A monoclonal antibody, a biochip comprising the same, and use thereof

Abstract

The application discloses a monoclonal antibody and a biochip containing the same and application. The monoclonal antibody contains a light chain variable region and a heavy chain variable region, the LCDR1 of the light chain variable region contains an amino acid sequence as shown in SEQ ID NO:1, the LCDR2 contains an amino acid sequence RMS, and the LCDR3 contains a sequence as shown in SEQ ID NO:2; the HCDR1-HCDR3 of the heavy chain variable region respectively contain sequences as shown in SEQ ID NO:3, 4 and 5; the monoclonal antibody is specific and sensitive; the biochip comprises a thin film transistor, a bio-sensitive film containing the monoclonal antibody and a micro-fluidic chip. The biochip containing the monoclonal antibody has the characteristics of small sample amount, low working voltage, high sensitivity, low cost, programmability and instantaneity, and has a wide application prospect in the fields of health monitoring, epidemic prevention, food safety and the like.

Description

Technical Field

[0001] This invention relates to an electronic device, specifically to a monoclonal antibody and a biochip containing the same, and its application in the detection of Staphylococcus aureus enterotoxin A (SEA). Background Technology

[0002] Enterotoxins produced by Staphylococcus aureus are one of the major pathogenic factors causing food safety and hygiene problems worldwide. They are highly toxic, occur at low doses, and are produced very easily. SEA, as a highly toxic and detectable enterotoxin from Staphylococcus aureus, seriously threatens food safety and human health. Traditional methods for detecting SEA have limitations such as low sensitivity and poor specificity; therefore, establishing a rapid, sensitive, and effective detection method is urgently needed. Currently, most kits for detecting SEA rely on polyclonal antibodies. However, because polyclonal antibodies produced using animal immunization procedures often contain antibodies against unrelated antigens and other irrelevant protein components, their specificity and sensitivity are far inferior to monoclonal antibodies. Monoclonal antibodies can specifically recognize and bind to their corresponding antigens and have been widely used for the rapid diagnosis of various diseases and pathogenic microorganisms.

[0003] Microfluidic chips, also known as lab-on-a-chip devices, are tiny chip devices that integrate microfluidic technology, enabling precise control and manipulation of microfluidics through micrometer-level channels and structures. Their advantages include saving sample and reagent usage, efficient and rapid experimental operations, automated execution, integration into multifunctional laboratory systems, portability, and applicability across multiple fields. Semiconductor biosensors consist of semiconductor sensors and biomolecular recognition elements. The most commonly used semiconductor device is the field-effect transistor (FET), hence these semiconductor biosensors are also called biosensitive field-effect transistors (BioFETs). BioFETs originate from two mature technologies: CMOS integrated circuits and ion-selective electrodes. A BioFET is a modern analytical instrument that uses bioactive substances (enzymes, antibodies, nucleic acids, etc.) as sensing units, exhibiting high selectivity for analytes. Its sensing unit performs molecular recognition of the target analyte, and the signal is converted through a field-effect transistor transducer to detect the analyte. Thin-film transistors, as a type of field-effect transistor, are considered ideal transducer elements due to their high electron mobility, stability and reliability, flexible manufacturing processes, and low power consumption.

[0004] Microfluidic chips themselves lack signal conversion and readout capabilities, and the detection of specific biomolecules still relies on traditional methods such as amplification and colorimetry. This poses a significant challenge to the development of rapid, low-cost, highly sensitive, and portable detection. Therefore, a novel solution is necessary. Monoclonal antibodies, acting as sensitive units of thin-film transistors, are integrated with microfluidic chips. When an antigen is captured by the antibody, the potential at the gate electrode surface changes, causing a change in channel current, converting the biological signal into an electrical signal. This enables highly sensitive and specific sample detection at the microscale. Summary of the Invention

[0005] Based on the aforementioned technical background and problems, this invention addresses the shortcomings of existing technologies by providing a monoclonal antibody, a biochip containing the antibody, and its applications. Specifically, it constructs a thin-film transistor biosensor based on a microfluidic chip. This invention combines the precise control and manipulation capabilities of microfluidic chips with the conversion and amplification capabilities of thin-film transistors for biological signals. Furthermore, the prepared monoclonal antibody ensures the specificity of the biological recognition process, constructing a novel label-free biological detection platform. It enables integrated processing, detection, and analysis of trace samples; this device structure is termed a biochip. This invention provides a biochip containing a monoclonal antibody against Staphylococcus aureus enterotoxin A. This invention provides a universal, integrated solution for biological detection.

[0006] To address the aforementioned problems, one of the technical solutions of this invention is: a monoclonal antibody against Staphylococcus aureus enterotoxin A, comprising a light chain variable region and a heavy chain variable region, wherein the light chain variable region LCDR1 contains the amino acid sequence shown in SEQ ID NO:1, LCDR2 contains the amino acid sequence RMS, and LCDR3 contains the sequence shown in SEQ ID NO:2; and the heavy chain variable region HCDR1 to HCDR3 respectively contain the sequences shown in SEQ ID NO:3, 4, and 5.

[0007] In some embodiments, the light chain variable region comprises a sequence as shown in SEQ ID NO:6, and the heavy chain variable region comprises a sequence as shown in SEQ ID NO:8.

[0008] In some embodiments, the monoclonal antibody comprises a heavy chain and a light chain, the light chain comprising a sequence as shown in SEQ ID NO:7, and the heavy chain comprising a sequence as shown in SEQ ID NO:9.

[0009] One technical solution of the present invention is a polynucleotide encoding a monoclonal antibody as described in the present invention. Preferably, it comprises a polynucleotide encoding a light chain as shown in SEQ ID NO:10 and / or a polynucleotide encoding a heavy chain as shown in SEQ ID NO:11.

[0010] One of the technical solutions of the present invention is: a recombinant expression vector comprising the polynucleotides described in the present invention.

[0011] One technical solution of the present invention is a transformant comprising a polynucleotide as described in the present invention or a recombinant expression vector as described in the present invention. Preferably, the host cell of the transformant is a prokaryotic cell and / or a eukaryotic cell. More preferably, the host cell is *Escherichia coli*.

[0012] One of the technical solutions of the present invention is: a chimeric antigen receptor comprising a monoclonal antibody as described in the present invention.

[0013] One technical solution of the present invention is: a genetically modified cell comprising a chimeric antigen receptor as described in the present invention, or a nucleic acid encoding a chimeric antigen receptor as described in the present invention. Preferably, the genetically modified cell is a chassis cell, specifically a T cell or an NK cell.

[0014] One of the technical solutions of this invention is: a biosensitive membrane, wherein the biosensitive membrane is loaded with the monoclonal antibody described in this invention. It can be used to specifically capture target molecules.

[0015] One of the technical solutions of the present invention is: a biochip, wherein the biochip includes a biosensitive membrane as described in the present invention.

[0016] Preferably, the biochip further includes one or more of the following: a substrate, a thin-film transistor, a reference electrode, and a microfluidic chip;

[0017] The transistor structure and reference electrode are disposed on the substrate;

[0018] The biosensitive membrane is placed on top of the thin-film transistor;

[0019] The microfluidic chip is placed on top of the thin-film transistor, the biosensitive membrane, and the reference electrode.

[0020] In some embodiments, the transistor comprises a channel, a gate insulating layer, a source electrode, a drain electrode, a second gate electrode, and a first gate electrode.

[0021] Preferably, the channel is made of oxide semiconductor, low-temperature polycrystalline silicon, or organic semiconductor material, and the first gate electrode is made of materials such as Au or ITO.

