Mythimna loreyi chemosensory protein CSP, its encoding gene and applications

Abstract

The present application discloses a chemosensory protein CSP of Mythimna loreyi, its encoding gene and applications, aiming to solve the technical problems of large amount of pesticides used and poor efficacy as well as serious drug resistance in the chemical control of Mythimna loreyi. The present application obtained a chemosensory protein of Mythimna loreyi, the amino acid sequence of which is shown in SEQ ID NO.1, and cloned the CSP gene encoding the chemosensory protein of Mythimna loreyi, the nucleotide sequence of which is shown in SEQ ID NO.2, and designed and synthesized a dsRNA fragment based on the nucleotide sequence of the CSP gene of Mythimna loreyi, the template DNA nucleotide sequence of which is shown in SEQ ID NO.3. The dsRNA of the CSP gene developed with the chemosensory protein of Mythimna loreyi as the target gene has an obvious effect on improving the sensitivity of Mythimna loreyi to chlorantraniliprole, and has no environmental toxicity and is safe to use. It can be used as a synergist in the emergency chemical control of Mythimna loreyi, and has important practical significance for reducing the amount of chemical pesticides and increasing their efficacy and ensuring food security.

Description

Technical Field

[0001] This invention application relates to the technical field of biological control, and specifically relates to a chemosensory protein of Mythimna loreyi, its encoding gene and applications. Background Art

[0002] Mythimna loreyi ( Mythimnaloreyi ) belongs to Lepidoptera, Noctuidae, and is an important agricultural pest widely distributed worldwide. It was included in the list of first-class agricultural pests and diseases twice in 2020 and 2023 respectively.

[0003] The larvae of Mythimna loreyi have a miscellaneous diet and can feed on a variety of plants, especially gramineous plants. The crops damaged mainly include wheat, barley, corn, rice, sugarcane and cotton, etc. After entering the 21st century, affected by various factors such as climate change, adjustment of planting structure and replacement of crop varieties, the occurrence range of Mythimna loreyi has been continuously expanding, and the degree of damage has become increasingly serious, posing a great threat to the safe production of food.

[0004] Currently, chemical control is still an effective means to control the damage of pests and diseases. However, in agricultural production, due to the long-term large-scale use of chemical insecticides, many pests such as cotton bollworms, armyworms and diamondback moths have developed relatively serious resistance. The resistance of pests often varies due to different pest and pesticide species, and the resistance mechanisms are different. In recent years, with the continuous in-depth research on the resistance mechanisms of pests, the research on the participation of chemosensory proteins in the resistance mechanisms of pests has gradually increased. Insect chemosensory proteins are a class of low-molecular-weight acidic soluble proteins formed during the long-term evolution process, and are widely distributed in various chemosensory organs such as insect antennae, midgut, wings, appendages and feet. At present, chemosensory proteins have been found to participate in the formation of resistance in pests such as diamondback moths, Rhopalosiphum padi and Bemisia tabaci, but there is currently a lack of research reports on the participation of chemosensory proteins of Mythimna loreyi in resistance.

[0005] In recent years, there have been more and more reports on using RNA interference (RNAi) technology to study gene functions, and it has gradually developed into a new technology for studying pest control. Using RNAi technology to silence genes involved in pest resistance and improve the sensitivity of pests to pesticides is one of the effective measures to achieve the reduction and efficiency increase of pesticides and delay the generation of pest resistance. Compared with traditional chemical pesticides, RNAi technology has the advantages of strong specificity, no environmental toxicity, short development cycle, flexible target change and lower dosage.

[0006] However, there are still few reports on applying RNAi technology to the control of Mythimna loreyi at present, and there is no report on the application of chemosensory proteins in its control.

