protection, 3-bromo-5-fluoro-4-hydroxybenzoic acid (2.35 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.69 g of 3-fluoro-4-hydroxy-5-(2-methyl-1H-benzimidazol-5-yl)benzoic acid, a white powder, with a yield of 24.1%. EI-MS M / Z 287.3 [M] + ].
[0092] Example 12 Synthesis of Compound I-11
[0093] Under nitrogen protection, 3-bromo-5-cyano-4-hydroxybenzoic acid (2.42 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.61 g of 3-cyano-4-hydroxy-5-(2-methyl-1H-benzimidazol-5-yl)benzoic acid, a white powder solid, with a yield of 20.8%. EI-MS M / Z 294.3 [M+].
[0094] Example 13 Synthesis of Compound I-12
[0095] Under nitrogen protection, methyl 3-bromo-4-hydroxybenzoate (2.31 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give methyl 4-hydroxy-3-(2-methyl-1H-benzimidazol-5-yl)benzoate, a white powder solid, 1.58 g, yield 56.0%. EI-MS M / Z 283.3[M + ].
[0096] Example 14 Synthesis of Compound I-13
[0097] Under nitrogen protection, methyl 3-bromo-5-fluoro-4-hydroxybenzoate (2.49 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give methyl 3-fluoro-4-hydroxy-5-(2-methyl-1H-benzimidazol-5-yl)benzoate, a white powder, 1.69 g, yield 56.3%. EI-MS M / Z 301.3 [M + ].
[0098] Example 15 Synthesis of Compound I-14
[0099] Under nitrogen protection, methyl 3-bromo-5-cyano-4-hydroxybenzoate (2.56 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give methyl 3-cyano-4-hydroxy-5-(2-methyl-1H-benzimidazol-5-yl)benzoate, a white powder solid, 1.61 g, yield 43.2%. EI-MS M / Z 308.3 [M+].
[0100] Example 16 Synthesis of Compound I-15
[0101] Under nitrogen protection, 4-allyl-2-bromophenol (2.13 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.78 g of 4-allyl-2-(2-methyl-1H-benzimidazol-5-yl)phenol as a white powder solid, with a yield of 29.4%. EI-MS M / Z 265.3[M + ].
[0102] Example 17 Synthesis of Compounds I-16
[0103] Under nitrogen protection, 4-allyl-2-bromo-6-fluorophenol (2.31 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 0.69 g of 4-allyl-2-(2-methyl-1H-benzimidazol-5-yl)-6-fluorophenol, a white powder, with a yield of 24.4%. EI-MS M / Z 283.3 [M] + ].
[0104] Example 18 Synthesis of Compounds I-17
[0105] Under nitrogen protection, 5-allyl-3-bromo-2-hydroxybenzonitrile (2.38 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.81 g of 5-allyl-3-(2-methyl-1H-benzimidazol-5-yl)-2-hydroxybenzonitrile, an off-white powder, with a yield of 28.0%. EI-MS M / Z 290.3 [M+].
[0106] Example 19 Synthesis of Compound I-18
[0107] Under nitrogen protection, 2-(3-bromo-4-hydroxyphenyl)acetonitrile (2.12 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.28 g of 2-(4-hydroxy-3-(2-methyl-1H-benzimidazol-5-yl)phenyl)acetonitrile, a white powder, with a yield of 48.7%. EI-MS M / Z 264.3 [M] + ].
[0108] Example 20: Synthesis of Compound I-19
[0109] Under nitrogen protection, 2-(3-bromo-5-fluoro-4-phenol)acetonitrile (2.30 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1... 1'-Bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.19 g of 2-(3-fluoro-4-hydroxy-5-(2-methyl-1H-benzimidazol-5-yl))phenyl)acetonitrile, a white powder, with a yield of 42.3%. EI-MS M / Z 282.3 [M] + ].
[0110] Example 21 Synthesis of Compound I-20
[0111] Under nitrogen protection, 3-bromo-5-cyanomethyl-2-hydroxybenzonitrile (2.37 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 1.01 g of 5-cyanomethyl-2-hydroxy-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile, an off-white powder, with a yield of 35.0%. EI-MS M / Z 289.3 [M+].
[0112] Example 22 Synthesis of Compound I-21
[0113] Under nitrogen protection, 2-bromo-4-propylphenol (2.15 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.75 g of 2-(2-methyl-1H-benzimidazol-5-yl)-4-propylphenol, a white powder solid, with a yield of 65.5%. EI-MS M / Z 267.3[M + ].
[0114] Example 23 Synthesis of Compound I-22
[0115] Under nitrogen protection, 2-bromo-6-fluoro-4-propylphenol (2.33 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.39 g of 2-fluoro-6-(2-methyl-1H-benzimidazol-5-yl)-4-propylphenol, a white powder, with a yield of 48.7%. EI-MS M / Z 285.3 [M + ].
[0116] Example 24 Synthesis of compounds of formula I-23
[0117] Under nitrogen protection, 3-bromo-2-hydroxy-5-propylbenzonitrile (2.40 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 1.11 g of 2-hydroxy-3-(2-methyl-1H-benzimidazol-5-yl)-5-propylbenzonitrile, an off-white powder, with a yield of 38.0%. EI-MS M / Z 292.4 [M+].
[0118] Example 25 Synthesis of Compound I-24
[0119] Under nitrogen protection, 2-bromo-4-fluorophenol (19.1 g, 0.1 mol) and (1H-benzimidazol-5-yl)boric acid (16.2 g, 0.1 mol) were added to 1,4-dioxane (100 ml), followed by potassium acetate (19.6 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (3.6 g, 5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (2.8 g, 5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was complete, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 14.5 g of 4-fluoro-2-(1H-benzimidazol-5-yl)phenol, a white powder solid, with a yield of 63.5%. EI-MS M / Z 229.2 [M + ].
[0120] 1 1H-NMR (DMSO-d6, 400MHz): 6.91–7.01 (2H, m), 7.12 (1H, dd, J = 9.8, 3.0 Hz), 7.38 (1H, d, J = 8.4 Hz), 7.60 (1H, d, J = 8.3 Hz), 7.77 (1H, s), 8.24 (1H, s), 9.48 (1H, s), 12.47 (1H, s). The 1H NMR spectrum is shown below. Figure 2 .
[0121] Example 26 Synthesis of Compound I-25
[0122] Under nitrogen protection, 2-bromo-4,6-difluorophenol (2.08 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.57 g of 2,4-difluoro-6-(1H-benzimidazol-5-yl)phenol, an off-white powder solid, with a yield of 63.8%. EI-MS M / Z 247.2[M + ].
[0123] 1 1H-NMR (DMSO-d6, 400MHz): 7.03–7.06 (1H, m), 7.17–7.23 (1H, m), 7.39 (1H, dd, J = 8.4 Hz), 7.63 (1H, d, J = 8.4 Hz), 7.79 (1H, s), 8.27 (1H, s), 9.44 (1H, s), 12.52 (1H, s). The 1H NMR spectrum is shown below. Figure 3 .
[0124] Example 27 Synthesis of compounds of formula I-26
[0125] Under nitrogen protection, 3-bromo-5-fluoro-2-hydroxybenzonitrile (2.16 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.12 g of 5-fluoro-2-hydroxy-3-(1H-benzimidazol-5-yl)benzonitrile, an off-white powder solid, with a yield of 44.3%. EI-MS M / Z 254.2[M + ].
[0126] Example 28 Synthesis of Compounds I-27
[0127] Under nitrogen protection, 3-bromo-4-hydroxybenzamide (2.16 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.86 g of 4-hydroxy-3-(1H-benzimidazol-5-yl)benzamide as a white powder solid, with a yield of 34.0%. EI-MS M / Z 254.3[M + ].
[0128] Example 29 Synthesis of compounds of formula I-28
[0129] Under nitrogen protection, 3-bromo-5-fluoro-4-hydroxybenzamide (2.34 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.82 g of 3-fluoro-4-hydroxy-5-(1H-benzimidazol-5-yl)benzamide as a white powder solid, with a yield of 30.1%. EI-MS M / Z 272.3[M + ].
[0130] Example 30 Synthesis of Compound I-29
[0131] Under nitrogen protection, 3-bromo-5-cyano-4-hydroxybenzamide (2.41 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.80 g of 3-cyano-4-hydroxy-5-(1H-benzimidazol-5-yl)benzamide as a white powder solid, with a yield of 26.9%. EI-MS M / Z 279.3 [M+].
[0132] Example 31 Synthesis of Compounds I-30
[0133] Under nitrogen protection, 3-bromo-4-hydroxy-N,N-dimethylbenzamide (2.16 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.12 g of 4-hydroxy-N,N-dimethyl-3-(1H-benzimidazol-5-yl)benzamide, an off-white powder solid, with a yield of 39.9%. EI-MS M / Z 282.3[M + ].
[0134] Example 32 Synthesis of Compounds I-31
[0135] Under nitrogen protection, 3-bromo-5-fluoro-4-hydroxy-N,N-dimethylbenzamide (2.60 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.09 g of 3-fluoro-4-hydroxy-N,N-dimethyl-5-(1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 36.4%. EI-MS M / Z 300.3 [M + ].
[0136] Example 33 Synthesis of compounds of formula I-32
[0137] Under nitrogen protection, 3-bromo-5-cyano-4-hydroxy-N,N-dimethylbenzamide (2.69 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 1.05 g of 3-cyano-4-hydroxy-N,N-dimethyl-5-(1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 34.3%. EI-MS M / Z 307.3 [M+].
[0138] Example 34 Synthesis of compounds of formula I-33
[0139] Under nitrogen protection, 3-bromo-4-hydroxybenzoic acid (2.17 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.68 g of 4-hydroxy-3-(1H-benzimidazol-5-yl)benzoic acid as a white powder solid, with a yield of 26.8%. EI-MS M / Z 255.3[M + ].
[0140] Example 35 Synthesis of compounds of formula I-34
[0141] Under nitrogen protection, 3-bromo-5-fluoro-4-hydroxybenzoic acid (2.35 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.52 g of 3-fluoro-4-hydroxy-5-(1H-benzimidazol-5-yl)benzoic acid as a white powder, with a yield of 19.0%. EI-MS M / Z 273.2[M + ].
[0142] Example 36 Synthesis of Compound I-35
[0143] Under nitrogen protection, 3-bromo-5-cyano-4-hydroxybenzoic acid (2.42 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.63 g of 3-cyano-4-hydroxy-5-(1H-benzimidazol-5-yl)benzoic acid as a white powder, with a yield of 22.5%. EI-MS M / Z 280.3 [M+].