[0022] More preferably, the reference electrode is a solid Ag / AgCl or Pt, and / or the biosensitive membrane is fixed to the surface of the first gate electrode by a chemical method.

[0023] One of the technical solutions of the present invention is: a detection system for detecting Staphylococcus aureus enterotoxin A, wherein the detection system includes a monoclonal antibody as described in the present invention or a biochip as described in the present invention.

[0024] Preferably, the detection system further includes one or more of the following components:

[0025] (1) Sample processing module, (2) Control module, (3) Data acquisition and processing module, and (4) User interface;

[0026] The sample processing module obtains the required biological sample through sample pretreatment, centrifugation, filtration, and dilution, and inputs it into the biochip.

[0027] The control module controls the voltage applied to the sensor and controls the sample flow;

[0028] The data acquisition and processing module acquires and processes data obtained from the biochip.

[0029] More preferably, the detection system further includes a judgment and output module, which compares the data obtained by the data acquisition and processing module with the data obtained by the 1 μg / mL negative control group and outputs the judgment result. The judgment criterion is: if the responsivity of the test sample is greater than the sum of the average responsivity of the negative sample and three times the standard deviation, then it is judged as positive.

[0030] One of the technical solutions of the present invention is: the application of a detection system as described in the present invention in the detection of Staphylococcus aureus enterotoxin A.

[0031] One of the technical solutions of the present invention is: a method for preparing monoclonal antibodies as described in the present invention, which is obtained by transformation of the transformant as described in the present invention.

[0032] One of the technical solutions of the present invention is: a method for manufacturing a biochip as described in the present invention, comprising:

[0033] Design and fabrication of microfluidic chips containing monoclonal antibodies as described in this invention;

[0034] The microfluidic chip is bonded to a thin-film transistor;

[0035] The biosensitive membrane is immobilized on the surface of the first gate electrode.

[0036] One of the technical solutions of the present invention is: a method for detecting Staphylococcus aureus enterotoxin A, which uses a monoclonal antibody as described in the present invention, a biochip as described in the present invention, or a detection system as described in the present invention to detect the sample to be tested.

[0037] Preferably, the detection method includes: slowly injecting the sample to be tested into the microfluidic channel of the biochip, allowing it to fully contact and react with the biosensitive membrane;

[0038] A constant drain voltage is set between the source electrode and the drain electrode of the biochip, a constant gate voltage within a range is given to the second gate electrode, and a constant reference electrode voltage within a range is given to the reference electrode. The change in the channel current between the source electrode and the drain electrode is measured in real time, and the content of Staphylococcus aureus enterotoxin A in the sample to be tested is calculated.

[0039] More preferably, the drain voltage is between 0.5V and 1V; the gate voltage is between 0V and 5V; the reference electrode voltage is between -5V and 0V; and / or the sample to be tested is a raw solution, a diluted solution, or a purified solution obtained from milk; and / or the buffer solution used in the detection method is 0.01mM PBS, pH 7.4.

[0040] More preferably, the detection method is for non-disease diagnostic purposes.

[0041] One of the technical solutions of the present invention is the application of monoclonal antibodies, biochips, or detection systems as described in the present invention in biological sample analysis, chemical sample analysis, food analysis, and / or environmental analysis.

[0042] One of the technical solutions of the present invention is: an electronic device, including a memory, a processor, and a computer program stored in the memory and executable on the processor, wherein the processor executes the computer program to implement the method for detecting Staphylococcus aureus enterotoxin A of the present invention.

[0043] One of the technical solutions of the present invention is: a computer-readable storage medium storing a computer program thereon, characterized in that the computer program, when executed by a processor, implements the method for detecting Staphylococcus aureus enterotoxin A described in the present invention.

[0044] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0045] The reagents and raw materials used in this invention are all commercially available.

[0046] The positive and progressive effects of this invention are as follows:

[0047] Compared with existing technologies, the technical solution of this invention realizes a more realistic Lab-on-Chip, integrating sample processing, detection and analysis, enabling real-time analysis of multiple samples without the need for additional amplification and labeling.

[0048] The monoclonal antibody against Staphylococcus aureus enterotoxin A of the present invention exhibits high specificity and sensitivity (e.g., up to 1:40,960,000). The monoclonal antibody against Staphylococcus aureus enterotoxin A prepared by the present invention has high titer (e.g., up to 1:4096000) and high specificity; it is also suitable for the preparation of biochips, providing smaller sample volumes, shorter detection times, and parallel operation capabilities; the biochip can also be integrated with multiple modules, providing a portable sensing platform for real-time, high-sensitivity, and rapid on-site analysis.

[0049] The microfluidic chip of this invention provides a relatively closed detection environment, ensuring stability of detection in complex external environments. Furthermore, the biochip possesses integration and miniaturization capabilities; by designing different microfluidic channels and immobilizing different specific antibodies, it can achieve multi-indicator, high-throughput detection. Therefore, the entire invention has stronger universality and is expected to be compatible with other field-effect transistor sensing platforms. It is highly attractive for the fabrication of low-cost, portable, and integrated biochips, and has broad application prospects in health monitoring, healthcare, and epidemic prevention. Attached Figure Description

[0050] The accompanying drawings are used to provide an understanding of the technical solutions of the present invention and form part of the specification. They are used together with the embodiments of the present invention to explain the technical solutions of the present invention, and do not constitute a limitation on the technical solutions of the present invention.

[0051] Figure 1 The result of amplification of the sea gene in Staphylococcus aureus; M: Marker DL2000; 1-3: Three replicates of the amplified band.

[0052] Figure 2 The results of PCR amplification of recombinant plasmid PET-28a-SEA are shown; M: Marker DL2000; 1-10: single colonies picked; 11: negative control.

[0053] Figure 3SDS-PAGE results for PET-28a-SEA recombinant protein (recombinant SEA protein); M: Protein Marker; 1: 16℃ 0.5mmol / mL IPTG cell lysis supernatant; 2: 16℃ 0.5mmol / mL IPTG cell lysis precipitate; 3: 37℃ 0.5mmol / mL IPTG cell lysis supernatant; 4: 37℃ 0.5mmol / mL IPTG cell lysis precipitate; 5: 37℃ 0.5mmol / mL IPTG PET-28a empty vector supernatant; 6: 37℃ 0.5mmol / mL IPTG PET-28a empty vector precipitate.

[0054] Figure 4 Results of optimized expression conditions for PET-28a-SEA recombinant protein; Figure 4 Part A: Different induction conditions from 16℃ to 28℃; M: Protein Marker; 1-2: 0.5 mmol / mL IPTG overnight at 16℃, supernatant and precipitate; 3-4: 1 mmol / mL IPTG for 4 h at 16℃, supernatant and precipitate; 5-6: 1 mmol / mL IPTG overnight at 16℃, supernatant and precipitate; 7-8: 0.5 mmol / mL IPTG for 4 h at 28℃, supernatant and precipitate; Figure 4 Part B: Different induction conditions from 28℃ to 37℃. M: Protein Marker; 1-2: 28℃ 1mmol / mL IPTG 4h supernatant and precipitate; 3-4: 28℃ 1mmol / mL IPTG overnight supernatant and precipitate; 5-6: 37℃ 0.5mmol / mL IPTG 4h supernatant and precipitate; 7-8: 37℃ 1mmol / mL IPTG 4h supernatant and precipitate.

[0055] Figure 5 The results of purification of PET-28a-SEA recombinant protein; M: Protein Marker; 1: 10mM imidazole elution; 2: 30mM imidazole elution; 3: 50mM imidazole elution; 4: 100mM imidazole elution; 5: 200mM imidazole elution; 6: first 500mM imidazole elution; 7: second 500mM imidazole elution.