[0007] The information disclosed in this background art section is only for enhancing the understanding of the background art of the present disclosure, and should not be regarded as an admission or any form of implication that this information constitutes the prior art known to those skilled in the art. Summary of the Invention

[0008] Research has shown that insect chemosensory proteins (CSPs) are proteins widely distributed in the lymph of various insect chemosensory organs, and have various biological functions such as sensing, recognizing, transporting, and conducting environmental chemical factor stimulation information, and participating in regulating the physiological rhythm and growth and development of insects. Recent research has found that insect chemosensory proteins play an important role in the insecticide resistance of pests and can serve as effective targets for developing insect biological control agents. In this application, the chemosensory protein (CSP) of Mythimna loreyi is used as a target gene to develop an RNAi product that can be used to control Mythimna loreyi, thereby providing a new direction and important basis for the biological control of Mythimna loreyi.

[0009] This application aims to provide a chemosensory protein derived from Mythimna loreyi and its encoding gene to achieve the reduction of pesticide use and improvement of efficiency and delay the increase of insecticide resistance in the chemical control of Mythimna loreyi.

[0010] To solve the above technical problems, this application adopts the following technical solutions:

[0011] Obtain a chemosensory protein (CSP) of Mythimna loreyi, whose gene encodes 107 amino acids, and its amino acid sequence is shown in SEQ ID NO.1.

[0012] Clone the gene encoding the chemosensory protein of Mythimna loreyi CSP The gene has a full-length cDNA sequence of 342 bp, and its nucleotide sequence is shown in SEQ ID NO.2.

[0013] Based on the nucleotide sequence of the Mythimna loreyi CSP gene, a dsRNA fragment was designed and synthesized, and its template DNA nucleotide sequence is shown in SEQ ID NO.3.

[0014] The CSP gene or the dsRNA fragment can improve the sensitivity of Mythimna loreyi to pesticides (such as chlorantraniliprole, etc.), and is effectively used in the control of Mythimna loreyi, or applied to the preparation of pesticides for controlling Mythimna loreyi.

[0015] Based on the CSP gene sequence, dsRNA or its fragment was designed and synthesized, which can improve the sensitivity of Mythimna loreyi to diamide pesticides (such as chlorantraniliprole, cyantraniliprole) when co-applied after Mythimna loreyi ingests the dsRNA fragment, thereby improving the control effect on Mythimna loreyi.

[0016] In this application, through gene silencing, CSP dsRNA was introduced into Mythimna loreyi, and the CSP effect of gene silencing on the sensitivity of Mythimna loreyi to chlorantraniliprole was determined. The experimental results showed that the sensitivity of Mythimna loreyi larvae fed with CSP gene dsRNA to chlorantraniliprole increased by 13.35% and 35.00% after 24 h and 48 h, respectively.

[0017] One or more technical solutions provided in the embodiments of this application have at least any one of the following technical effects or advantages:

[0018] The dsRNA of the gene developed with the chemosensory protein (CSP) of Mythimna loreyi in this application CSP has an obvious effect on improving the sensitivity of Mythimna loreyi to diamide pesticides (such as chlorantraniliprole, cyantraniliprole, etc.), has no environmental toxicity, is safe to use, and can be used as a synergist in the emergency chemical control of Mythimna loreyi, which has important practical significance for reducing the dosage and increasing the efficiency of chemical pesticides and ensuring food security. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 is the electrophoretic detection diagram of PCR amplification of the chemosensory protein CSP gene of Mythimna loreyi in an embodiment of this application; among them, 1, 2: PCR amplification of the CSP gene of Mythimna loreyi; 3: DL2000; 4: negative control.

[0020] Figure 2 is the homology analysis of the amino acid sequence of the chemosensory protein of Mythimna loreyi in an embodiment of this application; among them, the underlined part is the signal peptide sequence, and the rectangular marked part (ACPQCSD, ZGPCDK, FMQRNIKW) is the predicted domain of the chemosensory protein of Mythimna loreyi.

[0021] Figure 3 is the secondary structure of the predicted CSP of Mythimna loreyi in an embodiment of this application; among them, Figure 3 a is the online predicted secondary structure (https: / / www.novopro.cn / tools / secondary-structure-prediction.html); Figure 3 b is the secondary structure predicted by PSIPRED.