[0144] Example 37 Synthesis of compounds of formulas I-36
[0145] Under nitrogen protection, methyl 3-bromo-4-hydroxybenzoate (2.31 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give methyl 4-hydroxy-3-(1H-benzimidazol-5-yl)benzoate, a white powder solid, 1.50 g, yield 56.0%. EI-MS M / Z 269.3[M + ].
[0146] Example 38 Synthesis of compounds of formula I-37
[0147] Under nitrogen protection, methyl 3-bromo-5-fluoro-4-hydroxybenzoate (2.49 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give methyl 3-fluoro-4-hydroxy-5-(1H-benzimidazol-5-yl)benzoate, a white powder solid, 1.62 g, yield 56.6%. EI-MS M / Z 287.3[M + ].
[0148] Example 39 Synthesis of compounds of formula I-38
[0149] Under nitrogen protection, methyl 3-bromo-5-cyano-4-hydroxybenzoate (2.56 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give methyl 3-cyano-4-hydroxy-5-(1H-benzimidazol-5-yl)benzoate, a white powder solid, 1.60 g, yield 54.6%. EI-MS M / Z 294.3 [M+].
[0150] Example 40 Synthesis of Compounds I-39
[0151] Under nitrogen protection, 4-allyl-2-bromophenol (2.13 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.68 g of 4-allyl-2-(1H-benzimidazol-5-yl)phenol as a white powder solid, with a yield of 27.2%. EI-MS M / Z 251.3[M + ].
[0152] Example 41 Synthesis of Compound I-40
[0153] Under nitrogen protection, 4-allyl-2-bromo-6-fluorophenol (2.31 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.65 g of 4-allyl-2-(1H-benzimidazol-5-yl)-6-fluorophenol as a white powder solid, with a yield of 24.2%. EI-MS M / Z 269.3[M + ].
[0154] Example 42 Synthesis of Compound I-41
[0155] Under nitrogen protection, 5-allyl-3-bromo-2-hydroxybenzonitrile (2.38 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.80 g of 5-allyl-3-(1H-benzimidazol-5-yl)-2-hydroxybenzonitrile, an off-white powder solid, with a yield of 29.1%. EI-MS M / Z 276.3 [M+].
[0156] Example 43 Synthesis of compounds of formula I-42
[0157] Under nitrogen protection, 2-(3-bromo-4-hydroxyphenyl)acetonitrile (2.12 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.28 g of 2-(4-hydroxy-3-(1H-benzimidazol-5-yl)phenyl)acetonitrile, an off-white powder solid, with a yield of 51.2%. EI-MS M / Z 250.3[M + ].
[0158] Example 44 Synthesis of compounds of formula I-43
[0159] Under nitrogen protection, 2-(3-bromo-5-fluoro-4-phenol)acetonitrile (2.30 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1... 1'-Bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.12 g of 2-(3-fluoro-4-hydroxy-5-(1H-benzimidazol-5-yl))phenyl)acetonitrile, an off-white powder, yielding 41.9%. EI-MS M / Z 268.3 [M] + ].
[0160] Example 45 Synthesis of compounds of formula I-44
[0161] Under nitrogen protection, 3-bromo-5-cyanomethyl-2-hydroxybenzonitrile (2.37 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.12 g of 5-cyanomethyl-2-hydroxy-3-(1H-benzimidazol-5-yl)benzonitrile, an off-white powder solid, with a yield of 40.9%. EI-MS M / Z 275.3 [M+].
[0162] Example 46 Synthesis of Compound I-45
[0163] Under nitrogen protection, 2-bromo-4-propylphenol (2.15 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.55 g of 2-(1H-benzimidazol-5-yl)-4-propylphenol, an off-white powder solid, with a yield of 61.5%. EI-MS M / Z 253.3[M + ].
[0164] Example 47 Synthesis of compounds of formula I-46
[0165] Under nitrogen protection, 2-bromo-6-fluoro-4-propylphenol (2.33 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.33 g of 2-fluoro-6-(1H-benzimidazol-5-yl)-4-propylphenol, a white powder solid, with a yield of 49.2%. EI-MS M / Z 271.3[M + ].
[0166] Example 48 Synthesis of compounds I-47
[0167] Under nitrogen protection, 2.40 g (0.01 mol) of 3-bromo-2-hydroxy-5-propylbenzonitrile and 1.62 g (0.01 mol) of (1H-benzimidazol-5-yl)boronic acid were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g (0.02 mol), 0.36 g (0.5 mmol) of 1,1'-bis(diphenylphosphine)ferrocene palladium dichloride, and 0.28 g (0.5 mmol) of 1,1'-bis(diphenylphosphine)ferrocene. The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.02 g of 2-hydroxy-3-(1H-benzimidazol-5-yl)-5-propylbenzonitrile, a white powder solid, with a yield of 36.8%. EI-MS M / Z 278.3 [M+].
[0168] Example 49 Synthesis of Compound II-1
[0169] Under nitrogen protection, 2-(2-bromo-4-fluorophenyl)propane-2-ol (2.31 g, 0.1 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.1 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 5 mmol), and 1 1'-Bis(diphenylphosphine)ferrocene (0.28 g, 5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.24 g of 2-(4-fluoro-2-(2-methyl-1H-benzimidazol-5-yl)phenyl)propane-2-ol, a white powder solid, with a yield of 43.7%. EI-MS M / Z 285.3 [M] + ].
[0170] Example 50 Synthesis of Compound II-2
[0171] Under nitrogen protection, 2-(2-bromo-4,6-difluorophenyl)propane-2-ol (2.50 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.59 g of 2-(2,4-difluoro-6-(2-methyl-1H-benzimidazol-5-yl)phenyl)propane-2-ol, a white powder, with a yield of 52.5%. EI-MS M / Z303.3 [M + ].
[0172] Example 51 Synthesis of Compound II-3
[0173] Under nitrogen protection, 3-bromo-5-fluoro-2-(2-hydroxypropane-2-yl)benzonitrile (2.58 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.28 g of 5-fluoro-2-(2-hydroxypropane-2-yl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile, a white powder, with a yield of 41.4%. EI-MSM / Z 310.3 [M + ].
[0174] Example 52 Synthesis of Compound II-4
[0175] Under nitrogen protection, 3-bromo-4-(2-hydroxypropane-2-yl)benzamide (2.58 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.78 g of 4-(2-hydroxypropane-2-yl)-3-(2-methyl-1H-benzimidazol-5-yl)benzamide, a white powder, with a yield of 25.4%. EI-MS M / Z310.4 [M + ].
[0176] Example 53 Synthesis of Compound II-5
[0177] Under nitrogen protection, 3-bromo-5-fluoro-4-(2-hydroxypropane-2-yl)benzamide (2.76 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.89 g of 3-fluoro-4-(2-hydroxypropane-2-yl)-5-(2-methyl-1H-benzimidazol-5-yl)benzamide, a white powder, with a yield of 27.1%. EI-MS M / Z 328.4 [M] + ].
[0178] Example 54 Synthesis of Compound II-6
[0179] Under nitrogen protection, 3-bromo-5-cyano-4-(2-hydroxypropane-2-yl)benzamide (2.83 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 0.28 g of 1,1'-bis(diphenylphosphine)ferrocene (0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as eluent to give 0.71 g of 3-cyano-4-(2-hydroxypropane-2-yl)-5-(2-methyl-1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 21.2%. EI-MS M / Z 335.4 [M+].
[0180] Example 55 Synthesis of Compound II-7
[0181] Under nitrogen protection, 3-bromo-4-(2-hydroxypropane-2-yl)-N,N-dimethylbenzamide (2.86 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 1.18 g of 4-(2-hydroxypropane-2-yl)-N,N-dimethyl-3-(2-methyl-1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 35.0%. EI-MS M / Z 338.4 [M + ].
[0182] Example 56 Synthesis of Compound II-8
[0183] Under nitrogen protection, 3-bromo-5-fluoro-4-(2-hydroxypropane-2-yl)-N,N-dimethylbenzamide (3.04 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 1.21 g of 3-fluoro-4-(2-hydroxypropane-2-yl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 34.0%. EI-MS M / Z 356.4 [M + ].
[0184] Example 57 Synthesis of Compound II-9
[0185] Under nitrogen protection, 3-bromo-5-cyano-4-(2-hydroxypropane-2-yl)-N,N-dimethylbenzamide (3.11 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 1.20 g of 3-cyano-4-(2-hydroxypropane-2-yl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 33.1%. EI-MS M / Z 363.4 [M+].
[0186] Example 58 Synthesis of Compound II-10
[0187] Under nitrogen protection, 3-bromo-4-(2-hydroxypropane-2-yl)benzoic acid (2.59 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.79 g of 4-(2-hydroxypropane-2-yl)-3-(2-methyl-1H-benzimidazol-5-yl)benzoic acid, a white powder, with a yield of 25.4%. EI-MS M / Z311.4 [M + ].
[0188] Example 59 Synthesis of Compound II-11
[0189] Under nitrogen protection, 3-bromo-5-fluoro-4-(2-hydroxypropane-2-yl)benzoic acid (2.77 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.74 g of 3-fluoro-4-(2-hydroxypropane-2-yl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoic acid, a white powder, with a yield of 22.5%. EI-MSM / Z 329.3 [M] + ].
[0190] Example 60 Synthesis of Compound II-12
[0191] Under nitrogen protection, 3-bromo-5-cyano-4-(2-hydroxypropane-2-yl)benzoic acid (2.84 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 0.63 g of 3-cyano-4-(2-hydroxypropane-2-yl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoic acid, a white powder, with a yield of 19.4%. EI-MS M / Z 336.4 [M+].
[0192] Example 61 Synthesis of Compound II-13
[0193] Under nitrogen protection, methyl 3-bromo-4-(2-hydroxypropane-2-yl)benzoate (2.73 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give methyl 4-(2-hydroxypropane-2-yl)-3-(2-methyl-1H-benzimidazol-5-yl)benzoate, a white powder, 1.55 g, yield 47.8%. EI-MS M / Z325.4 [M + ].
[0194] Example 62 Synthesis of Compound II-14
[0195] Under nitrogen protection, methyl 3-bromo-5-fluoro-4-(2-hydroxypropane-2-yl)benzoate (2.91 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give methyl 3-fluoro-4-(2-hydroxypropane-2-yl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoate, a white powder, 1.69 g, yield 49.4%. EI-MS M / Z 343.4 [M + ].
[0196] Example 63 Synthesis of Compound II-15
[0197] Under nitrogen protection, methyl 3-bromo-5-cyano-4-(2-hydroxypropane-2-yl)benzoate (2.98 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give methyl 3-cyano-4-(2-hydroxypropane-2-yl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoate, 1.63 g of off-white powder solid, yield 46.5%. EI-MS M / Z 350.4 [M+].