[0056] Figure 6 The results are obtained by ELISA detection of serum levels in mice immunized with Staphylococcus aureus enterotoxin A.

[0057] Figure 7 To determine the titer of monoclonal antibodies against Staphylococcus aureus enterotoxin A.

[0058] Figure 8 This study aims to determine the specificity of monoclonal antibodies against Staphylococcus aureus enterotoxin A.

[0059] Figure 9 This is a structural diagram of a Staphylococcus aureus enterotoxin A detection biochip according to one embodiment of the present invention.

[0060] Figure 10 This is a schematic planar diagram of a Staphylococcus aureus enterotoxin A detection biochip according to one embodiment of the present invention.

[0061] Figure 11 This is a schematic diagram of a biochip simulation circuit for detecting Staphylococcus aureus enterotoxin A in one embodiment of the present invention.

[0062] Figure 12 This is an electrical test diagram of a biochip for detecting Staphylococcus aureus enterotoxin A in one embodiment of the present invention.

[0063] Figure 13 This is an example of the application of a biochip for detecting Staphylococcus aureus enterotoxin A according to one embodiment of the present invention.

[0064] Figure 14 This is a schematic diagram of a detection system according to one embodiment of the present invention.

[0065] Figure 15 This is a schematic diagram of the structure of an electronic device according to one embodiment of the present invention.

[0066] Figure Labels

[0067] 101-Substrate; 102-Thin film transistor; 103-Reference electrode; 104-First gate electrode; 105-Biosensitive membrane; 106-Inlet; 107-Outlet; 108-Flat-headed needle; 109-Capillary; 110-Flow channel; 111-Polydimethylsiloxane (PDMS); 112-Source electrode; 113-Drain electrode; 114-Second gate electrode; 115-Channel. Detailed Implementation

[0068] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0069] Unless otherwise stated, the technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention pertains. When a quantity, concentration, or other value or parameter is expressed as a range, preferred range, or preferred upper and lower limits of a numerical value, it should be understood that this is equivalent to specifically disclosing any range by combining any pair of upper or preferred values ​​with any lower or preferred value, regardless of whether the range is specifically disclosed. Unless otherwise stated, the numerical ranges listed herein are intended to include the endpoints of the range and all integers and fractions (decimals) within that range.

[0070] When used with a numerical variable, the terms "about" or "approximately" usually mean that the value of the variable and all values ​​of the variable are within the experimental error (e.g., within a 95% confidence interval for the mean) or within ±10% of the specified value, or a wider range.

[0071] The expression "comprising," or similar expressions such as "including," "containing," and "having," is open-ended and does not exclude additional unlisted elements, steps, or components. The expression "consisting of," excludes any unspecified elements, steps, or components. The expression "substantially consisting of," limits the scope to the specified elements, steps, or components, plus optional elements, steps, or components that do not materially affect the essential and novel features of the claimed subject matter. It should be understood that the expression "comprising" encompasses both the expressions "substantially consisting of" and "consisting of."

[0072] The expression "at least one" or "one or more" indicates 1, 2, 3, 4, 5, 6, 7, 8, 9 or more kinds.

[0073] In one aspect, the present invention provides a biochip comprising:

[0074] Substrates, thin-film transistors, biosensitive membranes, reference electrodes, and microfluidic chips.

[0075] The transistor structure and reference electrode are disposed on the substrate;

[0076] The biosensitive membrane is placed on top of the thin-film transistor;

[0077] The microfluidic chip is placed on top of the thin-film transistor, the biosensitive membrane, and the reference electrode;

[0078] The biosensitive membrane is loaded with anti-SEA monoclonal antibody for the specific capture of target molecules;

[0079] The thin-film transistor, as a transducer of the biochip, amplifies the biological signals of the target molecules sensed by the biosensitive membrane into electrical signals.

[0080] The reference electrode is used to fix the potential of the electrolyte;

[0081] The microfluidic chip is used for precise control and manipulation of samples.

[0082] In an exemplary embodiment of the present invention, the thin-film transistor structure may include:

[0083] The source electrode and the drain electrode are disposed above the substrate;

[0084] The first gate electrode and the second gate electrode are disposed above the substrate;

[0085] A channel connecting the source electrode and the drain electrode;

[0086] A gate insulating layer is disposed between the gate electrode and the channel;

[0087] The biosensitive membrane is fixed to the surface of the first gate electrode by a chemical method;

[0088] In an exemplary embodiment of the present invention, the microfluidic chip includes a microfluidic channel;

[0089] The microfluidic channel is disposed above the thin-film transistor, and the solution flowing through the microfluidic channel is in direct contact with the biosensitive membrane and the reference electrode;

[0090] The microfluidic channel is provided with a sample solution inlet and a sample solution outlet;

[0091] The solution inlet and outlet are embedded with flat-headed needles; the flat-headed needles are connected to capillary tubes to guide the solution in and out.

[0092] In some implementations, the thin-film transistor can be another potential-sensitive transistor structure, and the semiconductor layer of the channel can be made of materials such as oxide semiconductor, low-temperature polycrystalline silicon, or organic semiconductor. In some implementations, the number, size, position, and arrangement of transistors can be adjusted according to actual detection requirements.

[0093] In some implementations, the source electrode, drain electrode, and gate electrode are made of the same or different materials; optionally, the first gate electrode is made of Au or ITO; optionally, the second gate electrode is made of Al / Mo, Ti, Mo, etc.; optionally, the source electrode and drain electrode are made of Mo / Al / Mo, Au, Ag, etc.; in some implementations, electrodes made of other metal or non-metal materials may also be used.

[0094] In some implementations, the reference electrode can be solid Ag / AgCl or Pt; in other implementations, electrodes made of other metals or non-metals can also be used.

[0095] In some implementation schemes, the microfluidic chip can be fabricated using PDMS; the inlet and outlet connections can be made of various pipes that support liquid transport, such as steel needles or polytetrafluoroethylene tubes; the structure of the microfluidic chip can be adjusted according to the detection requirements.

[0096] This invention describes several embodiments, but these descriptions are exemplary and not limiting, and it will be apparent to those skilled in the art that many more embodiments and implementations are possible within the scope of the embodiments described herein. Although many possible combinations of features are shown in the drawings and discussed in the detailed description, many other combinations of the disclosed features are also possible. Unless specifically limited, any feature of any embodiment may be used in combination with any other feature of any other embodiment, or may substitute for any other feature of any other embodiment.

[0097] In some embodiments, the substrate includes a glass substrate or a plastic substrate; optionally, the substrate is GL-10173-1.1 from Luoyang Guluo Glass Co., Ltd. In some embodiments, other non-metallic materials may also be used as the substrate.

[0098] The following examples involve: Staphylococcus aureus SH2-19 (clinical isolate), Salmonella typhimurium ATCC14028, Escherichia coli O157:H7 ATCC43889, Vibrio parahaemolyticus SH112, SEB protein, SEC protein, SED protein, SEE protein, and laboratory-prepared recombinant SEA protein. All strains were cultured in fresh TSB medium at 37°C.

[0099] BALB / c mice and Kunming mice were purchased from Shanghai Jiesijie Biotechnology Co., Ltd. SP2 / 0 myeloma cells were preserved in our laboratory.