[0022] Figure 4 is the tertiary structure of the predicted CSP of Mythimna loreyi in an embodiment of this application.

[0023] Figure 5 is the phylogenetic analysis of the CSP of Mythimna loreyi in an embodiment of this application.

[0024] Figure 6 The expression of the chemosensory protein of Mythimna loreyi in an embodiment of the present application CSP after treatment with dsRNA of the gene.

[0025] Figure 7 The mortality rate of Mythimna loreyi larvae after treatment with chemosensory protein dsRNA + chlorantraniliprole in an embodiment of the present application. Detailed implementation manners

[0026] To better understand the technical solution of the present application, the above technical solution will be described in detail below in conjunction with the accompanying drawings of the specification and specific implementation manners.

[0027] The test materials and reagents used in the following embodiments, unless otherwise specified, are all purchased from conventional biochemical reagent companies; the instruments and equipment involved, unless otherwise specified, are all conventional laboratory instruments and equipment; for the quantitative tests in the following embodiments, unless otherwise specified, three repeated experiments are set, and the results are averaged.

[0028] Example 1, Mythimna loreyi CSP PCR amplification and cloning of the full-length cDNA of the gene

[0029] 1. Total RNA extraction: Three 2nd-instar larvae of Mythimna loreyi were placed in a 1.5 ml centrifuge tube, frozen in liquid nitrogen, and then ground into powder using a grinding rod. Then, total RNA was extracted with reference to the Total RNA Extractor (Trizol) instruction manual of Sangon Biotech (Shanghai) Co., Ltd. to obtain a total RNA sample with a concentration ≥ 400 ng / μL, a total amount ≥ 5 μg, and an OD260 / 280 of 1.8 - 2.1.

[0030] 2. PCR amplification and cloning of the Mythimna loreyi CSP gene

[0031] Based on the transcriptome data of Mythimna loreyi, CSP the full-length cDNA sequence of the gene SEQ ID NO. 2 was obtained, and primers for PCR amplification of the full-length cDNA sequence were designed using Primer5.0 software:

[0032] CSP-F: 5′- GAAAGTGGGCGTTACCAACATG-3′ (SEQ ID NO. 4);

[0033] CSP-R: 5′- CAGCCGTATTGGCGCACAATTT-3′ (SEQ ID NO. 5).

[0034] Using the extracted total RNA as a template, the first strand of cDNA was synthesized using a cDNA First Strand Synthesis Kit (cDNA Synthesis Kit, TAKARA). Using the synthesized cDNA as a template, PCR amplification was performed CSP for the full-length cDNA sequence of the gene. The reaction system (50 μL) consisted of 5 μL of cDNA, 5 μL of 10xPCR buffer, 4 μL of dNTPs, 0.5 μL of rTaq DNA polymerase, 2 μL of forward primer (10 pmol / ul), 2 μL of reverse primer (10 pmol / ul), and 31.5 μL of ultrapure water. The reaction conditions were: pre-denaturation at 95°C for 4 min, denaturation at 95°C for 30 s, annealing at 54°C for 30 s, extension at 72°C for 30 s (for a total of 35 cycles), and finally extension at 72°C for 10 min to terminate the reaction.

[0035] The PCR amplification products were electrophoretically detected using 1% agarose gel ( Figure 1 ), and the PCR amplification products were recovered using the UNIQ-10 Column DNA Gel Extraction Kit. The recovered products were ligated into the pMD18-T vector. The ligation system was (10 μL): 1 μL of T vector, 1 μL of T4 DNA ligase, 1 μL of 10xT4 ligase Buffer, and 7 μL of recovered product. After the prepared ligation system was placed at 16°C for overnight ligation, it was transformed into Escherichia coli TG1 competent cells by heat shock method. After colony PCR identification and sequencing analysis, a full-length cDNA sequence containing the Mythimna separata CSP gene (342 bp) was obtained (as shown in SEQ ID NO. 2).

