Sex-specific dna fragments, primers, applications and kits for platichthys stellatus

Abstract

The present application relates to a kind of sex-related specific DNA fragments of starburst flathead flounder, primer, application and kit, belong to molecular biology field, the nucleotide sequence of the specific DNA fragment is as shown in SEQ ID NO:1, the nucleotide sequence of the primer is as shown in SEQ ID NO:4 and SEQ ID NO:5.The primer is used to carry out PCR amplification to the DNA of starburst flathead flounder, two bands are amplified in male individual, length is 1327bp and 762bp respectively;One band is amplified in female individual, and it is the 762bp fragment.The present application also provides kit comprising the primer for identifying the genetic sex of starburst flathead flounder.The sex-specific molecular marker primer of the present application can accurately and efficiently identify the genetic sex of starburst flathead flounder, and the identification method is simple and easy to operate, and the required cost is low.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology, and particularly relates to a specific DNA fragment related to the gender of starry turbot, primers, applications and kits. BACKGROUND

[0002] Starry turbot belongs to the order Pleuronectiformes, the family Pleuronectidae and the genus Scaphirhynchus. It has a gentle character, strong adaptability to temperature and salinity, and a wide living range, and can survive in seawater and freshwater, and is suitable for various farming modes such as workshop, net cage and pond, and is a new fish farming variety with great potential. Since starry turbot has obvious gender dimorphism, the growth rate of females is 2-4 times faster than that of males, and the breeding ratio of females and males will directly affect the economic benefits of aquaculture. However, the female and male individuals are not easy to distinguish in the juvenile stage, and there is no heteromorphic sex chromosome, so the genetic sex cannot be distinguished according to the morphology of the sex chromosome, and therefore a specific molecular marker for identifying the genetic sex of starry turbot needs to be developed.

[0003] The development of the marker will promote the exploration of the gender differentiation mechanism of starry turbot, help to carry out artificial selection and breeding, and research gender control breeding technology, and improve the economic benefits of aquaculture. SUMMARY

[0004] The present application aims to provide a specific DNA fragment related to the gender of starry turbot, primers, applications and kits.

[0005] The present application is realized by the following technical solutions:

[0006] A specific DNA fragment related to the gender of starry turbot, wherein the nucleotide sequence of the DNA fragment is shown in SEQ ID NO: 1.

[0007] The specific sequence of the nucleotide shown in SEQ ID NO: 1 is 620 bp in length.

[0008] gaggaagaatgccatgacgtataaattctgctgtcaaaagtaaagtgtttttgttgacagcactttttgtcatcgacacacccactcacttgttgtgaattttccaccaaattgacatgctgtattctcatgtggacacactcagaaattttacagaataaagtgccggcagggaaagtccctgaaaatgtctgactgactcgggcatttgagttcttacatacagcctcctcagggtttatctgcaggaaaatgtccagacttcaacacacaataactccggccactgctattgttctcaatcaaaacaataacaaaagacccctgctcttagtttgatgacaccatgaagcagtgttggatcgtgggagttgttaatggttcattgatgaggtactgaatcccaagttttattcacattatgcagcaaacaacactgagtgaacataatccattacgagtgactgttaactggccaactggctaacatcgtgttcttccttcgtcatatgatgttgtggaaataatttcagagacaggcaaagctacattaaaaatggatatgacgcaattggaaggcaacttagatataatgtccaattaccatgaatacattttga.

[0009] The application further provides a pair of primers for identifying the genetic sex of Pseudosciaena heterura, and nucleotide sequences of the primers are shown in SEQ ID NO: 4 and SEQ ID NO: 5.

[0010] PSTEL-Forward: 5'-agtgaatgacctcagcagcc-3' (SEQ ID NO: 4);

[0011] PSTEL-Reverse: 5'-gcatcaaggacgcagtaaat-3' (SEQ ID NO: 5).

[0012] The application further provides an application of the primers, and the application method is that the DNA of Pseudosciaena heterura is subjected to PCR amplification by using the primers, two bands with lengths of 1327 bp and 762 bp are amplified in male individuals, and one band with a length of 762 bp is amplified in female individuals.

[0013] the specific sequence of nucleotides set forth in SEQ ID NO:2, 1327 bp in length:

[0014]

[0015] the specific sequence of nucleotides shown in SEQ ID NO: 3, 762 bp in length:

[0016] accgtttgtcttagctggtgaatccctgaaccgtctgttagacgatttaagcttttattttattatttttttcccccccaaataaaatatgaaagggatctgatgtaattctattattatactgatactgccgccagttcatctgctagtggtattaccattgcctctactattcctaatgtcatgagacccgttacaaaagctatttcaccatatctttattggatttgtttggtgaggattaacgagctgaagctgttttagaagtgaacacccggaaatgtctgaaaaattggtcctgccacaggagattgttcaggtcagacgttttcaggacaacagtcgacaattttggcctggttagggcatgctggatttctctggttgttggaaccatttttgatgatattagtccacaagtcgtttttggaatttttaatggagaatagttatatgttatatcttccactgcatggctgtctcaagaaaattcacttttgcactctgcacgctcagtggctgtcatactggcagctctatgatatcccaaagatgctgatgagcaggaaatgctgagattgaaacgtgggttgatattgtaatttaatattgtgatactttattgagccctgcaggaacattttcgtcattcctctgtcctcatggaggtcagaccacaggcagagctacacaacaacactgctgcagagaggaagatatattgtagaagggtgcaggtgcaacatgctctggacttgctct.