[0100] SEB, SEC, SED, and SEE proteins were purchased from Wuhan Huamei Biotechnology Co., Ltd.; 2×TaqPCR Master Mix was purchased from Nanjing Novizan Biotechnology Co., Ltd.; 10×PCR Buffer, PrimeSTAR Max DNA Polymerase, dNTPs mixture, restriction endonucleases, T4 DNA ligase, and DNA gel extraction kit were purchased from Takara; plasmid extraction kit was purchased from Tiangen Biotech Co., Ltd.; kanamycin (Kan) was purchased from Invitrogen; fetal bovine serum (FBS) and DMEM medium were purchased from Invitrogen (Shanghai) Trading Co., Ltd.; BeaverBeads TMMag COOH beaver nanocarboxylated magnetic beads were purchased from Shanghai Qiushuang Biotechnology Co., Ltd.; the BCA protein concentration assay kit was purchased from Shanghai Beyotime Biotechnology Co., Ltd. Freund's adjuvant, polyethylene glycol (PEG 6000), hypoxanthine (H), aminopterin (A), thymidine deoxyribonucleoside (T), penicillin-streptomycin (PS), and L-glutamine (LG) were all products of Sigma-Aldrich (USA); skim milk powder, PET-28a carrier, E. coli DH5α, and E. coli BL21 (DE3) were all purchased from Sangon Biotech Co., Ltd.; serum-free cell cryopreservation solution was purchased from Suzhou Xinsaimei Biotechnology Co., Ltd.; and the antibody subtype identification kit was purchased from Southern Biotech Ltd. Trizol reagent was a product of Invitrogen; and the Prime Script DNA de-transcription kit was a product of Thermo Biotech Ltd.

[0101] HT stock solution (100×): Dissolve 38.8 mg thymidine deoxyribonucleoside and 136.1 mg hypoxanthine in 50 mL ddH2O and bring the volume to 100 mL. Place in a 45 °C water bath to dissolve completely. Filter using a 0.22 μm filter membrane and dispense. Store at -20 °C for later use.

[0102] Stock solution A (100×): Dissolve 1.76 mg of aminopterin in an appropriate amount of dd H2O, add 1 mL of 1 mol / L NaOH, and bring the volume to 100 mL with dd H2O. Filter and dispense using a 0.22 μm filter membrane, and store at -20℃ for later use.

[0103] 20% FBS medium: 1 mL penicillin-streptomycin (PS), 1 mL L-glutamine (LG), 20 mL fetal bovine serum (FBS) and 78 mL DMEM, stored at 4°C for later use.

[0104] HT medium: 1 mL LG, 1 mL PS, 1 mL HT, 20 mL FBS and 77 mL DMEM, store at 4°C for later use.

[0105] HAT medium: 1 mL A, 1 mL HT, 1 mL LG, 1 mL PS, 20 mL FBS and 76 mL DMEM, store at 4°C for later use.

[0106] ELISA coating solution (pH 9.6): Add 0.848g Na2CO3 and 1.428g NaHCO3 to ddH2O and bring the volume to 0.5L. Store at 4℃.

[0107] ELISA substrate and colorimetric solution: Solution A is prepared by adding 6 mL of glacial acetic acid, 2.45 g of sodium acetate, and 0.3 mL of 30% hydrogen peroxide to ddH2O and bringing the volume to 500 mL; Solution B is prepared by adding 0.2 g of disodium ethylenediaminetetraacetate, 0.95 g of citric acid, 0.15 g of TMB, and 50 mL of glycerol to ddH2O and bringing the volume to 500 mL; When using, mix Solution A and Solution B in a 1:1 ratio (prepare fresh each time).

[0108] ELISA blocking solution (5% skim milk): Dissolve 5g of skim milk in PBST and bring the volume to 100mL.

[0109] ELISA stop solution (2M H2SO4): Slowly add 11mL of 98% concentrated sulfuric acid to 89mL of ddH2O while stirring, and store at 4℃.

[0110] ELISA washing buffer (1×PBST, pH 7.4): Add 8.0g NaCl, 2.9g Na2HPO4·12H2O, 0.2g KH2PO4, and 0.2g KCl to ddH2O and bring the volume to 1000mL. After dissolving, add 0.5mL Tween-20.

[0111] LB liquid medium: Weigh 10g sodium chloride, 5g yeast extract, and 10g tryptone and bring the volume to 1000mL of deionized water. Adjust the pH to 7.4, autoclave at 121℃ for 15min, and store at 4℃ for later use.

[0112] LB kanamycin (LB(Kan+)) liquid medium: Add Kan solution to LB liquid medium to a final concentration of 50 μg / mL.

[0113] LB kanamycin (LB(Kan+)) solid medium: Weigh 15g of agar powder and dissolve it in 1000mL of LB liquid medium. Autoclave at 121℃ for 20min. When cooled to 50℃, add Kan to a final concentration of 50μg / mL. Pour plates under sterile conditions.

[0114] The emulsifier was purchased from Amalgamator, the benchtop low-temperature centrifuge from Thermo Fisher Scientific, the CO2 cell incubator from Thermo Scientific, USA, the multi-functional microplate reader from Biotek, USA, and the gel imaging system from Bio-Rad China.

[0115] This invention includes and contemplates combinations with features known to those skilled in the art. The disclosed embodiments and features of this invention can also be combined with any conventional features to form a unique inventive scheme as defined by the claims. Any feature of any embodiment can also be combined with features from other inventive schemes to form another unique inventive scheme as defined by the claims. Therefore, it should be understood that any feature shown and / or discussed in this invention can be implemented individually or in any suitable combination. Therefore, the embodiments are not limited except by the limitations imposed by the appended claims and their equivalents. Furthermore, various modifications and changes can be made within the scope of the appended claims.

[0116] Furthermore, in describing representative embodiments, the specification may have presented methods and / or processes as a specific sequence of steps. However, the method or process should not be limited to the specific order of steps described herein, to the extent that it does not depend on such a specific order. As will be understood by those skilled in the art, other sequences of steps are also possible. Therefore, the specific order of steps set forth in the specification should not be construed as a limitation of the claims.

[0117] Furthermore, the claims for the method and / or process should not be limited to performing the steps in the order written, as those skilled in the art will readily understand that these orders may vary and remain within the spirit and scope of the embodiments of the invention.

[0118] like Figure 9 As shown, in one embodiment of the present invention, the biochip for SEA detection includes:

[0119] Substrate (101), thin film transistor (102), reference electrode (103), first gate electrode (104), biosensitive membrane (105), inlet (106), outlet (107), flat-head needle (108), capillary (109), flow channel (110), PDMS (111).

[0120] In some implementation schemes, refer to Figure 10 The second gate electrode (114), channel (115), source (112), drain (113), reference electrode (103), and first gate electrode (104) constitute the basic structure of the thin film transistor; the biosensitive membrane (105) is fixed on the first gate electrode (104); the PDMS (111), inlet (106), outlet (107), flat-head needle (108), capillary (109), and flow channel (110) constitute the microfluidic system.

[0121] In some implementation schemes, refer to Figure 9 and Figure 10The diameter of the microfluidic channel (110) is set to 0.2 mm and the height is set to 0.8 mm; the diameter of the inlet (106) and outlet (107) is 0.5 mm; flat-headed pins (108) are inserted at the inlet (106) and outlet (107), respectively, the material is stainless steel, the inner diameter is 0.4 mm and the outer diameter is 0.6 mm; a capillary tube (109) is connected to the other end of the flat-headed pin (108), the material is polytetrafluoroethylene, the inner diameter is 0.6 mm and the outer diameter is 1 mm.