[0036] Example 2: Amino acid sequence of Mythimna separata CSP and its homology alignment analysis

[0037] The amino acid sequence encoded by the Mythimna separata CSP gene was obtained by online prediction using NCBI ORF finder, as shown in SEQ ID NO.1, which consists of 107 amino acids.

[0038] The amino acid sequence encoded by the Mythimna separata CSP gene was subjected to homology alignment analysis using NCBI online BLAST and Clustalx software. The results were as Figure 2 , Mythimna separata CSP had the highest homology with Spodoptera exigua Spodoptera exigua from NCBI (AKT26485.1), reaching 98%. Its homology with Spodoptera frugiperda Spodoptera frugiperda from NCBI (UXY92029.1) was 96%, its homology with Helicoverpa armigera Helicoverpa armigera from NCBI (PZC83955.1) was 95%, and its homology with Athetis lepigoneAthetis dissimilis ((AND82447.1) and Mythimna separata Mythimna separata has a homology of 93% with (AWT22248.1).

[0039] Example 3. Physicochemical properties and structure prediction of CSP protein of Mythimna loreyi

[0040] 1. Physicochemical properties of CSP protein of Mythimna loreyi

[0041] The online analysis software ProtParam (https: / / web.expasy.org / protparam / ) was used to analyze the physicochemical properties of the CSP protein of Mythimna loreyi. The results showed that the molecular weight of CSP of Mythimna loreyi was 11976.12, and the theoretical isoelectric point was 9.49. Analysis by TMHMM (http: / / www.cbs.dtu.dk / services / TMHMM-2.0 / ) showed that CSP of Mythimna loreyi had no transmembrane sequence. Prediction of signal peptides using Signa IP (http: / / www.cbs.dtu.dk / services / SignaIP-4.1 / ) showed that the signal peptide of the CSP protein of Mythimna loreyi was located at amino acids 1-17 at the N-terminus ( Figure 2 ), and the cleavage site was between amino acids 17-18, indicating that this protein was a secreted protein.

[0042] 2. Domain and secondary structure prediction of CSP protein of Mythimna loreyi

[0043] The online analysis and prediction of the domain (motif) of the CSP protein of Mythimna loreyi was carried out using MEME (http: / / meme-suite.org / tools / meme). The results showed that three motifs were found in the CSP of Mythimna loreyi: ACPQCSD (position: 22-28 and 72-78), ZGPCDK (position: 33-38 and 51-56), and FMQRNIKW (position: 40-47 and 90-97) ( Figure 2 ).

[0044] The online analysis of protein secondary structure (https: / / www.novopro.cn / tools / secondary-structure-prediction.html) and PSIPRED (http: / / bioinf.cs.ucl.ac.uk / psipred / ) were used to predict the secondary structure of CSP of Mythimna loreyi. The results showed that the secondary structure of CSP of Mythimna loreyi contained 6 α-helices and 4 conserved cysteine sites ( Figure 2 、 Figure 3 ).

[0045] 3. Tertiary Structure Prediction of Mythimna loreyi CSP Protein

[0046] The tertiary structure of Mythimna loreyi CSP protein was predicted using Phyre2. The results showed that the tertiary structure of Mythimna loreyi CSP protein contains 6 α-helices ( Figure 4 ), and these structures form a hydrophobic pocket that can bind to endogenous and exogenous hydrophobic compounds.

[0047] Example 4. Phylogenetic Analysis of Mythimna loreyi CSP Protein

[0048] The maximum likelihood method of Mega 5.0 software was used to construct a phylogenetic tree for the CSP amino acid sequence of Mythimna loreyi (see Figure 5 ). The results showed that among the CSP amino acid sequences of 6 insects, Mythimna loreyi CSP clustered with those from Spodoptera frugiperda and Spodoptera exigua, and within this branch, Mythimna loreyi CSP further clustered separately, while those from Helicoverpa armigera, Actinotia polyodon, and Mythimna separata clustered into another branch.

[0049] Example 5. RNAi Analysis of Mythimna loreyi CSP Gene

[0050] 1. Primer Synthesis for RNAi: Based on the full-length cDNA sequence SEQ ID NO.2 of Mythimna loreyi CSP gene.

