An InDel molecular marker associated with dark purple leaves of non-heading cabbage and its application

Abstract

The invention discloses an InDel molecular marker related to the dark purple trait of leaves of non-heading Chinese cabbage and its application, and relates to the technical field of molecular marker-assisted breeding. The polymorphism of the Indel molecular marker of the invention is an insertion / deletion sequence, which is obtained by amplifying the specific primers as shown in SEQ ID NO.1-2. The invention constructs a hybrid population of purple non-heading Chinese cabbage and green non-heading Chinese cabbage, and uses F 2:4 The segregating population was identified by phenotype, genetic pattern analysis, and mixed pool sequencing, and InDel markers that can be used to distinguish purple and green leaf colors were obtained. This molecular marker can be used to identify purple and green leaf non-heading cabbages with high accuracy and can be used as a molecular marker-assisted breeding selection tool for purple non-heading cabbages. It is of great significance in actual production applications.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding, and particularly relates to an InDel molecular marker detection primer set associated with the dark purple color of non-heading cabbage leaves and a use thereof. Background Art

[0002] Non-heading Chinese cabbage (Brassica campestris ssp.chinensis Makino), also known as Chinese cabbage, is a subspecies of Brassica rapa in the family Cruciferae. Due to its strong adaptability and high nutritional value, it has been introduced and produced on a large scale in recent years and has become the main supply vegetable in the world. Purple vegetables are popular among consumers because they are rich in anthocyanins. Anthocyanins are a type of water-soluble pigment in the flavonoid synthesis pathway, which has the function of protecting humans from various chronic diseases caused by glycation and inflammation. With the development of molecular biology and the completion of cabbage genome sequencing, genes related to cabbage leaf color have been located and cloned one after another. The degree of purple expression is different, and the genes are also located on different chromosomes, indicating that the regulation of leaf purple in cabbage is complex.

[0003] InDel polymorphic molecular markers are designed based on the sequences on both sides of the insertion / deletion (InDel) site and are amplified by PCR using specific primers. They have the advantages of high accuracy, easy typing, and simple detection. They are widely used in vegetable breeding. The location of the purple gene in non-heading cabbage leaves and the development of Indel molecular markers for purple leaf trait genes have certain guiding significance for purple gene cloning and genetic molecular improvement breeding. Summary of the invention

[0004] In view of the above-mentioned deficiencies in the prior art, the present invention locates the purple leaf gene on chromosome A03 using BSA-seq, develops molecular markers closely related to the trait and verifies the reliability of the markers, with the aim of providing a primer set for detecting InDel molecular markers related to purple leaves in non-heading cabbage, and also providing the application of the molecular markers. The present invention constructs a hybrid population of purple non-heading cabbage and green non-heading cabbage, and uses F 2:4 The first generation of isolated populations were subjected to phenotypic identification, genetic pattern analysis, mixed pool sequencing, and map-based cloning, and InDel markers that can be used to distinguish between purple and green varieties were obtained.

[0005] To achieve the above purpose, the technical solution adopted by the present invention to solve the technical problem is:

[0006] A set of primer sets for detecting purple InDel molecular markers of non-heading Chinese cabbage, including specific primers for detecting InDel molecular marker sites, and the specific sequences of the specific primers are as follows:

[0007] Z364-Forward primer: 5'-GTGCTCCATAACTTTTCATT-3' (SEQ ID NO.1);

[0008] Z364-Reverse prime: 5'-CCCTGACAACGTTTAAAATC-3' (SEQ ID NO. 2).

[0009] The forward primer is named Z364 Forward primer; the reverse primer is named Z364 Reverse primer.

[0010] Using the marker Z364, if the isolated band contains only a 139 bp DNA fragment, it means that the leaves of the material are purple, which is marked as A. Its sequence is SEQ ID NO.3, and the specific sequence is as follows:

[0011] GTGCTCCATAACTTTTCATTTTTTCTCTGGAAGCTGGAAGTCTCTTAGTTTTCAAATA GTTACTCTTTTTGTGCATAGTAACTATTCGCCTTGTTAAACATTTTAATACATATATACTTGA TTTTAAACGTTGTCAGGG (SEQ ID NO. 3).