[0122] In some implementation schemes, refer to Figure 9 and Figure 10 First, the microfluidic chip and the thin-film transistor are bonded. The transistor device is ultrasonically cleaned in isopropanol and deionized water, and then dried with nitrogen. PDMS is cast onto a mold and then cured in a 65°C oven. After the bonding surfaces of the thin-film transistor (102) and the PDMS (111) are treated simultaneously in a plasma cleaner, the bonding surfaces are immediately pressed together, and the reference electrode (103), the first gate electrode (104), and the flow channel (110) are aligned to ensure that the sample solution entering the flow channel is in full contact with the electrodes.

[0123] In some implementation schemes, refer to Figure 9 Biosensitive membranes were prepared. Immediately after bonding, (3-aminopropyl)triethoxysilane (APTES) reagent (diluted to 10% (v / v) with deionized water, pH adjusted to 7.0) was injected into the flow channel. The membrane was reacted at 50°C for 2 hours, then thoroughly rinsed with deionized water and dried under nitrogen. Before antibody fixation, the electrode surface was treated with glutaraldehyde solution (5% (v / v)) and immersed at 37°C for 2 hours. The chip was then rinsed and dried, and immediately fixed with antibody (1.5 mg / mL anti-SEA monoclonal antibody) at 37°C for 2 hours. To reduce non-specific binding in the antigen-antibody affinity reaction, blocking was required after fixation. Blocking agents with one or more carboxyl groups at the end were generally selected; alternatively, bovine serum albumin (BSA) at a concentration of 2% was used, treated at 37°C for 0.5 hours.

[0124] In some implementation schemes, the preparation method of monoclonal antibodies is as follows:

[0125] Example 1: Prokaryotic expression of Staphylococcus aureus enterotoxin A gene and preparation of SEA immunogen

[0126] 1.1 PCR amplification of the SEA gene fragment

[0127] Based on the sea gene sequence of Staphylococcus aureus ATCC 25923 (GenBank accession number: EF520720.1) indexed in GenBank, and using SignalP 4.1Server online server to predict the signal peptide sequence, primers were designed. Nde I and Xho I restriction endonuclease sites were added to the upstream and downstream primers to amplify the gene sequence lacking the SEA signal peptide, as shown in Table 1. Primers were synthesized by Shanghai Qingke Biotechnology Co., Ltd.

[0128] Table 1 Primers required for amplifying the SEA fragment

[0129] Primer name Sequence (5'-3') SEQ ID NO: SEA-F <![CDATA[GAATTC CATATG AGCGAGAAAAGCGAAG]]> 12 SEA-R <![CDATA[CCG CTCGAG TTAACTTGTATATAAATATATATCAATATGC]]> 13

[0130] PCR amplification system: 1 μL each of forward and reverse primers, 1 μL DNA template, 5 μL 10×PCR Buffer, 5 μL dNTPs mixture (2.5 mmol / L), 0.5 μL PrimeSTAR, and 36.5 μL ddH2O. PCR cycling parameters were as follows: 94℃ pre-denaturation for 4 min, 94℃ denaturation for 40 s, 52℃ annealing for 30 s, 72℃ extension for 60 s, for a total of 30 cycles, with a final extension at 72℃ for 10 min. PCR products were detected by 1.0% agarose gel electrophoresis, and the results are as follows. Figure 1 .

[0131] 1.2 Double digestion of the target gene and plasmid

[0132] The PCR products of SEA were subjected to 1.0% agarose gel electrophoresis, and the target fragment was purified and recovered using a DNA gel extraction kit. The concentrations of the recovered target gene fragment and PET-28a plasmid were determined. The SEA fragment and PET-28a plasmid were double-digested with Nde I and Xho I, and incubated at 37°C for 4-5 hours. The digested products were then recovered and purified using a DNA gel extraction kit, following the manufacturer's instructions.

[0133] 1.3 Ligation and Transformation of Enzyme Digestion Products

[0134] The SEA gene fragment, after enzyme digestion, was ligated with the PET-28a plasmid fragment using T4 DNA ligase overnight at 16°C. The ligation product was then transformed into E. coli DH5α, as follows:

[0135] (1) Place competent cells in an ice bath, add DNA ligation products, gently mix, and let stand in the ice bath for 30 minutes.

[0136] (2) Place the centrifuge tube in a 42°C water bath for 60-90 seconds, then quickly transfer it to an ice bath to cool the cells for 2-3 minutes. Do not shake the centrifuge tube during this process.

[0137] (3) Add 900 μL of sterile LB medium to the tube, mix well, and then place it in a shaker at 37°C for 45 min.

[0138] (4) Centrifuge, discard 900 μL of supernatant, mix the precipitate, add 100 μL of transformed competent cells to LB (Kan+) solid medium, spread evenly, and after the liquid on the plate is completely absorbed, incubate upside down at 37°C for 12-16 h.

[0139] 1.4 PCR Identification and Transformation of Recombinant Plasmids

[0140] Several single colonies grown on plates were inoculated into LB (Kan+) liquid medium and cultured on a shaker at 37°C until turbid. Plasmids were extracted using a plasmid extraction kit. PCR identification was performed using the recombinant plasmid as a template, with primers and cycling parameters the same as for the SEA gene fragment PCR amplification. PCR amplification system: 1 μL each of forward and reverse primers, 1 μL DNA template, 12.5 μL 2×Taq PCRMaster Mix, and 9.5 μL ddH2O. PCR products were subjected to 1% agarose gel electrophoresis at 120V for 30 min, and the results were detected using a gel imaging analyzer. The successfully identified recombinant plasmid was transformed into competent E. coli BL21(DE3) cells, named PET-28a-SEA, and identified using the same method. The results showed that 3 out of 10 recombinant bacterial single colonies were successfully transformed into the PET-28a-SEA plasmid. Figure 2 ).

[0141] The recombinant bacteria were induced to express a single colony of the positive recombinant PET-28a-SEA strain. A small amount was inoculated into LB (Kan+) liquid medium and cultured in a shaker at 37°C until the bacterial culture reached the logarithmic growth phase (OD200). 600 When the concentration of the bacterial culture reaches 0.5-0.8 mmol / mL, add IPTG to a final concentration of 0.5 mmol / mL, incubate overnight at 16°C with shaking at 140 rpm. Centrifuge 1 mL of the induced bacterial culture at 12000 rpm for 2-3 min, discard the supernatant, and resuspend in 1 mL of PBS. Then sonicate the bacterial culture at 5% power with 5-second intervals for a total of 8-10 min. After centrifugation and sonication, retain the supernatant and precipitate for SDS-PAGE electrophoresis.

[0142] After recombinant bacteria were induced to express protein by IPTG, the results were analyzed by SDS-PAGE. Figure 3As shown in the figure. SDS-PAGE electrophoresis results showed a distinct protein band at approximately 30 kDa, consistent with the expected band size, indicating that the protein was clearly expressed in the supernatant, demonstrating that the recombinant SEA protein was successfully expressed in a soluble protein form.

[0143] 1.5 Optimization of Induced Expression Conditions

[0144] The induction conditions were optimized by increasing the induction time, induction temperature and inducing agent concentration. The different induction conditions are shown in Table 2.

[0145] The result after optimizing the induction conditions is as follows Figure 4 As shown in the figure. The optimization results demonstrate that the target protein is induced best under the condition of overnight induction with 1 mmol / mL IPTG at 28℃, and this condition is determined to be the condition for large-scale induction.