[0051] dsRNA primers were designed online using e-RNAi, and the T7 promoter sequence taatacgactcactataggg was added to the 5' end of the upstream and downstream primers respectively. At the same time, primers dsGFP-F and dsGFP-R for the green fluorescent protein gene GFP were synthesized.

[0052] dsRNA-F: taatacgactcactatagggTTAAGTGTGATGTGCGTGGG (SEQ ID NO:6);

[0053] dsRNA-R: taatacgactcactatagggGGGTAGTTTCGCTGGACAAA (SEQ ID NO:7);

[0054] dsGFP-F: taatacgactcactatagggAGAATGAGTAAAGGAGAAGAACTTTTC;

[0055] dsGFP-R: taatacgactcactatagggAGATTTGTATAGTTCATCCATGCCATGT.

[0056] 2. Synthesis of dsRNA: Using the cDNA obtained in Example 1 as a template, and dsRNA-F and dsRNA-R as primers, dsRNA was synthesized using the P1700 T7 RiboMAX TM Express RNAi In Vitro Transcription Kit. The specific steps were carried out according to the instructions and fine-tuned according to the actual situation. Reaction system (50 μL): RiboMAXTM Express T7 2 x Buffer 25 μl, double-stranded DNA template 1 μg, Enzyme Mix T7 Express 5 μL, supplemented with Nuclease-Free Water to 50 μL. The reaction steps were: water bath at 37 °C overnight, water bath at 70 °C for 10 min, allowed to cool to room temperature naturally, then added 1 μL of DNase and 1 μL of RNase diluted 200 times, then water bath at 37 °C for 30 min, added 0.1 volume of 3 mol / L NaAc and 1 volume of isopropanol, mixed well and placed on ice for 5 min. A white flocculent precipitate could be seen. Centrifuged at 4 °C, 12 000 r / min for 30 min, discarded the supernatant, added 500 μL of pre-cooled 75% ethanol, centrifuged at 4 °C / 12 000 r / min for 10 min, discarded the supernatant, dried for 5 min, and then added 50 - 100 μL of RNAse-free aqueous solution. The purified dsRNA was purified using the Transcription Clean-Up Kit, and the specific steps were carried out according to the kit instructions. The concentration of the purified dsRNA was detected using a NanoDrop one ultra-micro ultraviolet spectrophotometer.

[0057] 3. RNAi experiment

[0058] Feeding of larvae: Cut fresh corn leaves, then soak them in an aqueous solution containing 30 μg / ml CSP dsRNA. After 10 s, take them out and air-dry at room temperature for about 30 min. After the water has evaporated, feed 10 second-instar Mythimna loreyi larvae that have been starved for 12 h, and place them in an artificial climate chamber (temperature 25 + 1 °C, relative humidity 70 + 5%, light intensity 4000 lux, photoperiod L14:D10) for rearing. Observe the larval status every 24 h; and randomly select 2 larvae at 24 h and 48 h for CSP detection of gene expression levels, using larvae fed with an aqueous solution containing dsGFP ( dsGFP final concentration of 30 μg / ml) (negative control) and ddH 2 O (blank control) Mythimna loreyi larvae as controls, and 4 biological replicates were set for each treatment.

[0059] 4. Gene expression analysis

[0060] Refer to Step 1 in Example 1 to extract the total RNA of Mythimna loreyi for detection CSP of the gene expression level. In real-time PCR CSP The specific primers for gene quantitative analysis are SEQ ID NO.8 and SEQ ID NO.9, and the reference gene EF-1α primers are SEQ ID NO.10 and SEQ ID NO.11.

[0061] rCSP-F: TCCACGATGCAGCGACACATC (SEQ ID NO.8);

[0062] rCSP-R: CCCGCAGTGTTCGATGCAAGAA (SEQ ID NO.9);

[0063] EF-1α-F: TTGACGATAGAAGCGTCACCGG (SEQ ID NO.10);

[0064] EF-1α-R: GCAGAGATTTGACCAGGGTGG (SEQ ID NO.11).

