A method for increasing biofilm production of lactic acid bacteria under salt stress

Abstract

The invention discloses a method for increasing the biofilm yield of lactic acid bacteria under salt stress, wherein the method is to introduce a sacA gene from halophilic tetragenococcus into the lactic acid bacteria through genetic engineering technology, and the obtained recombinant lactic acid bacteria can effectively increase the biofilm yield under salt stress, and when cultured to the fifth day, the biofilm amount of the recombinant lactic acid bacteria is 5.24 times that of the original strain, thereby achieving the effect of increasing the tolerance of cells to environmental stress. The method of the invention is simple to operate and can be widely applied to industrial production.

Description

Technical Field

[0001] The invention relates to the technical field of microbial engineering, and in particular to a method for increasing the biofilm yield of lactic acid bacteria under salt stress. Background Art

[0002] For functional microorganisms that play a leading role in fermentation or target product production, the formation of biofilms is beneficial to improve their adaptability in the face of fierce competition and increasingly harsh fermentation environments. At the same time, the generation of extracellular matrix, as the main feature of biofilm formation, can protect cells from toxic compounds, antibiotics and enzymes, and improve the tolerance of cells to environmental stress.

[0003] Most lactic acid bacteria can participate in the food processing process mainly based on fermented foods as beneficial bacteria, and can also benefit human health by regulating intestinal microorganisms and inhibiting pathogenic bacteria. The formation of lactic acid bacteria biofilm is believed to be beneficial to the survival ability and probiotic properties of lactic acid bacteria. Therefore, understanding the formation and characteristics of lactic acid bacteria biofilm and improving its production will help further play the positive role of lactic acid bacteria in the fermentation industry and human health.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] The object of the present invention is to provide a method for increasing the biofilm production of lactic acid bacteria under salt stress, which is to increase the biofilm production of lactic acid bacteria under salt stress by constructing a recombinant lactic acid bacteria capable of expressing 6-phosphate sucrose hydrolase.

[0006] The present invention is achieved in that:

[0007] Firstly, the present invention constructs a recombinant vector, which contains the coding target gene sacA.

[0008] Among them, the target gene sacA encodes sucrose-6-phosphate hydrolase.

[0009] In the present invention, the coding gene sacA of 6-phosphopsucrose hydrolase is derived from Tetragenococcus halophilus. Preferably, the deposit number of Tetragenococcus halophilus is CGMCC NO.3792, which has been deposited in the General Microbiological Center of China Microbiological Culture Collection Administration Committee on April 29, 2010, and the address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. The strain is a published strain and has been disclosed in patents such as CN201510813755.8.

[0010] Specifically, the nucleotide sequence of the sacA gene encoding 6-phosphate sucrose hydrolase from the above-mentioned halophilic Tetragenococcus is shown in SEQ ID NO.1.

[0011] The method for constructing the above recombinant vector is as follows: purifying the obtained target gene, and double-digesting the vector with PstⅠ and HindⅢ, and connecting the digestion product with the purified target gene to obtain the recombinant vector.

[0012] In the present invention, the vector in the recombinant vector may be a pMG36e plasmid, but is not limited to the above plasmid, and may also be other lactobacillus expression vectors or Lactococcus lactis expression vectors.

[0013] On the basis of the above-mentioned recombinant vector, the present invention further provides a recombinant lactic acid bacteria, which is obtained by introducing the obtained recombinant vector into a host bacterium to obtain the recombinant lactic acid bacteria.

[0014] In the present invention, the host bacteria of the recombinant lactic acid bacteria include Lactococcus lactis NZ9000.

[0015] The inventors have found that the recombinant lactic acid bacteria obtained by the above method can increase the cell membrane production under adverse stress, thereby achieving the effect of improving the cell's tolerance to environmental stress. The adverse stress in the present invention refers to salt stress. It has been verified that the recombinant lactic acid bacteria of the present invention have a biofilm production of more than 5 times that of the original strain under salt stress.

[0016] Based on this, the recombinant lactic acid bacteria obtained by the present invention can be used to increase the biofilm production of lactic acid bacteria under salt stress. Therefore, the present invention also provides a method for increasing the biofilm production of lactic acid bacteria under salt stress, which comprises: expressing 6-phosphate sucrose hydrolase in lactic acid bacteria.

[0017] Specifically, the method comprises: connecting the target gene sacA to an expression vector, then introducing the obtained recombinant vector into a host bacterium to obtain recombinant lactic acid bacteria, and then culturing the recombinant lactic acid bacteria to express the target gene sacA.

[0018] In some embodiments, in order to verify whether the target gene is expressed, when constructing the recombinant vector, the EGFP sequence is inserted at the same time as the target gene sacA gene.

[0019] In some embodiments, the nucleotide sequence of EGFP is shown as SEQ ID NO.2.