[0146] Table 2 Optimized Induction Conditions

[0147]

[0148] 1.5 Purification of the expression product

[0149] Using BeaverBeads TM Mag COOH beaver carboxyl nanoparticles were used to purify recombinant SEA protein. The purification steps are as follows:

[0150] (1) Take 5 mL of magnetic beads into a centrifuge tube, place it on a magnetic rack, and discard the remaining liquid after the magnetic beads have accumulated. Take the induced and sonicated bacterial solution and gently resuspend the magnetic beads.

[0151] (2) Place the bacterial liquid and magnetic bead mixture on a rotary culture instrument and rotate for 30 minutes. Then place it on a magnetic rack to enrich the magnetic beads and discard the remaining liquid.

[0152] (3) Add bacterial solution again and repeat the above steps until all the solution is added. When resuspending the magnetic beads, be gentle to avoid the protein adsorbed on the magnetic beads falling off.

[0153] (4) Elute the protein enriched on the magnetic beads one by one using imidazole elution buffers at pH 7.4 at concentrations of 10 mM, 30 mM, 50 mM, 100 mM, 200 mM, and 500 mM. Add the elution buffer and shake upside down for 1-2 minutes. Then place the tube on a magnetic rack and collect the liquid after the magnetic beads have accumulated. This is the purified target protein, i.e., recombinant SEA protein.

[0154] (5) The purified protein was analyzed by SDS-PAGE electrophoresis. Proteins with good purification were dialyzed and ultrafiltered, and their concentration was determined using a BCA protein concentration assay kit. The purification results are as follows: Figure 5 As shown.

[0155] 1.6 Preparation of Staphylococcus aureus enterotoxin A immunogen

[0156] The prepared recombinant SEA protein was taken, and its concentration was measured. The protein concentration was then diluted to 50 μg / 100 μL with PBS. For the first immunization, Freund's complete adjuvant was used. The protein and Freund's complete adjuvant were mixed 1:1 and emulsified in an emulsifier for 90 seconds. Each mouse was then immunized with 200 μL of immunogen at a dose of 50 μg / mouse. Subsequent immunizations were performed using Freund's incomplete adjuvant.

[0157] Example 2 Animal Immunization Program

[0158] The initial immunization site was the footpad. Subsequent immunizations were administered every two weeks, with the sites being subcutaneous, subcutaneous, and intramuscular, respectively. The immunization dose was 50 μg per mouse, with each mouse receiving 200 μL of immunogen. A total of three mice were immunized for future use. The immunization schedule for the mice is shown in Table 3.

[0159] Table 3. Immunization schedule for mice

[0160] Number of immunizations Immune sites immune components Immunization dose 1 foot pads 100 μl immunogen (50 μg) + 100 μl Freund's complete adjuvant 200μL 2 subcutaneous 100 μl immunogen (50 μg) + 100 μl Freund's incomplete adjuvant 200μL 3 subcutaneous 100 μl immunogen (50 μg) + 100 μl Freund's incomplete adjuvant 200μL 4 subcutaneous 100 μl immunogen (50 μg) + 100 μl Freund's incomplete adjuvant 200μL 5 abdominal cavity 50 μl immunogen (25 μg) 50μL

[0161] Example 3: Determination of Serum Potency in Animals

[0162] Balb / C mice were immunized, and serum was collected after the third immunization at a ratio of 1:2 × 10⁻⁶. 3 1:4×10 3 1:8×10 3 1:16×10 3 1:32×10 3 1:64×10 3 1:128×10 3 After serial dilution, serum titers were determined using an indirect ELISA method, with serum from healthy mice serving as a negative control. Optimal immunized mice were selected for cell fusion (Example 4).

[0163] Indirect ELISA experimental procedure:

[0164] (1) Dilute the SEA protein stock solution to 2 μg / mL with ELISA coating buffer (0.05 M carbonate buffer, pH 9.6), vortex to mix, and then coat each well of the ELISA plate with 100 μL of the solution. Use the uncoated stock solution as a blank control. Incubate at 37°C for 4 h or at 4°C overnight.

[0165] (2) After coating, discard the coating solution, wash the microplate three times with ELSIA washing buffer (1×PBST, pH 7.4), add PBST containing 5% skim milk (200 μL / well) to each well, and incubate at 37°C for 2 hours.

[0166] (3) After sealing, wash the ELISA plate three times with ELSIA washing buffer to obtain the anti-SEA antibody ELISA detection plate, and store it at 4℃ for later use.

[0167] (4) Serially dilute the serum to be tested with 5% FBS PBST (1×PBST, pH 7.4), add the serially diluted serum to the anti-SEA antibody ELISA detection plate (100 μL per well), and incubate at 37°C for 2 h.

[0168] (5) Wash the anti-SEA antibody ELISA detection plate three times with ELISA washing buffer, add 100 μL of HRP-labeled goat anti-mouse IgG antibody diluted (1:2000) to each well, and incubate at 37°C for 1 h.

[0169] (6) After incubation, wash three times with ELSIA washing buffer, add 100 μL of ELSIA substrate chromogenic solution to each well, incubate at 37°C for 15 min, add 50 μL of ELSIA stop solution (2M H2SO4), and finally read the absorbance value at OD450 using a microplate reader.

[0170] Blood was collected from the tails of mice 7-10 days after three immunizations, and serum titers were determined by indirect ELISA. The results showed that the serum titers of the mice were all above 128 × 10⁻⁶. 3 above( Figure 6 All samples showed high titers and were suitable for cell fusion. Mice 1 showed the highest titer. The immunogen was reduced by half and administered via intraperitoneal pulse immunization. Sample 1 mice were selected for booster immunization.

[0171] Example 4: Preparation of monoclonal antibody against Staphylococcus aureus enterotoxin A

[0172] 4.1 Culture of mouse myeloma cells (SP2 / 0)

[0173] Remove SP2 / 0 cells from the liquid nitrogen container and quickly place them in a 37°C water bath until completely thawed. Add 7 mL of pre-prepared blank DMEM culture medium to a 15 mL centrifuge tube, centrifuge at 1000 rpm for 8 min, discard the supernatant, resuspend the SP / 20 cells in an appropriate amount of DMEM complete culture medium, transfer to cell culture flasks, and incubate at 37°C in a 5% CO2 cell culture incubator. Observe the cell growth status daily and change the culture medium as needed. When the cells reach 90% confluence with the bottom of the culture flask, perform cell division.

[0174] 4.2 Preparation of feeder cells

[0175] Six- to eight-week-old Kunming mice were euthanized by exsanguination through the eyes and then immersed in 75% alcohol for 5 minutes. After disinfection, the mice were fixed in a clean bench with their abdomens facing upwards. Using autoclaved scissors and forceps, the abdominal skin was cut along the linea alba to expose the peritoneum, following standard procedures. 4 mL of DMEM culture medium was injected into the peritoneal cavity of the mice using a 5 mL syringe. The peritoneal cavity was then gently tapped with forceps approximately 50 times. The culture medium was then drawn from the peritoneal cavity using the same syringe and added to a 15 mL centrifuge tube. This process was repeated 2-3 times. The collected peritoneal flushing fluid was transferred to a sterile centrifuge tube and centrifuged at 1000 rpm for 10 minutes. The supernatant was discarded, and the feeder cells were resuspended in 50 mL of HAT medium. The feeder cells were then added to 96-well cell culture plates and placed in a 5% CO2 cell culture incubator for later use.

[0176] 4.3 Cell Fusion

[0177] (1) Preparation of SP2 / 0 cells: Collect SP2 / 0 cells in good growth condition into centrifuge tubes, centrifuge at 1000 rpm for 8 min, discard the supernatant, resuspend the cells and transfer them to fusion tubes.