[0065] The fluorescence quantitative PCR reaction system is: 10 μL SYBR Green Master Mix, 0.5 μmol / L forward / reverse primers, 0.5 μL cDNA, and supplemented with ddH 2 2O to 20 μL. The fluorescence quantitative PCR reaction program is: pre-denaturation at 94°C for 5 min, denaturation at 95°C for 15 s, annealing at 54°C for 20 s, extension at 72°C for 25 s, for 40 cycles. Each sample is replicated biologically 4 times, and ddH 2 2O without template is used as a negative control.

[0066] The relative expression level of the gene is calculated by the 2 -△△Ct method, with the lowest expression level set as 1, and the data is processed using Excel 2010. The results are as Figure 6 shown, and the results indicate that feeding dsCSP can significantly reduce the CSP gene expression level of Mythimna loreyi.

[0067] Example 6. Synergistic effect of ds CSP gene on chlorantraniliprole

[0068] The technical material of chlorantraniliprole is formulated into a liquid medicine with a concentration of 20 mg / L using acetone, CSP and the dsRNA aqueous solution concentration is 30 μg / ml. InCSP The chlorantraniliprole liquid medicine was added to the aqueous solution of dsRNA to make its final concentration 2 mg / L. Fresh corn leaves were taken and immersed in the solution containing chlorantraniliprole + CSP dsRNA for 10 s and then taken out. After standing indoors for 30 min, 20 second-instar Mythimna loreyi larvae with consistent development and starved for 12 h were fed, and they were placed in an artificial climate chamber (temperature 25 + 1 °C, relative humidity 70 + 5%, illumination 4000 lux, photoperiod L14:D10) for rearing. The larval state was observed every 24 h, the growth and development were recorded, and the larval mortality was counted. Using the Mythimna loreyi larvae fed with the chlorantraniliprole liquid medicine with a final concentration of 2 mg / L (positive control) and ddH 2 O (blank control) as the control, 4 biological replicates were set for each treatment. Excel 2010 was used for data analysis and graphing. The results are as Figure 7 . The results showed that compared with feeding chlorantraniliprole alone, feeding CSP dsRNA + chlorantraniliprole for 24 h and 48 h could increase the mortality of Mythimna loreyi by 13.35% and 35.00% respectively, indicating that CSP dsRNA had an obvious synergistic effect on chlorantraniliprole and could improve its lethality to Mythimna loreyi.

[0069] The above has described the present application in detail with reference to the accompanying drawings and embodiments; however, those skilled in the art can understand that without departing from the inventive concept of the present application, the changes, modifications, substitutions, combinations, and simplifications made should all be equivalent replacement methods, thus forming multiple specific embodiments, which are all within the common change range of the present invention and will not be elaborated here one by one.

Claims

1. Application of dsRNA targeting the Mythimna loreyi gene with the nucleotide sequence shown in SEQ ID NO.2 in at least one of the following (1) to (2): CSP ​ (1) Controlling Mythimna loreyi or preparing a product for controlling Mythimna loreyi; (2) Increasing the sensitivity of Mythimna loreyi to pesticides or preparing a product for increasing the sensitivity of Mythimna loreyi to pesticides; The pesticide is at least one of diamide pesticides; The template DNA nucleotide sequence of the dsRNA is SEQ ID NO.3 and is amplified by primers SEQ ID NO.6 and SEQ ID NO.

7.

2. A method for controlling Mythimna loreyi, characterized in that it comprises the following steps: (1) Design and synthesize the dsRNA specific to the Mythimna loreyi gene based on the gene sequence shown in SEQ ID NO.2 CSP The template DNA nucleotide sequence of the dsRNA is SEQ ID NO.3 and is amplified by primers SEQ ID NO.6 and SEQ ID NO.7; (2) Making Mythimna loreyi ingest the dsRNA to increase the sensitivity of Mythimna loreyi to the diamide pesticides applied in combination and thereby reduce its survival rate.

Images