[0012] If the Z364 separation band contains only a 130 bp DNA fragment, it means that the leaves of the material are green, which is recorded as B. Its sequence is SEQ ID NO.4. The specific sequence is as follows:

[0013] GTGCTCCATAACTTTTCATTTTTTCTCTGGAAGCTGGAAGTCTCTTAGTTTTCAACTTTTTGTGCATAGTAACTATTCGCCTTGTTAAACATTTTAATACATATATACTTGATTTTAAAC GTTGTCAGGG (SEQ ID NO. 4).

[0014] If the separated band contains two fragments of 139 bp and 130 bp, it indicates that the leaf is light purple and is marked as H.

[0015] An InDel molecular marker associated with the dark purple color of non-heading cabbage leaves comprises the above primer sequence.

[0016] A method for detecting InDel molecular markers associated with dark purple color of non-heading cabbage leaves, comprising the following steps:

[0017] (1) Extraction of genomic DNA from plant materials to be identified

[0018] (2) using the DNA of the sample to be tested extracted in step 1 as a template, using the InDel molecular marker described in any one of claims 1 to 3 and the method described in claims 4 to 5, to perform PCR amplification on the DNA sample template DNA to obtain a PCR amplification product;

[0019] (3) The PCR amplification products were subjected to 12% polyacrylamide gel electrophoresis. If the separated band contained only a 139 bp DNA fragment, it indicated that the leaves of the material were purple homozygous. If it contained only a 130 bp DNA fragment, it indicated that the leaves of the material were green homozygous. If it contained both 139 bp and 130 bp fragments, it indicated that the leaves were light purple heterozygous.

[0020] Furthermore, the PCR amplification system in step (2) is: 1 μL of 200 ng / μL DNA template, 0.5 μ of each upstream and downstream primer of 10 μM S-63 or Z364, 5 μL of 2×SanTaqPCRMix, and 3 μL of ddH2O. The total reaction system is 10 μL.

[0021] Furthermore, in step (2), the PCR reaction program is 94°C, 5 min; 94°C, 30 s, 55°C, 30 s, 72°C, 45 s, 35 cycles; 72°C, 10 min, cooled to 12°C for storage.

[0022] Application of the above-mentioned InDel molecular markers in genotyping of purple varieties of non-heading Chinese cabbage.

[0023] Application of the above-mentioned InDel molecular markers in the identification of purple varieties of non-heading cabbage and genetic diversity analysis.

[0024] Application of the above-mentioned InDel molecular markers in screening or identifying purple varieties of non-heading Chinese cabbage.

[0025] The application of the above-mentioned InDel molecular markers in breeding purple varieties of non-heading cabbage or improving non-heading cabbage germplasm resources.

[0026] Beneficial effects of the present invention:

[0027] The invention constructs a hybrid population of purple non-heading Chinese cabbage and green non-heading Chinese cabbage, and utilizes F 2:4The Indel molecular markers provided by the present invention can be used to quickly identify and distinguish purple non-heading cabbage at the seedling stage, with high efficiency, simple operation, low detection cost, and can accelerate the breeding process of non-heading cabbage leaf color. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 To mark the genetic map position of Z364;

[0029] Figure 2 To mark the banding pattern of Z364 in some 21XZS61 populations, lane 1 is P1 (dark purple phenotype), lane 2 is P2 (green phenotype), lane 3 is heterozygous F1 (light purple phenotype), lanes 4-28 are all 130bp bands, consistent with the green banding pattern, and lanes 29-32 are all 139bp bands, consistent with the purple banding pattern. DETAILED DESCRIPTION

[0030] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0031] Example 1 Construction of sample pool

[0032] The experimental materials used in this application are all provided by the Cruciferae Research Group of Northwest Agriculture and Forestry University, including purple non-heading cabbage 'ZY-3' and green non-heading cabbage '14XS17'.

[0033] Green non-heading cabbage '14XS17' was bred from the local cabbage variety 'Ai Kang Qing' as the original material through continuous self-pollination and phenotypic observation.