[0017] The present application also provides a kit for identifying the genetic sex of Scophthalmus maximus comprising said pair of primers.

[0018] Compared with the prior art, the application has the beneficial effects that the gender-specific molecular marker primer of the application can accurately and efficiently identify the genetic sex of the starry turbot, the identification method is simple and easy to operate, the required cost is low, and it is suitable for large-scale detection in breeding work. Since only the fish fin needs to be collected, the damage to the fish body during detection is extremely low, which is beneficial to the sex control breeding and germplasm resource protection of the starry turbot. At the same time, it is helpful to promote the research on the sex differentiation mechanism of the starry turbot, screen sex-reversed individuals, and carry out sex control breeding. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Electrophoresis detection results of male and female starry turbot genetic sex identification;

[0020] Figure 2 For the nucleotide sequence alignment of SEQ ID NO: 2 and SEQ ID NO: 3, SEQ ID NO: 1 is the part unique in SEQ ID NO: 2;

[0021] Figure 3 Sample gonad histological section of starry turbot. DETAILED DESCRIPTION

[0022] In order to better understand the content of the application, the accompanying drawings are combined with the Figures 1-3 The technical content of the application is further described in conjunction with the specific implementation cases. The materials and reagents used can be obtained from commercial channels. The described implementation cases are only a part of the application, not all the embodiments. The protection scope of the application is not limited in any form. All other implementation manners obtained without creative labor belong to the protection scope of the application.

[0023] Example 1

[0024] In order to verify the accuracy of the gender-specific molecular marker of the application, it is verified in the starry turbot.

[0025] Starry turbot sample: 19 sexually mature individuals of starry turbot were selected from the farm.

[0026] Gonadal histological determination: 19 starry turbot were dissected, and the gonads were placed in 4% paraformaldehyde for overnight fixation, and then soaked in 10mM phosphate buffer solution for 1 hour. After fixation, dehydration was performed with gradient ethanol, the tissue was paraffin-embedded, cut into 4um sections, stained with eosin / hematoxylin, and observed under a microscope to distinguish the gender, 10 females and 9 males, as shown in Figure 3

[0027] DNA extraction: The fish fin of each sample was collected, and the DNA sample was prepared using a DNA extraction kit. The quality of the extracted DNA was detected by a nucleic acid quantification instrument.​

[0028] PCR amplification: The collected *Flounder* DNA samples were subjected to PCR amplification using the primers described above. The reaction mixture was 50 μL: 2 μL each of forward and reverse primers (10 μmol / L), 25 μL of Rapid enzyme, 1 μL of DNA template (300-500 ng / μL), and 20 μL of ultrapure water. The PCR amplification program was: 94℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s; annealing at T0. m = 55℃ annealing for 15s, 72℃ extension for 30s, 34 cycles; 72℃ extension for 5min; store at 12℃.

[0029] The primers mentioned are:

[0030] PSTEL-positive:5'-agtgaatgacctcagcagcc-3';

[0031] PSTEL-reverse:5'-gcatcaaggacgcagtaaat-3'.

[0032] Amplification result detection: PCR products were detected by 1% agarose gel electrophoresis to analyze their specificity. Electrophoresis results are as follows: Figure 1 and Figure 2 As shown. Figure 1 The male individuals were amplified as a combination of SEQ ID NO:2 and SEQ ID NO:3 fragments, with lengths of 1327bp and 762bp, respectively; the female individuals were amplified as the SEQ ID NO:3 fragment, with a length of 762bp.

[0033] This case study verifies that the PCR electrophoresis results of sex-specific molecular marker amplification using primers from the starfish are consistent with the results of gonadal histological determination. Figure 3 As shown, this specific molecular marker can accurately identify the genetic sex of the starfish. This identification method is simple to operate, has a clear procedure, and provides intuitive and accurate results.

[0034] The above description is merely a preferred embodiment of the present invention and does not limit the invention. Equivalent substitutions and modifications based on the content of the present invention are all within the scope of protection of the present invention.

Claims

1. Use of primers for identifying the genetic sex of Platichthys stellatus, characterized in that, The application method is to use the primer to perform PCR amplification on DNA of the starry turbot, two bands are amplified in male individuals, one band is amplified in female individuals, and the nucleotide sequences of the primer are shown in SEQ ID NO: 4 and SEQ ID NO: 5.

Images