[0198] Example 64 Synthesis of Compound II-16
[0199] Under nitrogen protection, 2-(4-allyl-2-bromophenyl)propane-2-ol (2.55 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.68 g of 2-(4-allyl-2-(2-methyl-1H-benzimidazol-5-yl)phenyl)propane-2-ol, a white powder, with a yield of 22.2%. EI-MS M / Z307.4 [M + ].
[0200] Example 65 Synthesis of Compound II-17
[0201] Under nitrogen protection, 2-(4-allyl-2-bromo-6-fluorophenyl)propane-2-ol (2.73 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.59 g of 2-(4-allyl-2-fluoro-6-(2-methyl-1H-benzimidazol-5-yl)phenyl)propane-2-ol, a white powder, with a yield of 18.2%. EI-MSM / Z 325.4 [M] + ].
[0202] Example 66 Synthesis of Compound II-18
[0203] Under nitrogen protection, 5-allyl-3-bromo-2-(2-hydroxypropane-2-yl)benzonitrile (2.80 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 0.61 g of 5-allyl-2-(2-hydroxypropane-2-yl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile, a white powder, with a yield of 18.4%. EI-MS M / Z 332.4 [M+].
[0204] Example 67 Synthesis of Compound II-19
[0205] Under nitrogen protection, 2-(3-bromo-4-(2-hydroxypropane-2-yl)phenyl)acetonitrile (2.54 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 1.08 g of 2-(4-(2-hydroxypropane-2-yl)-3-(2-methyl-1H-benzimidazol-5-yl)phenyl)acetonitrile, a white powder, with a yield of 35.4%. EI-MS M / Z 306.4 [M+].
[0206] Example 68 Synthesis of Compound II-20
[0207] Under nitrogen protection, 2-(3-bromo-5-fluoro-4-(2-hydroxypropane-2-yl)phenyl)acetonitrile (2.72 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 1.11 g of 2-(3-fluoro-4-(2-hydroxypropane-2-yl)-5-(2-methyl-1H-benzimidazol-5-yl)phenyl)acetonitrile, a white powder, with a yield of 34.3%. EI-MS M / Z 324.4 [M] + ].
[0208] Example 69 Synthesis of Compound II-21
[0209] Under nitrogen protection, 2.79 g (0.01 mol) of 3-bromo-5-cyanomethyl-2-(2-hydroxypropane-2-yl)benzonitrile and 1.76 g (0.01 mol) of (2-methyl-1H-benzimidazol-5-yl)boronic acid were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g (0.02 mol) and 0.36 g (0.5 mmol) of 1,1-bis(diphenylphosphine)ferrocene palladium dichloride. 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 0.93 g of 5-cyanomethyl-2-(2-hydroxypropane-2-yl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile, an off-white powder, with a yield of 28.1%. EI-MS M / Z 331.4 [M+].
[0210] Example 70 Synthesis of Compound II-22
[0211] Under nitrogen protection, 2-(2-bromo-4-propylphenyl)propane-2-ol (2.57 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.65 g of 2-(2-(2-methyl-1H-benzimidazol-5-yl)-4-propylphenyl)propane-2-ol, a white powder, with a yield of 53.5%. EI-MS M / Z 309.4 [M] + ].
[0212] Example 71 Synthesis of Compound II-23
[0213] Under nitrogen protection, 2-(2-bromo-6-fluoro-4-propylphenyl)propane-2-ol (2.75 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.33 g of 2-(2-fluoro-6-(2-methyl-1H-benzimidazol-5-yl)-4-propylphenyl)propane-2-ol, a white powder, with a yield of 40.7%. EI-MS M / Z 327.4 [M] + ].
[0214] Example 72 Synthesis of Compound II-24
[0215] Under nitrogen protection, 3-bromo-2-(2-hydroxypropane-2-yl)-5-propanebenzonitrile (2.82 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mol). 0.28 g (0.5 mmol) of 1,1'-bis(diphenylphosphine)ferrocene was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as eluent to give 1.01 g of 2-hydroxy-3-(2-methyl-1H-benzimidazol-5-yl)-5-propylbenzonitrile, an off-white powder solid, with a yield of 30.3%. EI-MS M / Z 334.4 [M+].
[0216] Example 73 Synthesis of Compound II-25
[0217] Under nitrogen protection, 2-(2-bromo-4-fluorophenyl)propane-2-ol (2.31 g, 0.1 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.1 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.21 g of 2-(4-fluoro-2-(1H-benzimidazol-5-yl)phenyl)propane-2-ol, a white powder solid, with a yield of 44.8%. EI-MS M / Z 271.3[M + ].
[0218] Example 74 Synthesis of Compound II-26
[0219] Under nitrogen protection, 2-(2-bromo-4,6-difluorophenyl)propane-2-ol (2.50 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.44 g of 2-(2,4-difluoro-6-(1H-benzimidazol-5-yl)phenyl)propane-2-ol, a white powder, with a yield of 49.9%. EI-MS M / Z 289.3 [M] + ].
[0220] Example 75 Synthesis of Compound II-27
[0221] Under nitrogen protection, 3-bromo-5-fluoro-2-(2-hydroxypropane-2-yl)benzonitrile (2.58 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 1.08 g of 5-fluoro-2-(2-hydroxypropane-2-yl)-3-(1H-benzimidazol-5-yl)benzonitrile, an off-white powder, with a yield of 36.6%. EI-MS M / Z 296.3 [M + ].
[0222] Example 76 Synthesis of Compound II-28
[0223] Under nitrogen protection, 3-bromo-4-(2-hydroxypropane-2-yl)benzamide (2.58 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.72 g of 4-(2-hydroxypropane-2-yl)-3-(1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 24.4%. EI-MS M / Z 296.3 [M] + ].
[0224] Example 77 Synthesis of Compound II-29
[0225] Under nitrogen protection, 3-bromo-5-fluoro-4-(2-hydroxypropane-2-yl)benzamide (2.76 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.83 g of 3-fluoro-4-(2-hydroxypropane-2-yl)-5-(1H-benzimidazol-5-yl)benzamide, a white powder, with a yield of 26.5%. EI-MS M / Z314.3 [M + ].
[0226] Example 78 Synthesis of Compound II-30
[0227] Under nitrogen protection, 3-bromo-5-cyano-4-(2-hydroxypropane-2-yl)benzamide (2.83 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.66 g of 3-cyano-4-(2-hydroxypropane-2-yl)-5-(1H-benzimidazol-5-yl)benzamide, a white powder, with a yield of 20.6%. EI-MS M / Z 321.4 [M+].
[0228] Example 79 Synthesis of Compound II-31
[0229] Under nitrogen protection, 3-bromo-4-(2-hydroxypropane-2-yl)-N,N-dimethylbenzamide (2.86 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.03 g of 4-(2-hydroxypropane-2-yl)-N,N-dimethyl-3-(1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 31.8%. EI-MS M / Z 324.4 [M] + ].
[0230] Example 80 Synthesis of Compound II-32
[0231] Under nitrogen protection, 3-bromo-5-fluoro-4-(2-hydroxypropane-2-yl)-N,N-dimethylbenzamide (3.04 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 1.04 g of 3-fluoro-4-(2-hydroxypropane-2-yl)-N,N-dimethyl-5-(1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 30.5%. EI-MS M / Z 342.4 [M] + ].
[0232] Example 81 Synthesis of Compound II-33
[0233] Under nitrogen protection, 3-bromo-5-cyano-4-(2-hydroxypropane-2-yl)-N,N-dimethylbenzamide (3.11 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 1.09 g of 3-cyano-4-(2-hydroxypropane-2-yl)-N,N-dimethyl-5-(1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 31.3%. EI-MS M / Z 349.4 [M+].
[0234] Example 82 Synthesis of Compound II-34
[0235] Under nitrogen protection, 3-bromo-4-(2-hydroxypropane-2-yl)benzoic acid (2.59 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.77 g of 4-(2-hydroxypropane-2-yl)-3-(1H-benzimidazol-5-yl)benzoic acid, a white powder, with a yield of 26.0%. EI-MS M / Z 297.3 [M] + ].
[0236] Example 83 Synthesis of Compound II-35
[0237] Under nitrogen protection, 3-bromo-5-fluoro-4-(2-hydroxypropane-2-yl)benzoic acid (2.77 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 0.76 g of 3-fluoro-4-(2-hydroxypropane-2-yl)-5-(1H-benzimidazol-5-yl)benzoic acid, a white powder, with a yield of 24.2%. EI-MS M / Z 315.3 [M + ].
[0238] Example 84 Synthesis of Compound II-36
[0239] Under nitrogen protection, 3-bromo-5-cyano-4-(2-hydroxypropane-2-yl)benzoic acid (2.84 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.74 g of 3-cyano-4-(2-hydroxypropane-2-yl)-5-(1H-benzimidazol-5-yl)benzoic acid, a white powder, with a yield of 23.0%. EI-MS M / Z 322.3 [M+].
[0240] Example 85 Synthesis of Compound II-37
[0241] Under nitrogen protection, methyl 3-bromo-4-(2-hydroxypropane-2-yl)benzoate (2.73 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give methyl 4-(2-hydroxypropane-2-yl)-3-(1H-benzimidazol-5-yl)benzoate, a white powder, 1.25 g, yield 40.3%. EI-MS M / Z 311.4 [M + ].
[0242] Example 86 Synthesis of Compound II-38
[0243] Under nitrogen protection, methyl 3-bromo-5-fluoro-4-(2-hydroxypropane-2-yl)benzoate (2.91 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give methyl 3-fluoro-4-(2-hydroxypropane-2-yl)-5-(1H-benzimidazol-5-yl)benzoate, a white powder solid, 1.89 g, yield 57.6%. EI-MS M / Z329.3 [M + ].
[0244] Example 87 Synthesis of Compound II-39
[0245] Under nitrogen protection, methyl 3-bromo-5-cyano-4-(2-hydroxypropane-2-yl)benzoate (2.98 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give methyl 3-cyano-4-(2-hydroxypropane-2-yl)-5-(1H-benzimidazol-5-yl)benzoate, 1.68 g of off-white powder solid, yield 50.1%. EI-MS M / Z 336.4 [M+].
[0246] Example 88 Synthesis of Compound II-40
[0247] Under nitrogen protection, 2-(4-allyl-2-bromophenyl)propane-2-ol (2.55 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.61 g of 2-(4-allyl-2-(1H-benzimidazol-5-yl)phenyl)propane-2-ol, a white powder solid, with a yield of 20.9%. EI-MS M / Z 293.4 [M] + ].