[0034] The purple non-heading cabbage "ZY-3" was bred from a variant of the purple non-heading cabbage PK11 (Beijing Zhongnong Lvheng Seed Technology Co., Ltd.) as the original material. It was selected through continuous self-pollination, separation, purification, and a high-generation inbred line of purple non-heading cabbage with stable traits.

[0035] After hybridization of the above two materials, the F 2:4Segregating population 21XZS61. Thirty extreme purple plants and thirty green plants were selected from the segregating population to construct purple pools and green pools for BSA-seq and genetic positioning.

[0036] Two parents, F1 and F 2:4 The leaf color of the group was observed during the adult stage, and the whole plant phenotype was counted by visual inspection, which was purple and green respectively.

[0037] Example 2 InDel molecular marker development

[0038] 1. DNA extraction and sequencing

[0039] The modified CTAB method was used to extract leaf genomic DNA. The specific steps are as follows:

[0040] (1) Take 0.1 g of fresh young non-heading cabbage leaves and put them into a 2 mL centrifuge tube. Add 2 steel balls and crush the leaves thoroughly with an oscillating crusher.

[0041] (2) Add 700 μL CTAB extraction solution (preheated at 65°C) and mix thoroughly.

[0042] (3) Incubate at 65°C for 30 min, inverting occasionally to mix.

[0043] (4) Add 600 μL of chloroform / isoamyl alcohol (24:1) and mix thoroughly. Centrifuge at 12,000 rpm for 5 min at room temperature.

[0044] (5) Transfer the aqueous phase to a new 1.5 mL centrifuge tube, add an equal volume of chloroform:isoamyl alcohol (24:1) and extract for the second time, centrifuge, and remove the supernatant.

[0045] (6) Add 1 / 10 volume of 5M NaCl to a new centrifuge tube, and then add 2 times the volume of pre-cooled anhydrous ethanol.

[0046] Gently invert several times to mix, and place at -20°C for at least 20 min. Remove the centrifuge tube, centrifuge at 10,000 rpm for 3 min, and discard the supernatant.

[0047] (7) Add 1 mL of 70% ethanol to suspend the precipitate, centrifuge at 10,000 rpm for 3 min at room temperature, discard the supernatant, and air-dry on the bench.

[0048] (8) Add 500 μL dd H2O to dissolve and store in a -20°C refrigerator until used.

[0049] 2. Indel Primer Design

[0050] According to the BSA sequencing results, Indel markers were designed at sites with large fragment differences in the peak region. Primers were mainly designed using Primer5.0 software, and all primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0051] 3. Indel Primer Screening

[0052] (1) From F 2:4 Thirty green-leaf and purple-leaf plants were selected from the population for DNA pool sequencing (BSA-seq). The pool sequencing data were analyzed using the ED and SNP-index algorithms, respectively, and five candidate regions related to the purple trait were finally obtained, with a total length of 4.31Mb, located on chromosome A03.

[0053] (2) Using individual plants from the segregating population to verify the linkage relationship between the polymorphic marker and the target gene, molecular markers were designed and polymorphisms were screened for Indel sites on chromosome A03 that differed by more than 4 bp between the two parents. Finally, the Indel marker Z364, which is closest to the gene controlling the purple leaf trait, was obtained.

[0054] Example 3 Method for Identifying Purple Leaf Traits of Non-heading Chinese Cabbage Using Indel Molecular Markers

[0055] 1. Extraction of genomic DNA from non-heading cabbage leaves

[0056] The improved CTAB method was used to extract leaf genomic DNA. The specific operation steps are shown in Example 2.

[0057] 2. Amplification of marker primer Z364 in non-heading cabbage DNA

[0058] Among them, DNA template 1μL, upstream and downstream primers 0.5μL each, 2×San Taq PCR Mix 5μL, sterile distilled water to supplement the reaction system to 10μL; the reaction program is: 94℃5min; 94℃30s; 56℃30s; 72℃30s; 34 cycles; 72℃5min. The primer sequences are as follows:

[0059] Z364-Forward primer: 5'-GTGCTCCATAACTTTTCATT-3'(SEQ ID NO.1)

[0060] Z364-Reverse primier:5'-CCCTGACAACGTTTAAAATC-3'(SEQ ID NO.2)

[0061] 3. Polyacrylamide gel electrophoresis detection

[0062] After PCR, 12% non-denaturing polyacrylamide gel electrophoresis was performed with an electrophoresis voltage of 220 V, a current of 400 mA, a time of 1 h 30 min, and a 1×TBE electrophoresis buffer. After electrophoresis, silver staining was performed for color development, observation, and photography.