[0178] (2) Isolation of spleen cells: The mice used for fusion were euthanized, and then the abdominal skin and peritoneum of the mice were cut open in sequence according to the operation method in this embodiment to fully expose the organs. On the left side of the mouse viscera, the fat and other connective tissues adhering to the spleen were separated, and the spleen was removed and placed into a 12-well cell culture plate. The surface was washed with blank DMEM medium and then transferred to another well. The spleen was repeatedly rinsed with blank DMEM medium with a syringe until the spleen cells were transparent. The eluent containing spleen cells was centrifuged at 1000 rpm for 8 min and the supernatant was discarded. Then the supernatant was discarded and the cells were resuspended for use.

[0179] (3) Fusion of SP2 / 0 and spleen cells: After mixing, transfer to a fusion tube already containing SP2 / 0 cells, centrifuge at 1000 rpm for 8 min and discard the supernatant completely. Place the fusion tube in the palm of your left hand and shake vigorously to thoroughly mix the two cell types. Incubate at 37℃ for 10 min. Add 1 mL of preheated PEG evenly over 45 s, and after 90 s, add DMEM medium to terminate the PEG reaction. Then, incubate the fusion tube at 37℃ for 10 min, centrifuge at 1000 rpm for 8 min, discard the supernatant, resuspend in an appropriate amount of 20% FBS HAT medium, dilute to different concentrations, and add to 96-well plates containing feeder cells (100 μL / well). Incubate at 37℃ in a 5% CO2 incubator.

[0180] 4.4 Screening of positive cells

[0181] Observe the growth status daily. Screening for positive cells depends on the hybridoma cell growth status. Observe cell growth 8-10 days after fusion, and screen and label wells with only single-clone cell clusters growing. Extract 100 μL of supernatant from each single-clone well and supplement with HAT medium. Perform indirect ELISA. Dilute the PET-28a-SEA protein stock solution to 2 μg / mL with ELISA coating buffer, vortex to mix, and then coat each well with 100 μL of the solution. Use negative mouse serum as a negative control and blank coating buffer as a blank control. Mix 20 μL of cell supernatant with 80 μL of PBST (containing 5% FBS) as the primary antibody. Follow the same ELISA procedure as for mouse serum titer determination to identify positive wells.

[0182] 4.5 Subclones of positive hybridoma cells

[0183] Select monoclonal cell lines with high cell titers and good growth status for subcloning. First, mark the locations of positive clones under a microscope. Use a 200 μL pipette to transfer a small amount of cells to a 96-well cell plate and serially dilute with 20% FBS incomplete medium. Observe under an inverted microscope, select wells containing 90-120 cells per well, transfer the liquid from each well to 10 mL of 20% FBS incomplete medium, and mix thoroughly by pipetting. Then add the mixture to 96-well cell plates containing feeder cells (100 μL / well) and incubate at 37°C in a 5% CO2 incubator. Observe cell growth status regularly and replenish medium as needed within 3-5 days. When the cells grow to the size of a fingernail, perform screening and subcloning again until the positive rate of cell supernatant in the monoclonal wells reaches 100%. Expand the culture and freeze the cells, labeling them carefully.

[0184] 4.6 Preparation of mouse ascites

[0185] Female Balb / C mice were intraperitoneally injected with 0.5 mL of sterile paraffin oil every 7 days for a total of 3 times. Following this, 0.5 mL of subcloned positive cells (concentration 2 × 10⁻⁶) were injected intraperitoneally into the mice. 6 The mice were injected with an equal volume of sterile paraffin oil ( / L). For 7-15 days post-injection, the physiological and mental state of the mice was observed multiple times daily. For mice exhibiting lethargy, abdominal distension, and palpable fluctuation, ascites fluid was collected using a sterile syringe needle when the mice were near death. After allowing the ascites fluid to stand for 1-2 hours, it was centrifuged at 4℃ and 5000rpm for 30 minutes. Upon centrifugation, the ascites fluid separated into three layers; the middle layer was the clear, yellow ascites fluid. The ascites fluid was collected using a pipette in a laminar flow hood, aliquoted into clean EP tubes, and stored at -80℃.

[0186] Example 5 Monoclonal Antibody Analysis

[0187] 5.1 Potency and Specificity Determination

[0188] The titer of anti-SEA specific monoclonal antibodies was determined using ELISA. Recombinant SEA protein stock solution was diluted to 2 μg / mL with ELISA coating buffer, and 100 μL was used to coat each well of the ELISA plate. The antibody detection procedure was the same as in Example 3. The collected ascites fluid monoclonal antibodies were serially diluted at 1:16,000, 1:32,000, 1:64,000, 1:128,000, 1:256,000, 1:512,000, 1:1,024,000, 1:2,048,000, and 1:4,096,000. 100 μL of each concentration was added to each well as the primary antibody. The remaining ELISA procedures were the same as for mouse serum titer determination. Positive and negative controls were also included. The OD450 value was measured using a microplate reader, and a P / N ratio ≥ 2.1 was used to determine a positive value. The highest dilution showing a positive result was considered the antibody titer. Inactivated Salmonella Typhimurium ATCC14028, Escherichia coli O157:H7 ATCC43889, Vibrio parahaemolyticus SH112, and five proteins (recombinant SEA protein, SEB protein, SEC protein, SED protein, and SEE protein) were coated onto a 96-well ELISA plate using coating buffer. The antibody detection procedure was the same as in Example 3 for determining the specificity of the monoclonal antibody.

[0189] After four rounds of subcloning, six monoclonal antibodies were selected and named 9C7, 3E2, 3D10, 7B2, 7A5, and 11A2. Ascites titers were determined by indirect ELISA using PET-28a-SEA protein as the coating antigen, following the same method as above. The results ( Figure 7 It can be seen that the titers of all six monoclonal antibodies are high; even after a 4,096,000-fold dilution, the OD450 remains above 0.5. Using PET-28a-SEA protein as the positive coating antigen, SEB protein, SEC protein, SED protein, SEE protein (purchased from Wuhan Huamei Biotechnology Co., Ltd.), and other foodborne pathogens preserved in the laboratory were selected as test coating antigens. The specificity of the antibodies was determined, and the results were... Figure 8 The results showed that none of the six antibodies reacted with the aforementioned coating antigens, indicating that all six antibodies had good specificity.

[0190] 5.2 Identification of Monoclonal Antibody Subtypes

[0191] The results of antibody subtype identification using an antibody subtype identification kit showed that the light chain type of all six antibodies was kappa, and the heavy chain types were IgG2b and IgG1.

[0192] Table 4. Isotype determination of monoclonal antibodies

[0193] 9C7 3E2 3D10 7B2 7A5 11A2 Light chain Kappa Kappa Kappa Kappa Kappa Kappa Heavy chain IgG2b IgG2b IgG1 IgG1 IgG1 IgG1

[0194] Example 6: Sequence determination and analysis of anti-Staphylococcal enterotoxin A monoclonal antibody

[0195] Monoclonal antibody 3E2 has the best titer and specificity. To identify the 3E2 antibody sequence, total RNA was isolated from hybridoma cells secreting monoclonal antibody 3E2 using Trizol reagent. Specific steps: 1) Trizol lysis: Resuspend all bacteria in 1 mL Trizol, mix by pipetting and let stand for 3-5 min. (2) Chloroform phase separation: Add 0.2 mL of chloroform (trichloromethane) to each sample, shake vigorously for 15 s, let stand at room temperature for 3 min, and then centrifuge at 12,000 rpm for 15 min. (3) RNA precipitation: Transfer the upper aqueous phase to a new 1.5 mL RNase-free EP tube, add 500 μL of isopropanol to precipitate RNA molecules, and mix thoroughly by inverting. (4) RNA washing: Gently aspirate the supernatant (be careful not to aspirate the white precipitate), drain on paper, add 1 mL of 75% ethanol (750 μL of anhydrous ethanol and 250 μL of DEPC water, prepared in advance) to the precipitate, and centrifuge at 7,500 rpm for 5 min. (5) RNA lysis: Discard the supernatant and dry for 10 min. Add an appropriate amount of DEPC water and dissolve by pipetting. Place on ice and measure OD. 260 / OD 280 .