[0248] Example 89 Synthesis of Compound II-41
[0249] Under nitrogen protection, 2-(4-allyl-2-bromo-6-fluorophenyl)propane-2-ol (2.73 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.50 g of 2-(4-allyl-2-fluoro-6-(1H-benzimidazol-5-yl)phenyl)propane-2-ol, a white powder, with a yield of 16.1%. EI-MS M / Z 311.4 [M] + ].
[0250] Example 90 Synthesis of Compound II-42
[0251] Under nitrogen protection, 5-allyl-3-bromo-2-(2-hydroxypropane-2-yl)benzonitrile (2.80 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.56 g of 5-allyl-2-(2-hydroxypropane-2-yl)-3-(1H-benzimidazol-5-yl)benzonitrile, an off-white powder, with a yield of 17.6%. EI-MS M / Z 318.4 [M+].
[0252] Example 91 Synthesis of Compound II-43
[0253] Under nitrogen protection, 2-(3-bromo-4-(2-hydroxypropane-2-yl)phenyl)acetonitrile (2.54 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 1.02 g of 2-(4-(2-hydroxypropane-2-yl)-3-(1H-benzimidazol-5-yl)phenyl)acetonitrile, an off-white powder, with a yield of 26.1%. EI-MS M / Z 292.4 [M+].
[0254] Example 92 Synthesis of Compound II-44
[0255] Under nitrogen protection, 2-(3-bromo-5-fluoro-4-(2-hydroxypropane-2-yl)phenyl)acetonitrile (2.72 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.31 g of 2-(3-fluoro-4-(2-hydroxypropane-2-yl)-5-(1H-benzimidazol-5-yl)phenyl)acetonitrile, a white powder, with a yield of 42.3%. EI-MS M / Z 310.3 [M] + ].
[0256] Example 93 Synthesis of Compound II-45
[0257] Under nitrogen protection, 3-bromo-5-cyanomethyl-2-(2-hydroxypropane-2-yl)benzonitrile (2.79 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 1.03 g of 5-cyanomethyl-2-(2-hydroxypropane-2-yl)-3-(1H-benzimidazol-5-yl)benzonitrile, an off-white powder, with a yield of 32.6%. EI-MS M / Z 317.4 [M+].
[0258] Example 94 Synthesis of Compound II-46
[0259] Under nitrogen protection, 2-(2-bromo-4-propylphenyl)propane-2-ol (2.57 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.66 g of 2-(2-(1H-benzimidazol-5-yl)-4-propylphenyl)propane-2-ol, a white powder solid, with a yield of 56.4%. EI-MS M / Z 295.4 [M] + ].
[0260] Example 95 Synthesis of Compound II-47
[0261] Under nitrogen protection, 2-(2-bromo-6-fluoro-4-propylphenyl)propane-2-ol (2.75 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.38 g of 2-(2-fluoro-6-(1H-benzimidazol-5-yl)-4-propylphenyl)propane-2-ol, a white powder, with a yield of 44.2%. EI-MS M / Z 313.4 [M] + ].
[0262] Example 96 Synthesis of Compound II-48
[0263] Under nitrogen protection, 3-bromo-2-(2-hydroxypropane-2-yl)-5-propanebenzonitrile (2.82 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mol). 0.28 g (0.5 mmol) of 1,1'-bis(diphenylphosphine)ferrocene was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as eluent to give 0.89 g of 2-hydroxy-3-(1H-benzimidazol-5-yl)-5-propylbenzonitrile, an off-white powder solid, with a yield of 27.9%. EI-MS M / Z 320.4 [M+].
[0264] Example 97 Synthesis of Compound II-49
[0265] Under nitrogen protection, 1-(2-bromo-4-fluorophenyl)ethane-1-ol (2.19 g, 0.1 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.1 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 5 mmol), and 1... 1'-Bis(diphenylphosphine)ferrocene (0.28 g, 5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.04 g of 1-(4-fluoro-2-(2-methyl-1H-benzimidazol-5-yl)phenyl)ethane-1-ol, a white powder, with a yield of 38.5%. EI-MS M / Z 271.3 [M] + ].
[0266] Example 98 Synthesis of Compound II-50
[0267] Under nitrogen protection, 1-(2-bromo-4,6-difluorophenyl)ethane-1-ol (2.37 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.69 g of 1-(2,4-difluoro-6-(2-methyl-1H-benzimidazol-5-yl)phenyl)ethane-1-ol, a white powder, with a yield of 58.4%. EI-MS M / Z289.3 [M] + ].
[0268] Example 99 Synthesis of Compound II-51
[0269] Under nitrogen protection, 3-bromo-5-fluoro-2-(1-hydroxyethyl)benzonitrile (2.44 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.09 g of 5-fluoro-2-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile, a white powder, with a yield of 36.9%. EI-MS M / Z 296.3 [M + ].
[0270] Example 100 Synthesis of Compound II-52
[0271] Under nitrogen protection, 3-bromo-4-(1-hydroxyethyl)benzamide (2.42 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.72 g of 4-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzamide, a white powder, with a yield of 24.4%. EI-MS M / Z 296.3 [M + ].
[0272] Example 101 Synthesis of Compound II-53
[0273] Under nitrogen protection, 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzamide (2.62 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.86 g of 3-fluoro-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzamide, a white powder, with a yield of 27.4%. EI-MS M / Z314.3 [M + ].
[0274] Example 102 Synthesis of Compound II-54
[0275] Under nitrogen protection, 3-bromo-5-cyano-4-(1-hydroxyethyl)benzamide (2.69 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.70 g of 3-cyano-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 21.8%. EI-MSM / Z 321.4 [M+].
[0276] Example 103 Synthesis of Compound II-55
[0277] Under nitrogen protection, 3-bromo-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.72 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.10 g of 4-(1-hydroxyethyl)-N,N-dimethyl-3-(2-methyl-1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 34.0%. EI-MS M / Z 324.4 [M + ].
[0278] Example 104 Synthesis of Compound II-56
[0279] Under nitrogen protection, 3-bromo-5-fluoro-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.90 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.25 g of 3-fluoro-4-(1-hydroxyethyl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazol-5-yl)benzamide, a white powder, with a yield of 38.9%. EI-MS M / Z 342.4 [M + ].
[0280] Example 105 Synthesis of Compound II-57
[0281] Under nitrogen protection, 3-bromo-5-cyano-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.97 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 1.33 g of 3-cyano-4-(1-hydroxyethyl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 38.1%. EI-MS M / Z 349.4 [M+].
[0282] Example 106 Synthesis of Compound II-58
[0283] Under nitrogen protection, 3-bromo-4-(1-hydroxyethyl)benzoic acid (2.45 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.77 g of 4-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzoic acid, a white powder, with a yield of 26.0%. EI-MS M / Z 297.3 [M + ].
[0284] Example 107 Synthesis of Compound II-59
[0285] Under nitrogen protection, 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzoic acid (2.63 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.68 g of 3-fluoro-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoic acid, a white powder, with a yield of 21.6%. EI-MS M / Z315.3 [M + ].
[0286] Example 108 Synthesis of Compound II-60
[0287] Under nitrogen protection, 3-bromo-5-cyano-4-(1-hydroxyethyl)benzoic acid (2.70 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.71 g of 3-cyano-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoic acid, a white powder, with a yield of 22.0%. EI-MS M / Z 322.3 [M+].
[0288] Example 109 Synthesis of Compound II-61
[0289] Under nitrogen protection, methyl 3-bromo-4-(1-hydroxyethyl)benzoate (2.59 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give methyl 4-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzoate, a white powder, 1.55 g, yield 47.8%. EI-MS M / Z 311.4 [M + ].
[0290] Example 110 Synthesis of Compound II-62
[0291] Under nitrogen protection, methyl 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzoate (2.77 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give methyl 3-fluoro-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoate, a white powder, 1.74 g, yield 53.0%. EI-MS M / Z329.3 [M + ].
[0292] Example 111 Synthesis of Compound II-63
[0293] Under nitrogen protection, methyl 3-bromo-5-cyano-4-(1-hydroxyethyl)benzoate (2.84 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give methyl 3-cyano-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoate, 1.60 g of off-white powder solid, yield 47.7%. EI-MSM / Z 336.4 [M+].
[0294] Example 112 Synthesis of Compound II-64
[0295] Under nitrogen protection, 1-(4-allyl-2-bromophenyl)ethane-1-ol (2.40 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.72 g of 1-(4-allyl-2-(2-methyl-1H-benzimidazol-5-yl)phenyl)ethane-1-ol, a white powder, with a yield of 24.6%. EI-MS M / Z293.4 [M] + ].
[0296] Example 113 Synthesis of Compound II-65
[0297] Under nitrogen protection, 1-(4-allyl-2-bromo-6-fluorophenyl)ethane-1-ol (2.59 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.57 g of 1-(4-allyl-2-fluoro-6-(2-methyl-1H-benzimidazol-5-yl)phenyl)ethane-1-ol, a white powder, with a yield of 18.4%. EI-MSM / Z 311.4 [M] + ].
[0298] Example 114 Synthesis of Compound II-66
[0299] Under nitrogen protection, 5-allyl-3-bromo-2-(1-hydroxyethyl)benzonitrile (2.66 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.66 g of 5-allyl-2-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile, a white powder, with a yield of 20.7%. EI-MS M / Z 318.4 [M+].
[0300] Example 115 Synthesis of Compound II-67
[0301] Under nitrogen protection, 2-(3-bromo-(1-hydroxyethyl)phenyl)acetonitrile (2.40 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 1.02 g of 2-(4-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)phenyl)acetonitrile, an off-white powder, with a yield of 35.9%. EI-MS M / Z 292.4 [M+].
[0302] Example 116 Synthesis of Compound II-68
[0303] Under nitrogen protection, 2-(3-bromo-5-fluoro-4-(1-hydroxyethyl)phenyl)acetonitrile (2.58 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.02 g of 2-(3-fluoro-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazol-5-yl)phenyl)acetonitrile, a white powder, with a yield of 33.0%. EI-MS M / Z 310.3 [M + ].
[0304] Example 117 Synthesis of Compound II-69
[0305] Under nitrogen protection, 3-bromo-5-cyanomethyl-2-(1-hydroxyethyl)benzonitrile (2.65 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.84 g of 5-cyanomethyl-2-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile, a white powder, with a yield of 26.7%. EI-MS M / Z 317.4 [M+].
[0306] Example 118 Synthesis of Compound II-70
[0307] Under nitrogen protection, 1-(2-bromo-4-propylphenyl)ethane-1-ol (2.43 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.58 g of 1-(2-(2-methyl-1H-benzimidazol-5-yl)-4-propylphenyl)ethane-1-ol, a white powder, with a yield of 53.7%. EI-MS M / Z 295.4 [M] + ].