[0020] The present invention has the following beneficial effects:

[0021] The present invention introduces the sacA gene from halophilic tetragenococcus into lactic acid bacteria through genetic engineering technology, and the obtained recombinant lactic acid bacteria can effectively improve its biofilm production under salt stress. When cultured to the fifth day, the biofilm amount of the recombinant lactic acid bacteria is 5.24 times that of the original strain, thereby achieving the effect of improving the tolerance of cells to environmental stress. The method of the present invention is simple to operate and can be widely applied to industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0023] Figure 1 This is a comparison chart of the biofilm yield of the original strain and the recombinant strain under salt stress in Example 2. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0025] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0026] The sources or components of the materials that may be involved in the following examples are as follows:

[0027] 1. The Lactococcus lactis NZ9000 involved in the present invention comes from Jiangnan University.

[0028] 2. The culture medium involved in the present invention is as follows:

[0029] Liquid LB medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride, pH adjusted to 7.0. Sterilize at 121°C for 20 min. Add erythromycin as needed to a final concentration of 500 ug / mL.

[0030] Solid LB medium: Liquid LB medium plus 2% (m / v) agar. Add erythromycin as needed to a final concentration of 500ug / mL.

[0031] Liquid GM17 medium: M17 medium supplemented with 5 g / L glucose. Sterilize at 121°C for 20 min. Add erythromycin as needed to a final concentration of 25 ug / mL.

[0032] Solid GM17 medium: Liquid GM17 medium supplemented with 2% (m / v) agar. Add erythromycin as needed to a final concentration of 25ug / mL.

[0033] Liquid SGM17 medium: M17 medium supplemented with 2.38 g / L sucrose and 2.5 g / L glucose. Sterilize at 121°C for 20 min. Add erythromycin as needed to a final concentration of 25 ug / mL.

[0034] Example 1

[0035] This example is the construction of recombinant lactic acid bacteria, the host bacteria is Lactococcus lactis NZ9000, and the specific construction process of the recombinant strain Lactococcus lactis NZ9000 (pNZ8148-sacA-EGFP) is as follows:

[0036] (1) Using the genome of Tetragenococcus halophilus (CGMCC 3792) as a template, the target gene sacA was amplified using primers sacA-F and sacA-R and purified.

[0037] The primer sequences involved are:

[0038] sacA-F:5'-AACTGCAGATGAATCTTATTAACAAGTGGACAAGAGAATTACGC-3' (SEQ IDNO.3);

[0039] sacA-R: 5'-CCGGTACCTTACCGCGCAGACCGTAAAATC-3' (SEQ ID NO. 4).

[0040] The obtained nucleotide sequence of the target gene sacA is shown in SEQ ID NO.1:

[0041] ATGAATCTTATTAACAAGTGGACAAGAGAATTACGCTATCATCCTTATGAAAAATGGGGGAAAGATTATCAAGATCAATTAAACAAAACTGTTAATCAATCGATTTGGCGTTTAGATTACCATATCCAACCAGTTACTGGTTTATTAAATGATCCAAATGGTTTTACTTTCTTTAATGGCAAGTGGCACTTGTTTTACCAATTTTATCCTTTTGGTCCTGTGCATGGTTTGAAATCCTGGTTTCACCTAACTTCAACCAATTTAGTGGACTGGAAAGAAGAAGGCATCCGTCTTTTACCTGATAGTTTGTATGATAGTCACGGCGTTTATTCTGGTTCTGCTTTAGCTATTGATGATCAATTGCTGCTTGCTTACACTGGAAACGTACGTAACGCTGATTGGGAACGCTCTACTTATCAGCTAGGGGCTTATATGGATAAAAAACACCAAATCAACAAAGTGGAGACCCCGCTTGTCTCGGGACCTCCTAAAGGATACACAACAAATTTTCGTGATCCGCAAGTTATTTTTTACCAAGATCACTATTTAATGATCATTGGAGCCCAAACAACAGAAGAAAAAGGAGAAATTCTTCTCTATAAAAGTAAGGATTTAAAAGATTGGCAATTTTTGGGGCCTTTAAACTTCACTCAACAATCTTTAGGCTTTATGGTGGAA.

[0042] (2) The pMG36e plasmid was double-digested with PstⅠ and HindⅢ, and the digestion product was linked to the purified target gene sacA and enhanced green fluorescent protein (EGFP), wherein the nucleotide sequence of EGFP is shown in SEQ ID NO.2:

[0043] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT.

[0044] (3) The ligation product was transformed into competent Escherichia coli MC1061, positive clones were screened, and after verification by PCR and restriction digestion, the recombinant plasmid was extracted and introduced into competent Lactococcus lactis NZ9000 by electroporation technology.

[0045] (4) The electroporation conditions were as follows: 20 μL of recombinant plasmid and 50 μL of competent cells were mixed and transferred into a pre-cooled 2 mm electroporation cuvette; the voltage was adjusted to 2 000 V, the capacitance to 25 μF, and the resistance to 200 μΩ for electroporation.

[0046] (5) Positive clones were screened and verified by PCR and sequencing to obtain the recombinant bacteria Lactococcus lactis NZ9000 (pMG36e-sacA).