[0063] 4. Genotyping statistics

[0064] The electrophoresis results were photographed under the light. If the separated band contained only a 139bp DNA fragment, it indicated that the leaves of the material were purple, recorded as A. If it contained only a 130bp DNA fragment, it indicated that the leaves of the material were green, recorded as B. If it contained both 139bp and 130bp fragments, the leaves were light purple, recorded as H.

[0065] 5. Feasibility verification

[0066] In order to verify the feasibility and accuracy of this marker, 160 F 2:4 Samples, all sample materials were from the Cruciferae Laboratory of Northwest Agriculture and Forestry University.

[0067] Among them, the one with a 139bp band was recorded as A, and its genotype was the same as that of purple-leaf non-heading Chinese cabbage ZY, and its leaves were purple; the one with a 130bp band was recorded as B, and its genotype was the same as that of green-leaf non-heading Chinese cabbage 14XS17, and its leaves were green; the one with two bands was recorded as H, and its leaves were light purple. The specific band patterns are shown in Table 1. Figure 2 To mark the banding pattern of Z364 in some 21XZS61 populations, lane 1 is P1 (dark purple phenotype), lane 2 is P2 (green phenotype), lane 3 is heterozygous F1 (light purple phenotype), lanes 4-28 are all 130bp bands, indicating that the phenotypes are all green, and lanes 29-32 are all 139bp bands, indicating that the phenotypes are all purple, which is consistent with the actual situation.

[0068] Table 1 Primer Z364 population validation results

[0069]

[0070]

[0071]

[0072] Note: In the table, A represents purple, H represents light purple, and B represents green.

[0073] Finally, it should be noted that the above specific implementation methods are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to examples, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solution of the present invention, which should be included in the scope of the claims of the present invention.

Claims

1. A set of InDel molecular markers for identifying or assisting in identifying the leaf color of non-heading Chinese cabbage, characterized in that: The InDel marker is an insertion / deletion sequence, which is amplified by specific primers with primer sequences such as SEQ ID NOs. 1 and 2; the product sequence of the Indel marker Z364 amplification is shown in SEQ ID NOs. 3-4.

2. A method for detecting molecular markers of purple leaves of non-heading Chinese cabbage, characterized in that: The following steps are involved: (1) using the specific primer pair in claim 1 to perform PCR amplification on the DNA sample template DNA to obtain a PCR amplification product; (2) Detecting the PCR amplification product by gel electrophoresis or purifying the PCR amplification product and then sequencing it; then identifying the leaf color trait of the non-heading cabbage by the PCR product: if the PCR product contains only a 139 bp DNA fragment, and its sequence is SEQ ID NO.3, then the non-heading cabbage to be identified has the purple leaf trait; If the PCR product contains only a 130 bp DNA fragment, whose sequence is SEQ ID NO. 4, the non-heading cabbage to be identified has a green leaf trait; If the PCR product contains two DNA fragments of 139 bp and 130 bp, the non-heading cabbage to be identified has the light purple leaf trait, which is a heterozygous trait.

3. The method according to claim 2, characterized in that The PCR amplification reaction procedure is: Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, for a total of 34 cycles; and finally extension at 72°C for 5 min. The PCR amplification reaction system was: 1 μL DNA, 0.5 μL each of 10 μmol upstream and downstream primers, Mix: 5 μL, and sterile distilled water was used to supplement the reaction system to 10 μL.

4. Use of the InDel molecular marker described in claim 1 or the method described in claim 2 or 3 in identifying purple cultivars of non-heading Chinese cabbage.

5. Use of the InDel molecular marker according to claim 1 or the method according to claim 2 or 3 in screening or identifying purple varieties of non-heading Chinese cabbage.

Images