[0308] Example 119 Synthesis of Compound II-71
[0309] Under nitrogen protection, 1-(2-bromo-6-fluoro-4-propylphenyl)ethane-2-ol (2.61 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.19 g of 1-(2-fluoro-6-(2-methyl-1H-benzimidazol-5-yl)-4-propylphenyl)ethane-1-ol, a white powder, with a yield of 38.0%. EI-MS M / Z 313.4 [M] + ].
[0310] Example 120 Synthesis of Compound II-72
[0311] Under nitrogen protection, 3-bromo-2-(1-hydroxyethyl)-5-propanebenzonitrile (2.68 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 1.19 g of 2-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)-5-propylbenzonitrile, an off-white powder, with a yield of 37.3%. EI-MS M / Z 320.4 [M+].
[0312] Example 121 Synthesis of Compound II-73
[0313] Under nitrogen protection, 1-(2-bromo-4-fluorophenyl)ethane-1-ol (2.19 g, 0.1 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.1 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.33 g of 1-(4-fluoro-2-(1H-benzimidazol-5-yl)phenyl)ethane-1-ol, a white powder solid, with a yield of 51.9%. EI-MS M / Z 257.3[M + ].
[0314] Example 122 Synthesis of Compound II-74
[0315] Under nitrogen protection, 1-(2-bromo-4,6-difluorophenyl)ethane-1-ol (2.37 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.58 g of 1-(2,4-difluoro-6-(1H-benzimidazol-5-yl)phenyl)ethane-1-ol, a white powder, with a yield of 57.6%. EI-MS M / Z 275.3 [M] + ].
[0316] Example 123 Synthesis of Compound II-75
[0317] Under nitrogen protection, 3-bromo-5-fluoro-2-(1-hydroxyethyl)benzonitrile (2.44 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.89 g of 5-fluoro-2-(1-hydroxyethyl)-3-(1H-benzimidazol-5-yl)benzonitrile, an off-white powder, with a yield of 31.6%. EI-MS M / Z 282.3 [M] + ].
[0318] Example 124 Synthesis of Compound II-76
[0319] Under nitrogen protection, 3-bromo-4-(1-hydroxyethyl)benzamide (2.42 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction mixture was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.71 g of 4-(1-hydroxyethyl)-3-(1H-benzimidazol-5-yl)benzamide, an off-white powder solid, with a yield of 25.2%. EI-MS M / Z 282.3[M + ].
[0320] Example 125 Synthesis of Compound II-77
[0321] Under nitrogen protection, 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzamide (2.62 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.81 g of 3-fluoro-4-(1-hydroxyethyl)-5-(1H-benzimidazol-5-yl)benzamide, a white powder, with a yield of 27.1%. EI-MS M / Z 300.3 [M + ].
[0322] Example 126 Synthesis of Compound II-78
[0323] Under nitrogen protection, 3-bromo-5-cyano-4-(1-hydroxyethyl)benzamide (2.69 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.61 g of 3-cyano-4-(1-hydroxyethyl)-5-(1H-benzimidazol-5-yl)benzamide, an off-white powder solid, with a yield of 19.9%. EI-MS M / Z 307.3 [M+].
[0324] Example 127 Synthesis of Compound II-79
[0325] Under nitrogen protection, 3-bromo-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.72 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.21 g of 4-(1-hydroxyethyl)-N,N-dimethyl-3-(1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 39.1%. EI-MS M / Z310.4 [M + ].
[0326] Example 128 Synthesis of Compound II-80
[0327] Under nitrogen protection, 3-bromo-5-fluoro-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.90 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.22 g of 3-fluoro-4-(1-hydroxyethyl)-N,N-dimethyl-5-(1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 37.3%. EI-MS M / Z 328.4 [M] + ].
[0328] Example 129 Synthesis of Compound II-81
[0329] Under nitrogen protection, 3-bromo-5-cyano-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.97 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 1.22 g of 3-cyano-4-(1-hydroxyethyl)-N,N-dimethyl-5-(1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 36.5%. EI-MS M / Z 335.4 [M+].
[0330] Example 130 Synthesis of Compound II-82
[0331] Under nitrogen protection, 3-bromo-4-(1-hydroxyethyl)benzoic acid (2.45 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 4-(1-hydroxyethyl)-3-(1H-benzimidazol-5-yl)benzoic acid, a white powder solid, 0.71 g, yield 25.2%. EI-MS M / Z 283.3[M + ].
[0332] Example 131 Synthesis of Compound II-83
[0333] Under nitrogen protection, 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzoic acid (2.63 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.60 g of 3-fluoro-4-(1-hydroxyethyl)-5-(1H-benzimidazol-5-yl)benzoic acid, a white powder, with a yield of 20.0%. EI-MS M / Z 301.3 [M + ].
[0334] Example 132 Synthesis of Compound II-84
[0335] Under nitrogen protection, 3-bromo-5-cyano-4-(1-hydroxyethyl)benzoic acid (2.70 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.62 g of 3-cyano-4-(1-hydroxyethyl)-5-(1H-benzimidazol-5-yl)benzoic acid, a white powder solid, with a yield of 20.2%. EI-MS M / Z 308.3 [M+].
[0336] Example 133 Synthesis of Compound II-85
[0337] Under nitrogen protection, methyl 3-bromo-4-(1-hydroxyethyl)benzoate (2.59 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give methyl 4-(1-hydroxyethyl)-3-(1H-benzimidazol-5-yl)benzoate, a white powder solid, 1.59 g, yield 53.6%. EI-MS M / Z 297.3[M + ].
[0338] Example 134 Synthesis of Compound II-86
[0339] Under nitrogen protection, methyl 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzoate (2.77 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give methyl 3-fluoro-4-(1-hydroxyethyl)-5-(1H-benzimidazol-5-yl)benzoate, a white powder solid, 1.54 g, yield 49.0%. EI-MS M / Z 315.3 [M + ].
[0340] Example 135 Synthesis of Compound II-87
[0341] Under nitrogen protection, methyl 3-bromo-5-cyano-4-(1-hydroxyethyl)benzoate (2.84 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give methyl 3-cyano-4-(1-hydroxyethyl)-5-(1H-benzimidazol-5-yl)benzoate, 1.68 g of off-white powder solid, yield 52.3%. EI-MS M / Z 322.3 [M+].
[0342] Example 136 Synthesis of Compound II-88
[0343] Under nitrogen protection, 1-(4-allyl-2-bromophenyl)ethane-1-ol (2.40 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.77 g of 1-(4-allyl-2-(1H-benzimidazol-5-yl)phenyl)ethane-1-ol, a white powder, with a yield of 27.7%. EI-MS M / Z 279.4 [M] + ].
[0344] Example 137 Synthesis of Compound II-89
[0345] Under nitrogen protection, 1-(4-allyl-2-bromo-6-fluorophenyl)ethane-1-ol (2.59 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.51 g of 1-(4-allyl-2-fluoro-6-(1H-benzimidazol-5-yl)phenyl)ethane-1-ol, a white powder, with a yield of 17.2%. EI-MS M / Z 297.4 [M] + ].
[0346] Example 138 Synthesis of Compound II-90
[0347] Under nitrogen protection, 5-allyl-3-bromo-2-(1-hydroxyethyl)benzonitrile (2.66 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.69 g of 5-allyl-2-(1-hydroxyethyl)-3-(1H-benzimidazol-5-yl)benzonitrile, a white powder, with a yield of 22.7%. EI-MS M / Z 304.4 [M+].
[0348] Example 139 Synthesis of Compound II-91
[0349] Under nitrogen protection, 2-(3-bromo-(1-hydroxyethyl)phenyl)acetonitrile (2.40 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.85 g of 2-(4-(1-hydroxyethyl)-3-(1H-benzimidazol-5-yl)phenyl)acetonitrile, a white powder solid, with a yield of 30.6%. EI-MS M / Z 278.3 [M+].
[0350] Example 140 Synthesis of Compound II-92
[0351] Under nitrogen protection, 2-(3-bromo-5-fluoro-4-(1-hydroxyethyl)phenyl)acetonitrile (2.58 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.24 g of 2-(3-fluoro-4-(1-hydroxyethyl)-5-(1H-benzimidazol-5-yl)phenyl)acetonitrile, a white powder, with a yield of 42.0%. EI-MS M / Z 296.3 [M] + ].
[0352] Example 141 Synthesis of Compound II-93
[0353] Under nitrogen protection, 3-bromo-5-cyanomethyl-2-(1-hydroxyethyl)benzonitrile (2.65 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.89 g of 5-cyanomethyl-2-(1-hydroxyethyl)-3-(1H-benzimidazol-5-yl)benzonitrile, a white powder, with a yield of 29.4%. EI-MS M / Z 303.3 [M+].
[0354] Example 142 Synthesis of Compound II-94
[0355] Under nitrogen protection, 1-(2-bromo-4-propylphenyl)ethane-1-ol (2.43 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.55 g of 1-(2-(1H-benzimidazol-5-yl)-4-propylphenyl)ethane-1-ol, a white powder, with a yield of 55.3%. EI-MS M / Z 281.4 [M] + ].
[0356] Example 143 Synthesis of Compound II-95
[0357] Under nitrogen protection, 1-(2-bromo-6-fluoro-4-propylphenyl)ethane-2-ol (2.61 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.06 g of 1-(2-fluoro-6-(1H-benzimidazol-5-yl)-4-propylphenyl)ethane-1-ol, a white powder, with a yield of 35.5%. EI-MS M / Z 299.4 [M] + ].
[0358] Example 144 Synthesis of Compound II-96
[0359] Under nitrogen protection, 3-bromo-2-(1-hydroxyethyl)-5-propanebenzonitrile (2.68 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 1.02 g of 2-(1-hydroxyethyl)-3-(1H-benzimidazol-5-yl)-5-propylbenzonitrile, an off-white powder, with a yield of 33.4%. EI-MS M / Z 306.4 [M+].
[0360] Example 145 Synthesis of Compound II-97
[0361] Under nitrogen protection, (2-bromo-4-fluorophenyl)methanol (2.05 g, 0.1 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.1 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give (4-fluoro-2-(2-methyl-1H-benzimidazol-5-yl)phenyl)methanol, a white powder solid, in a yield of 1.11 g (43.3%). EI-MS M / Z 257.3[M + ].
[0362] Example 146 Synthesis of Compound II-98
[0363] Under nitrogen protection, (2-bromo-4,6-difluorophenyl)methanol (2.23 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give (2,4-difluoro-6-(2-methyl-1H-benzimidazol-5-yl)phenyl)methanol, a white powder, 1.39 g, yield 50.7%. EI-MS M / Z 275.3 [M + ].