[0047] (6) The sacA gene fragment in the recombinant plasmid extracted from the recombinant bacteria was amplified by PCR using primers pMG36e-sacA-F and pMG36e-sacA-R.

[0048] The primer sequences involved are:

[0049] pMG36e-sacA-F:5'-GCAAAGTCTGAAAACGAAGGTGG-3' (SEQ ID NO.5);

[0050] pMG36e-sacA-R: 5'-TTACCGCGCAGACCGTAAAAT-3' (SEQ ID NO. 6).

[0051] (7) The EGFP coding sequence was amplified by PCR using primers pMG36e-sacA-EGFP-F and pMG36e-sacA-EGFP-F.

[0052] The primer sequences involved are:

[0053] pMG36e-sacA-EGFP-F:5'-CGGTCTGCGCGGTAAATGGTGAGCAAGG GCGAG-3' (SEQ IDNO.7);

[0054] pMG36e-sacA-EGFP-R:5'-GTTTTCAGACTTTGCTTACTTGTACAGCT CGTCCATGCC-3' (SEQ ID NO. 8).

[0055] (8) The PCR products were connected to obtain the recombinant plasmid pMG36e-sacA-EGFP.

[0056] (9) The recombinant plasmid pMG36e-sacA-EGFP was screened, amplified, and then electroporated into competent Lactococcus lactis NZ9000 to obtain the recombinant bacteria Lactococcus lactis NZ9000 (pMG36e-sacA-EGFP), which was recorded as S11.

[0057] Example 2

[0058] This example is a verification experiment of the application of the recombinant lactic acid bacteria constructed in Example 1 in improving the biofilm production under salt stress. The biofilm production of the recombinant strain under salt stress is detected. The specific steps are as follows:

[0059] (1) The original strain NZ (Lactococcus lactis NZ9000 (pMG36e)) and the recombinant strain S11 (Lactococcus lactis NZ9000 (pMG36e-sacA-EGFP)) were inoculated into SGM17 medium containing 2.5% (m / v) NaCl, and cultured at 30°C to form biofilms.

[0060] (2) The amount of biofilm was measured using the crystal violet method. Immerse the well plate in physiological saline, rinse gently to remove non-adherent cells, remove the upper layer of liquid with a pipette, and dry at 35°C for 4 hours. Stain with 1% (w / v) crystal violet for 15 minutes. Then wash the well plate by immersing it in water until the washed water is colorless, and dry it at 35°C for 4 hours. Pipette 200 μL of 30% (v / v) glacial acetic acid aqueous solution into each well, decolorize for 20 minutes, transfer the decolorized liquid to a new well plate, and measure the absorbance at 492 nm using an enzyme reader.

[0061] The results are as follows Figure 1 As shown, compared with the original strain NZ, the recombinant strain S11 had a higher biofilm production under salt stress conditions, which was 5.24 times that of the original strain NZ on the fifth day of culture, proving that the expression of the sacA gene can significantly increase the biofilm amount of Lactococcus lactis under salt stress conditions.

[0062] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Use of a gene encoding 6-phosphopsucrose hydrolase in improving the stress resistance of recombinant lactic acid bacteria, characterized in that: The stress resistance includes: biofilm production under salt stress; The recombinant lactic acid bacteria contains a gene encoding 6-phosphate sucrose hydrolase. sacA recombinant vector; The host bacteria of the recombinant lactic acid bacteria is Lactococcus lactis.

2. The use according to claim 1, characterized in that: The coding gene of the 6-phosphopsucrose hydrolase sacA Derived from halophilic Tetragenococcus.

3. The use according to claim 2, characterized in that: The deposit number of the halophilic tetragenococcus is CGMCCNO.3792; The coding gene of the 6-phosphopsucrose hydrolase sacA The nucleotide sequence is shown in SEQ ID NO.

1.

4. The use according to claim 3, characterized in that: The Lactococcus lactis includes Lactococcus lactis NZ9000.

5. The use according to claim 4, characterized in that: The plasmid in the recombinant vector includes pMG36e.

6. A method for increasing biofilm production of lactic acid bacteria under salt stress, characterized in that: include: Expression of 6-phosphate sucrose hydrolase in Lactococcus lactis.

7. The method according to claim 6, characterized in that The coding gene of the 6-phosphopsucrose hydrolase sacA Derived from halophilic Tetragenococcus.

8. The method according to claim 7, characterized in that The deposit number of the halophilic tetragenococcus is CGMCCNO.3792; The coding gene of the 6-phosphopsucrose hydrolase sacA The nucleotide sequence is shown in SEQ ID NO.

1.

9. The method according to claim 8, characterized in that 6-phosphate sucrose hydrolase gene sacA Connecting with the expression vector, then introducing the obtained recombinant vector into the host bacteria to obtain the recombinant lactic acid bacteria, and then culturing the recombinant lactic acid bacteria to make it express 6-phosphate sucrose hydrolase; The expression vector includes pMG36e; the host bacteria includes Lactococcus lactis NZ9000.

Images