[0364] Example 147 Synthesis of Compound II-99
[0365] Under nitrogen protection, 3-bromo-5-fluoro-2-(hydroxymethyl)benzonitrile (2.30 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.01 g of 5-fluoro-2-(hydroxymethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile, an off-white powder, with a yield of 35.9%. EI-MS M / Z 282.3 [M] + ].
[0366] Example 148 Synthesis of Compound II-100
[0367] Under nitrogen protection, 3-bromo-4-(hydroxymethyl)benzamide (2.30 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.66 g of 4-(hydroxymethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzamide, an off-white powder solid, with a yield of 23.5%. EI-MS M / Z 282.3[M + ].
[0368] Example 149 Synthesis of Compound II-101
[0369] Under nitrogen protection, 3-bromo-5-fluoro-4-(hydroxymethyl)benzamide (2.48 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.56 g of 3-fluoro-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzamide, a white powder, with a yield of 18.7%. EI-MS M / Z300.3 [M + ].
[0370] Example 150 Synthesis of Compound II-102
[0371] Under nitrogen protection, 3-bromo-5-cyano-4-(hydroxymethyl)benzamide (2.55 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.88 g of 3-cyano-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 28.7%. EI-MS M / Z 307.3 [M+].
[0372] Example 151 Synthesis of Compound II-103
[0373] Under nitrogen protection, 3-bromo-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.58 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.82 g of 4-(hydroxymethyl)-N,N-dimethyl-3-(2-methyl-1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 58.8%. EI-MS M / Z 310.4 [M + ].
[0374] Example 152 Synthesis of Compound II-104
[0375] Under nitrogen protection, 3-bromo-5-fluoro-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.76 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.45 g of 3-fluoro-4-(hydroxymethyl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazol-5-yl)benzamide, a white powder, with a yield of 44.3%. EI-MS M / Z 328.4 [M + ].
[0376] Example 153 Synthesis of Compound II-105
[0377] Under nitrogen protection, 3-bromo-5-cyano-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.83 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 1.16 g of 3-cyano-4-(hydroxymethyl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 34.7%. EI-MS M / Z 335.4 [M+].
[0378] Example 154 Synthesis of Compound II-106
[0379] Under nitrogen protection, 3-bromo-4-(hydroxymethyl)benzoic acid (2.31 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.57 g of 4-(hydroxymethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzoic acid as a white powder solid, with a yield of 20.2%. EI-MS M / Z 283.3[M + ].
[0380] Example 155 Synthesis of Compound II-107
[0381] Under nitrogen protection, 3-bromo-5-fluoro-4-(hydroxymethyl)benzoic acid (2.49 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.53 g of 3-fluoro-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoic acid, a white powder, with a yield of 17.6%. EI-MS M / Z 301.3 [M + ].
[0382] Example 156 Synthesis of Compound II-108
[0383] Under nitrogen protection, 3-bromo-5-cyano-4-(hydroxymethyl)benzoic acid (2.56 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.63 g of 3-cyano-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoic acid, a white powder, with a yield of 20.5%. EI-MS M / Z 308.3 [M+].
[0384] Example 157 Synthesis of Compound II-109
[0385] Under nitrogen protection, methyl 3-bromo-4-(hydroxymethyl)benzoate (2.45 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give methyl 4-(hydroxymethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzoate, a white powder, 1.85 g, yield 62.4%. EI-MS M / Z 297.3 [M + ].
[0386] Example 158 Synthesis of Compound II-110
[0387] Under nitrogen protection, methyl 3-bromo-5-fluoro-4-(hydroxymethyl)benzoate (2.63 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give methyl 3-fluoro-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoate, a white powder, 1.77 g, yield 56.3%. EI-MS M / Z315.3 [M + ].
[0388] Example 159 Synthesis of Compound II-111
[0389] Under nitrogen protection, methyl 3-bromo-5-cyano-4-(hydroxymethyl)benzoate (2.70 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give methyl 3-cyano-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoate, 1.69 g of off-white powder solid, yield 52.6%. EI-MS M / Z 322.4 [M+].
[0390] Example 160 Synthesis of Compound II-112
[0391] Under nitrogen protection, (4-allyl-2-bromophenyl)methanol (2.27 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give (4-allyl-2-(2-methyl-1H-benzimidazol-5-yl)phenyl)methanol, a white powder solid, 0.42 g, yield 14.1%. EI-MS M / Z 279.4[M + ].
[0392] Example 161 Synthesis of compound II-113
[0393] Under nitrogen protection, (4-allyl-2-bromo-6-fluorophenyl)methanol (2.45 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 0.41 g of (4-allyl-2-fluoro-6-(2-methyl-1H-benzimidazol-5-yl)phenyl)methanol, a white powder, with a yield of 13.8%. EI-MS M / Z 297.4 [M] + ].
[0394] Example 162 Synthesis of compound II-114
[0395] Under nitrogen protection, 5-allyl-3-bromo-2-(hydroxymethyl)benzonitrile (2.52 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.51 g of 5-allyl-2-(hydroxymethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile, an off-white powder, with a yield of 16.8%. EI-MS M / Z 304.4 [M+].
[0396] Example 163 Synthesis of Compound II-115
[0397] Under nitrogen protection, 2-(3-bromo-4-(hydroxymethyl)phenyl)acetonitrile (2.26 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.88 g of 2-(4-(hydroxymethyl)-3-(2-methyl-1H-benzimidazol-5-yl)phenyl)acetonitrile, a white powder, with a yield of 31.7%. EI-MS M / Z 278.4 [M+].
[0398] Example 164 Synthesis of Compound II-116
[0399] Under nitrogen protection, 2-(3-bromo-5-fluoro-4-(hydroxymethyl)phenyl)acetonitrile (2.44 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.22 g of 2-(3-fluoro-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazol-5-yl)phenyl)acetonitrile, a white powder, with a yield of 41.3%. EI-MSM / Z 296.3 [M] + ].
[0400] Example 165 Synthesis of Compound II-117
[0401] Under nitrogen protection, 3-bromo-5-cyanomethyl-2-(hydroxymethyl)benzonitrile (2.51 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.82 g of 5-cyanomethyl-2-(hydroxymethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile, a white powder, with a yield of 27.1%. EI-MS M / Z 303.3 [M+].
[0402] Example 166 Synthesis of Compound II-118
[0403] Under nitrogen protection, (2-bromo-4-propylphenyl)methanol (2.29 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give (2-(2-methyl-1H-benzimidazol-5-yl)-4-propylphenyl)methanol, a white powder solid, 1.58 g, yield 53.7%. EI-MS M / Z 281.4[M + ].
[0404] Example 167 Synthesis of Compound II-119
[0405] Under nitrogen protection, (2-bromo-6-fluoro-4-propylphenyl)methanol (2.47 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.06 g of (2-fluoro-6-(2-methyl-1H-benzimidazol-5-yl)-4-propylphenyl)methanol, an off-white powder, with a yield of 35.5%. EI-MS M / Z 299.4 [M] + ].
[0406] Example 168 Synthesis of Compound II-120
[0407] Under nitrogen protection, 3-bromo-2-(hydroxymethyl)-5-propanebenzonitrile (2.54 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 1.12 g of 2-(hydroxymethyl)-3-(2-methyl-1H-benzimidazol-5-yl)-5-propylbenzonitrile, an off-white powder, with a yield of 36.7%. EI-MS M / Z 306.4 [M+].
[0408] Example 169 Synthesis of Compound II-121
[0409] Under nitrogen protection, (2-bromo-4-fluorophenyl)methanol (2.05 g, 0.1 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.1 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was complete, the reaction mixture was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as eluent to give (4-fluoro-2-(1H-benzimidazol-5-yl)phenyl)methanol, a white powder solid, 1.24 g, yield 51.2%. EI-MS M / Z 243.3 [M + ].
[0410] Example 170 Synthesis of Compound II-122
[0411] Under nitrogen protection, (2-bromo-4,6-difluorophenyl)methanol (2.23 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.1 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give (2,4-difluoro-6-(1H-benzimidazol-5-yl)phenyl)methanol, a white powder solid, 1.52 g, yield 58.4%. EI-MS M / Z 261.2[M + ].
[0412] Example 171 Synthesis of compound II-123
[0413] Under nitrogen protection, 2.30 g (0.01 mol) of 3-bromo-5-fluoro-2-(hydroxymethyl)benzonitrile and 1.62 g (0.1 mol) of (1H-benzimidazol-5-yl)boronic acid were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g (0.02 mol), 0.36 g (0.5 mmol) of 1,1'-bis(diphenylphosphine)ferrocene palladium dichloride, and 0.28 g (0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction mixture was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.13 g of 5-fluoro-2-(hydroxymethyl)-3-(1H-benzimidazol-5-yl)benzonitrile, a white powder solid, with a yield of 42.3%. EI-MS M / Z 268.3[M + ].
[0414] Example 172 Synthesis of Compound II-124
[0415] Under nitrogen protection, 3-bromo-4-(hydroxymethyl)benzamide (2.30 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.58 g of 4-(hydroxymethyl)-3-(1H-benzimidazol-5-yl)benzamide, an off-white powder solid, with a yield of 21.7%. EI-MS M / Z 268.3[M + ].
[0416] Example 173 Synthesis of Compound II-125
[0417] Under nitrogen protection, 2.48 g (0.01 mol) of 3-bromo-5-fluoro-4-(hydroxymethyl)benzamide and 1.62 g (0.01 mol) of (1H-benzimidazol-5-yl)boronic acid were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g (0.02 mol), 0.36 g (0.5 mmol) of 1,1'-bis(diphenylphosphine)ferrocene palladium dichloride, and 0.28 g (0.5 mmol) of 1,1'-bis(diphenylphosphine)ferrocene. The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction mixture was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.65 g of 3-fluoro-4-(hydroxymethyl)-5-(1H-benzimidazol-5-yl)benzamide as a white powder solid, with a yield of 22.8%. EI-MS M / Z 286.3[M + ].
[0418] Example 174 Synthesis of Compound II-126
[0419] Under nitrogen protection, 3-bromo-5-cyano-4-(hydroxymethyl)benzamide (2.55 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.83 g of 3-cyano-4-(hydroxymethyl)-5-(1H-benzimidazol-5-yl)benzamide, an off-white powder solid, with a yield of 28.4%. EI-MS M / Z 293.3 [M+].
[0420] Example 175 Synthesis of Compound II-127
[0421] Under nitrogen protection, 3-bromo-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.58 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.12 g of 4-(hydroxymethyl)-N,N-dimethyl-3-(1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 37.9%. EI-MS M / Z 296.3 [M] + ].
[0422] Example 176 Synthesis of Compound II-128
[0423] Under nitrogen protection, 3-bromo-5-fluoro-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.76 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 1.05 g of 3-fluoro-4-(hydroxymethyl)-N,N-dimethyl-5-(1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 33.5%. EI-MS M / Z 314.3 [M] + ].
[0424] Example 177 Synthesis of Compound II-129
[0425] Under nitrogen protection, 3-bromo-5-cyano-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.83 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 1.03 g of 3-cyano-4-(hydroxymethyl)-N,N-dimethyl-5-(1H-benzimidazol-5-yl)benzamide, an off-white powder, with a yield of 32.1%. EI-MS M / Z 321.4 [M+].
[0426] Example 178 Synthesis of Compound II-130
[0427] Under nitrogen protection, 3-bromo-4-(hydroxymethyl)benzoic acid (2.31 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.37 g of 4-(hydroxymethyl)-3-(1H-benzimidazol-5-yl)benzoic acid as a white powder, with a yield of 13.8%. EI-MS M / Z 269.3[M + ].
[0428] Example 179 Synthesis of Compound II-131
[0429] Under nitrogen protection, 3-bromo-5-fluoro-4-(hydroxymethyl)benzoic acid (2.49 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 0.63 g of 3-fluoro-4-(hydroxymethyl)-5-(1H-benzimidazol-5-yl)benzoic acid as a white powder solid, with a yield of 22.0%. EI-MS M / Z 287.3[M + ].
[0430] Example 180 Synthesis of Compound II-132
[0431] Under nitrogen protection, 3-bromo-5-cyano-4-(hydroxymethyl)benzoic acid (2.56 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.33 g of 3-cyano-4-(hydroxymethyl)-5-(1H-benzimidazol-5-yl)benzoic acid, an off-white powder solid, with a yield of 11.3%. EI-MS M / Z 294.3 [M+].
[0432] Example 181 Synthesis of compound II-133
[0433] Under nitrogen protection, methyl 3-bromo-4-(hydroxymethyl)benzoate (2.45 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give methyl 4-(hydroxymethyl)-3-(1H-benzimidazol-5-yl)benzoate, a white powder solid, 1.63 g, yield 57.7%. EI-MS M / Z 283.3[M + ].
[0434] Example 182 Synthesis of compound II-134
[0435] Under nitrogen protection, methyl 3-bromo-5-fluoro-4-(hydroxymethyl)benzoate (2.63 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give methyl 3-fluoro-4-(hydroxymethyl)-5-(1H-benzimidazol-5-yl)benzoate, a white powder, 1.68 g, yield 55.9%. EI-MS M / Z 301.3 [M + ].
[0436] Example 183 Synthesis of Compound II-135
[0437] Under nitrogen protection, methyl 3-bromo-5-cyano-4-(hydroxymethyl)benzoate (2.70 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give methyl 3-cyano-4-(hydroxymethyl)-5-(1H-benzimidazol-5-yl)benzoate, a white powder solid, 1.32 g, yield 43.0%. EI-MS M / Z 308.3 [M+].
[0438] Example 184 Synthesis of compound II-136
[0439] Under nitrogen protection, (4-allyl-2-bromophenyl)methanol (2.27 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give (4-allyl-2-(1H-benzimidazol-5-yl)phenyl)methanol, a white powder solid, 0.22 g, yield 8.3%. EI-MS M / Z 265.3[M + ].
[0440] Example 185 Synthesis of Compound II-137
[0441] Under nitrogen protection, (4-allyl-2-bromo-6-fluorophenyl)methanol (2.45 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give (4-allyl-2-fluoro-6-(1H-benzimidazol-5-yl)phenyl)methanol, a white powder solid, 0.36 g, yield 12.8%. EI-MS M / Z 283.3[M + ].
[0442] Example 186 Synthesis of Compound II-138
[0443] Under nitrogen protection, 5-allyl-3-bromo-2-(hydroxymethyl)benzonitrile (2.52 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 0.38 g of 5-allyl-2-(hydroxymethyl)-3-(1H-benzimidazol-5-yl)benzonitrile, an off-white powder solid, with a yield of 13.1%. EI-MS M / Z 290.3 [M+].
[0444] Example 187 Synthesis of compound II-139
[0445] Under nitrogen protection, 2-(3-bromo-4-(hydroxymethyl)phenyl)acetonitrile (2.26 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.15 g of 2-(4-(hydroxymethyl)-3-(1H-benzimidazol-5-yl)phenyl)acetonitrile, an off-white powder solid, with a yield of 43.7%. EI-MS M / Z 264.3 [M+].
[0446] Example 188 Synthesis of Compound II-140
[0447] Under nitrogen protection, 2-(3-bromo-5-fluoro-4-(hydroxymethyl)phenyl)acetonitrile (2.44 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as eluent to give 1.06 g of 2-(3-fluoro-4-(hydroxymethyl)-5-(1H-benzimidazol-5-yl)phenyl)acetonitrile, a white powder, with a yield of 37.7%. EI-MS M / Z 282.3 [M] + ].
[0448] Example 189 Synthesis of Compound II-141
[0449] Under nitrogen protection, 3-bromo-5-cyanomethyl-2-(hydroxymethyl)benzonitrile (2.51 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as the eluent to give 1.15 g of 5-cyanomethyl-2-(hydroxymethyl)-3-(1H-benzimidazol-5-yl)benzonitrile, an off-white powder, with a yield of 39.9%. EI-MS M / Z 289.3 [M+].
[0450] Example 190 Synthesis of compound II-142
[0451] Under nitrogen protection, (2-bromo-4-propylphenyl)methanol (2.29 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.06 g of (2-(1H-benzimidazol-5-yl)-4-propylphenyl)methanol, an off-white powder solid, with a yield of 39.8%. EI-MS M / Z 267.3[M + ].
[0452] Example 191 Synthesis of compound II-143
[0453] Under nitrogen protection, (2-bromo-6-fluoro-4-propylphenyl)methanol (2.47 g, 0.01 mol) and (1H-benzimidazol-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give (2-fluoro-6-(1H-benzimidazol-5-yl)-4-propylphenyl)methanol, a white powder solid, 1.23 g, yield 42.3%. EI-MS M / Z 285.3[M + ].
[0454] Example 192 Synthesis of compound II-144
[0455] Under nitrogen protection, 3-bromo-2-(hydroxymethyl)-5-propanebenzonitrile (2.54 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol) and 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol). 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed with ethyl acetate / petroleum ether as eluent to give 1.52 g of 2-(hydroxymethyl)-3-(1H-benzimidazol-5-yl)-5-propylbenzonitrile, an off-white powder, with a yield of 52.2%. EI-MS M / Z 292.4 [M+].
[0456] Example 193 Synthesis of Formula I-24-A
[0457]
[0458] Under nitrogen protection, 2-bromo-4-fluoro-1-anisole (2.05 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.55 g of 5-(5-fluoro-2-methoxyphenyl)-1H-benzimidazole, an off-white powder solid, with a yield of 64.0%. EI-MS M / Z 243.3 [M+].
[0459] Example 194 Synthesis of Formula I-24-B
[0460]
[0461] Under nitrogen protection, 2-bromo-4-fluorophenol (1.91 g, 0.01 mol) and (1-methyl-1H-benzimidazol-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.15 g of 4-fluoro-2-(1-methyl-1H-benzimidazol-5-yl)phenol, an off-white powder solid, with a yield of 47.5%. EI-MS M / Z 243.3 [M+].
[0462] Example 195 Synthesis of Formula I-24-C
[0463]
[0464] Under nitrogen protection, 2-bromophenol (1.73 g, 0.01 mol) and (7-fluoro-1H-benzimidazol-5-yl)boric acid (1.80 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110 °C and reacted for 2 h. After the reaction was completed, the reaction solution was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to give 1.02 g of 2-(7-fluoro-1H-benzimidazol-5-yl)phenol, an off-white powder solid, with a yield of 44.69%. EI-MS M / Z 229.2 [M+].
[0465] Example 196: Bioactivity assay of primary myocardial cells from suckling rats after injury
[0466] Test method:
[0467] Primary rat neonatal cardiomyocytes were isolated and cultured, and seeded in cell culture plates. Drug stock solution was added to the cell wells at a specific dilution ratio, with a final concentration of 10 μM. After 30 minutes of drug treatment, phenylephrine (PE) stock solution was added, with a final PE concentration of 20 μM. After 48 hours of PE treatment, cell samples were collected for real-time quantitative PCR or cell area measurement.
[0468] Rat cardiomyocyte isolation and plating: According to the actual cell quantity requirements, a certain number of SPF-grade suckling rats were taken and placed in a clean bench. The thoracic cavity was cut open with scissors, the heart was separated, and the heart was cut into tissue fragments with sterile surgical scissors. Type II collagenase (manufacturer: Sigma, catalog number: C2-28-100MG) was added to D-HANKS balanced salt buffer to prepare an enzyme digestion solution of 5 μL / mL. Heart tissue fragments were digested three times consecutively in a 37°C constant temperature water bath. For the first digestion, about 2 mL of enzyme digestion solution was added. After digestion and centrifugation to precipitate cardiomyocytes and tissue fragments, the supernatant was discarded. For the second and third digestions, about 4 mL of enzyme digestion solution was added respectively to continue digestion. The supernatant was retained each time, and DMEM containing 10% FBS was immediately added to the same volume as the supernatant digestion solution to neutralize the digestive enzyme. The supernatants of the second and third digestions were combined, centrifuged, and the supernatant was discarded. The cardiomyocytes were resuspended in an appropriate amount of DMEM containing 10% FBS and seeded in 100 mm culture dishes. The cells were then incubated in a constant temperature cell culture incubator for differential adhesion for 2 hours. After that, the supernatant was collected for cell counting.
[0469] Rat cardiomyocyte area detection: 24-well plates pre-coated with 1% gelatin were analyzed using 1.0 × 10⁻⁶ cells / well. 3 Cells were seeded in 500 μL of 10% FBS + DMEM medium per well and cultured at 37°C for 24 hours. Different compounds were prepared as 100 mM stock solutions with DMSO, and then serially diluted with 10% FBS + DMEM medium to prepare 10 μM final solutions containing 0.5% DMSO. The medium in the 24-well plates was discarded and replaced with 500 μL / well of 10 μM compound medium, with three replicates for each compound and negative control wells. After 0.5 hours of drug treatment, PE (manufacturer: Meilun Biotechnology; catalog number: MB1602) was added to each well to a final concentration of 20 μM, except for the negative control wells. After 48 hours of PE treatment, at least five fields of view were randomly selected from each well under an inverted microscope (manufacturer: Nikon; model: Eclipse TS100), and cell area data were calculated using ImageJ software. With the cell area of the negative control well as 1, the cell area hypertrophy factor of the PE well and each drug administration well was calculated, and statistical analysis was performed using the one-way ANOVA method.
[0470] Real-time quantitative PCR
[0471] Take a 24-well plate pre-coated with 1% gelatin, and use 1×10 5Cells were seeded into plates with 500 μL of 10% FBS + DMEM medium per well and cultured at 37°C for 24 hours. Different compounds were prepared into 100 mM stock solutions using DMSO, and then serially diluted with 10% FBS + DMEM medium to prepare a final 10 μM compound solution containing 0.5% DMSO. The medium in the 24-well plates was discarded and replaced with 500 μL / well of medium containing 10 μM of the compound, with three replicates for each compound and negative control wells. After 0.5 hours of drug incubation, PE (manufacturer: Meilun Biotechnology; catalog number: MB1602) was added to each well to a final concentration of 20 μM, except for the negative control wells. Samples were analyzed after 48 hours of PE incubation.
[0472] The expression levels of genes related to cardiomyocyte hypertrophy were compared by real-time quantitative PCR detection of atrial natriuretic peptide (ANP) and myosin heavy chain β (β-MHC) mRNA levels. The procedure included total RNA extraction, reverse transcription to synthesize cDNA, and real-time quantitative PCR assay.
[0473] Perform the real-time quantitative PCR steps according to the following reaction system and procedure (Note: all relevant primers can be purchased commercially).
[0474] ANP primers:
[0475] Forward primer: CTGCTAGACCACCTGGAGGA
[0476] Reverse primer: AAGCTGTTGCAGCCTAGTCC
[0477] β-MHC primers:
[0478] Forward primer: TGCAAAGGCTCCAGGTCTGAGGGC
[0479] Reverse primer: GCCAACACCAACCTGTCCAAGTTC
[0480] Reaction system: 20 μL
[0481] Reaction procedure:
[0482]
[0483] Results Summary and Analysis:
[0484] Preliminary modeling experiment for cardiomyocyte hypertrophy: Before the experiment, it is necessary to confirm that PE can successfully induce cardiomyocyte hypertrophy.
[0485] Drug screening results
[0486] Drugs with anti-cardiomyocyte hypertrophy potential were initially screened based on the detection of ANP mRNA levels in cardiomyocytes using real-time quantitative PCR. Then, the mRNA levels of another hypertrophy gene, β-MHC, were used for validation. One-way ANOVA was used for statistical analysis, and GraphPad Prism was used for statistical analysis. It can be seen that there are significant differences between the typical compounds in Formulas I-1 to I-48 and Formulas II-1 to I-144 and the PE group (all P values are less than 0.05).
[0487]
[0488] The study validated the intervention by directly measuring cardiomyocyte area and comparing differences between groups. Cardiomyocytes, after being treated with both PE and drugs, were directly observed and photographed under a microscope, and cell area data were calculated using ImageJ software. The results are shown in Table 4. The results showed that the cardiomyocyte area in the typical drug intervention groups of Formula I and Formula II was significantly lower than that in the PE group, while Formulas I-24-A, I-24-B, and I-24-C showed no significant improvement.
[0489] Table 4
[0490]
[0491] Example 197: Pharmacological Experiment in a Mouse Model of Heart Failure Due to Stress Overload
[0492] 1. Materials and Methods
[0493] Healthy C57BL / 6 mice
[0494] Drugs and Dosing Regimens
[0495]
[0496] method
[0497] Modeling:
[0498] Aortic ligation modeling: Preoperative echocardiography was performed to exclude mice with abnormal cardiac function. For mice with normal cardiac function, anesthesia was administered, and the mice were then transferred to the small animal operating table and fixed in place. Anesthesia was maintained by establishing a respiratory pathway through endotracheal intubation. Using the second rib as the center, the skin was incised along the sternum towards the first and third ribs to expose the junction of the second rib and sternum. The second rib was then incised to expose the thoracic segment of the aorta. The aortic arch was freed, and a fine suture was inserted below it. A fine needle was placed parallel to the aortic arch and ligated together. After ligation, the needle was removed, and the mouse's condition was observed. Once the condition stabilized, the sutures were closed layer by layer. The mice were kept warm on a heat-insulating mat. After waking up, they were returned to their cages for routine care based on their activity level.
[0499] Experimental grouping and dosing regimen:
[0500] Five weeks after modeling, echocardiography was performed on mice to determine their cardiac ejection fraction. When the ejection fraction decreased to approximately 50%, the experimental requirements were met, and the drug administration experiment could begin. Based on the ultrasound data, animals were randomly grouped and drugged. Echocardiography was performed on mice every two weeks until the ninth week, at which point pathological section analysis was conducted.
[0501] Statistical analysis:
[0502] Results are expressed as mean ± standard error. Data analysis was performed using GraphPad Prism statistical software. The t-test was used for comparison. A p-value < 0.05 was considered statistically significant, otherwise it was considered not significant.
[0503] 2 Results
[0504] 2.1 Effects of the test drug on disease development in mice
[0505] The results are shown in Tables 5 and 6. It can be seen that after four weeks of administration (i.e., nine weeks of modeling), the typical drugs of Formula I and Formula II have a significant effect on improving cardiac contractile function, while Formula I-24-A, Formula I-24-B and Formula I-24-C have no significant effect.
[0506] Table 5
[0507]
[0508] Table 6
[0509]
[0510] Four weeks after administration (i.e., nine weeks after modeling), tissue samples were taken from the heart of the mice. Pathological results showed that cardiac fibrosis increased significantly after modeling treatment; however, the degree of fibrosis was significantly reduced after treatment with the typical test drugs of Formula I and Formula II (described in Tables 5 and 6).
[0511] In summary, the synthesis process of the benzimidazole compounds of the present invention is simple and easy to control; they have cardioprotective effects and can be used to treat chronic heart failure, showing broad application prospects.
[0512] The applicant declares that the above embodiments illustrate the compounds, their preparation methods, and applications of the present invention, but the present invention is not limited to the above embodiments, that is, it does not mean that the present invention must rely on the above embodiments to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions of the raw materials used in the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.
Claims
1. A benzimidazole compound or a pharmaceutically acceptable salt thereof, characterized in that, The benzimidazole compounds have the structure shown in Formula I or Formula II: R1 and R2 are hydrogen or C1~C4 straight-chain alkyl groups; R3 is cyano, fluorine, or hydrogen; R4 can be fluorine, allyl, n-propyl, cyanomethyl, carboxyl, C1-C4 straight-chain alkoxycarbamoyl, carbamoyl, or dimethylcarbamoyl. R5 is hydrogen or a C1~C4 straight-chain alkyl group; When a benzimidazole compound has the structure shown in Formula I, and when R4 is a carboxyl group, R3 is hydrogen, and R5 is not a methyl group.
2. The benzimidazole compound or a pharmaceutically acceptable salt thereof according to claim 1, characterized in that, The benzimidazole compound is any one of the compounds having the following formulas: I-1 to I-47 and II-1 to II-144: 。 3. The benzimidazole compound or a pharmaceutically acceptable salt thereof according to claim 1, characterized in that, The pharmaceutically acceptable salt is an organic or inorganic acid salt of the benzimidazole compound.
4. The benzimidazole compound or a pharmaceutically acceptable salt thereof according to claim 3, characterized in that, The organic acid salt is selected from any one of tartrate, stearate, oxalate, citrate, lactate, sorbate, fumarate, formate, acetate, benzoate, benzenesulfonate, ethanesulfonate, resin acid salt, trifluoroacetate, maleate, malate, methanesulfonate, fumarate, amino acid salt, or nicotinate.
5. The benzimidazole compound or a pharmaceutically acceptable salt thereof according to claim 3, characterized in that, The organic acid salt is selected from any one of tartrate, acetate, maleate, L-malate or fumarate.
6. The benzimidazole compound or a pharmaceutically acceptable salt thereof according to claim 3, characterized in that, The inorganic acid salt is selected from any one of phosphate, sulfate, nitrate, iodate, bromate, hydroiodate, hydrobromate or hydrochloride.
7. The benzimidazole compound or a pharmaceutically acceptable salt thereof according to claim 3, characterized in that, The inorganic acid salt is selected from any one of phosphate, sulfate or hydrochloride.
8. The method for preparing a benzimidazole compound or a pharmaceutically acceptable salt thereof according to any one of claims 1-7, characterized in that, The preparation method includes the following steps: the brominated compound shown in Formula B reacts with the boric acid compound shown in Formula V under the action of a catalyst to undergo a Suzuki reaction, yielding the benzimidazole compound as described in any one of claims 1-7, as shown in the following reaction formula: R is a hydroxyl group or .
9. The preparation method according to claim 8, characterized in that, The molar ratio of the brominated compound shown in Formula B to the boric acid compound shown in Formula V is 1:0.8 to 1:
3.
10. The preparation method according to claim 8, characterized in that, The catalyst is any one or a combination of at least two of tetra(triphenylphosphine)palladium, 1,1-bis(diphenylphosphine)ferrocene palladium dichloride, or palladium acetate.
11. The preparation method according to claim 8, characterized in that, The molar ratio of the catalyst to the boric acid compound shown in Formula V is 0.001:1 to 0.5:
1.
12. The preparation method according to claim 8, characterized in that, The Suzuki reaction is carried out in the presence of an alkaline substance.
13. The preparation method according to claim 12, characterized in that, The alkaline substance is any one or a combination of at least two of potassium fluoride, potassium acetate, sodium carbonate, potassium carbonate, or potassium phosphate.
14. The preparation method according to claim 8, characterized in that, The Suzuki reaction is carried out in an organic solvent, which is any one or a combination of at least two of DMF, toluene, ethanol, 1,4-dioxane, or THF.
15. The preparation method according to claim 8, characterized in that, The Suzuki reaction was carried out at a temperature of 70–150 °C for a time of 0.25 h–48 h.
16. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises a benzimidazole compound or a pharmaceutically acceptable salt thereof as described in any one of claims 1-7.
17. The pharmaceutical composition according to claim 16, characterized in that, The pharmaceutical composition also contains pharmaceutically acceptable excipients.
18. The pharmaceutical composition according to claim 17, characterized in that, The pharmaceutically acceptable excipient is any one of the following: excipient, diluent, carrier, flavoring agent, binder, or filler.
19. The pharmaceutical composition according to claim 16, characterized in that, The dosage form of the pharmaceutical composition is an oral preparation, a parenteral preparation, or a topical preparation.
20. The use of any benzimidazole compound or a pharmaceutically acceptable salt thereof, or any pharmaceutical composition according to any one of claims 1-7, in the preparation of a medicament for treating chronic heart failure.
21. Use of a substituted benzimidazole compound or a pharmaceutically acceptable salt thereof or a pharmaceutical composition thereof in the preparation of a medicament for treating chronic heart failure, said substituted benzimidazole compound having the following structure: 。