[0196] Then, antibody constant region-specific primers were used to reverse transcribe the antibody into cDNA using the Thermo Reverse Transcription Kit. The corresponding cDNA was then used as a template for PCR amplification with Ex Taq polymerase (Takara) and degenerate primers, followed by sequencing to obtain the variable region sequences of the heavy and light chains of the monoclonal antibody. The location of the complementarity-determining region (CDR) was determined using the IgBLAST tool.

[0197] To determine the antibody sequence, RNA was extracted from hybridoma cells, and then the variable region sequence was amplified using degenerate primers. Sequencing results showed that the sequence of the monoclonal antibody variable region was derived from a germline gene family of gene fragments (Table 5).

[0198] Table 5 Germline genes of the variable region of anti-Staphylococcal enterotoxin A monoclonal antibody

[0199] MAb <![CDATA[V H ]]> <![CDATA[D H ]]> JH <![CDATA[V K ]]> <![CDATA[J K ]]> SEA 2-6-4*01 1-2*01 4*01 2-109*01 5*01

[0200] Note: V H D H J H These are germline gene fragments from the heavy chain variable region, namely V, D, and J. V K J K These are the V and J germline gene fragments from the light chain variable region, respectively.

[0201] The sequencing results are as follows:

[0202] Light chain nucleotide sequence (SEQ ID NO:10):

[0203]

[0204] Note: The bolded part is the variable region nucleotide sequence, and the unbolded part is the constant region nucleotide sequence.

[0205] Light chain amino acid sequence (SEQ ID NO:7):

[0206]

[0207] Note: Bold text represents the variable region amino acid sequence, while unbold text represents the constant region amino acid sequence. * indicates a stop codon. Bold and underlined text indicates the complementarity-determining region (CDR).

[0208] in:

[0209] LCDR1:KSLLHSNGITY(SEQ ID NO:1)

[0210] LCDR2: RMS

[0211] LCDR3:AQNLELPLT(SEQ ID NO:2)

[0212] The amino acid sequence of the light chain variable region (SEQ ID NO:6):

[0213]

[0214] Heavy chain nucleotide sequence (SEQ ID NO:11):

[0215]

[0216] Note: The bolded portion represents the variable region nucleotide sequence, and the unbolded portion represents the constant region nucleotide sequence. Heavy chain amino acid sequence (SEQ ID NO:9):

[0217]

[0218]

[0219] Note: Bold text represents the variable region amino acid sequence, while unbold text represents the constant region amino acid sequence. * indicates a stop codon. Bold and underlined text indicates the complementarity-determining region (CDR).

[0220] in:

[0221] HCDR1: GFSLSRYS (SEQ ID NO:3)

[0222] HCDR2: IWGNGNT (SEQ ID NO:4)

[0223] HCDR3:AREGTSATEYAMDY(SEQ ID NO:5)

[0224] Heavy chain variable region amino acid sequence (SEQ ID NO:8):

[0225]

[0226] Example 7 Circuit Structure

[0227] A schematic diagram of the analog circuit structure is shown below. Figure 11 As shown in the figure. V Ref V is the reference electrode voltage. BG The source-drain voltage (V) represents the second gate electrode voltage; S, D, and G represent the source, drain, and second gate electrodes, respectively; electrical tests can be performed using a portable source meter or semiconductor analyzer. D The second gate electrode voltage (V) is set to a constant value between 0.5V and 1V. BG Given a constant value between approximately 0V and 5V, the reference electrode voltage (V) Ref Given a constant value between approximately -5V and 0V, measure the channel current I between the source and drain. D Changes over time. Because the SEA carries a negative charge at pH 7.4, when the immobilized antibody captures the SEA, it changes the potential on the surface of the first gate electrode, thereby causing a channel current (I0). D The content of the sample to be tested can be estimated based on the change in current and the response time.

[0228] Example 8: Application of SEA detection biochip

[0229] In an application example, the aforementioned biochip was used to detect different concentrations of SEA, while a 1 μg / mL SEB concentration was used as a negative control. The other end of the capillary tube connected to the microfluidic chip inlet was connected to a syringe on a syringe pump, containing the sample to be tested. Figure 13 The sample to be tested is an original sample obtained from milk, a diluted solution, or a purified solution. Preferably, 0.01 mM PBS (pH 7.4) is used as the detection buffer.

[0230] The sample is slowly injected into the flow channel of the biochip by setting parameters such as sample flow rate and flow rate using an injection pump. Before sample testing, PBS (pH 7.4) buffer is first injected into the microfluidic channel for signal calibration. After the current signal stabilizes, the sample is injected. A portable source meter is used to set a given voltage and measure the change in channel current over time under different samples. The portable source meter can be connected to a mobile phone via Bluetooth, allowing parameter settings and signal readings to be completed on the mobile phone.

[0231] The measured electrical signals are as follows Figure 12 As shown in the figure. A constant second gate electrode voltage (V) is set in the figure. BG The reference electrode voltage is set to 1V, and a constant reference electrode voltage (V) is set. Ref The source-drain voltage is -3V, and the voltage is constant (V). D =1V), and the sample to be tested was slowly injected into the flow channel of the biochip, and tested at 37°C. The responsivity was defined as the response current (I = 1V). D The difference between the initial current (I0) and the current (I0) is divided by the initial current (I0) to reflect the change in the electrical signal. As shown in the figure, when detecting SEA samples, SEA is slowly injected into the flow channel within a certain time range. As the amount of SEA captured by the antibody increases, the responsivity gradually increases. When detecting SEB samples, the signal changes slightly within a certain time range, but eventually stabilizes and no longer increases. In the SEB sample test, the initial signal change is due to interference from non-specific adsorption, and the subsequent stabilization is because SEB cannot be captured by the specific antibody. In the SEA sample test, the responsivity continuously increases because the amount of SEA captured by the specific antibody gradually increases, accumulating sufficient charge on the surface of the first gate electrode. At least three measurements are performed for each sample, and the positive threshold is defined as the sum of the average of the final responsivity of the negative samples (i.e., the responsivity at final equilibrium) and three times its standard deviation. Therefore, in this embodiment, the specific detection of SEA in the range of 1 ng / mL to 1 μg / mL is successfully achieved. The shortest reaction time is approximately 500 seconds (defined as the time it takes for the lowest concentration of positive sample to reach 90% reaction equilibrium), and the detection limit is approximately 1 ng / mL. ELSIA is currently the most widely used SEA detection technology, as demonstrated by companies such as R-Biopharm in Germany. The SET assay kit has a detection limit of 0.25 ng / mL for liquid samples. Compared to ELISA technology, our method offers shorter detection time and simpler operation while maintaining sensitivity.

[0232] Example 9: Detection System for Staphylococcus aureus Enterotoxin A

[0233] The detection system for Staphylococcus aureus enterotoxin A consists of a sample processing module, a data acquisition and processing module, and a control module (see...). Figure 14 Preferably, it also includes a user interface.

[0234] Sample processing module 51 includes steps such as sample pretreatment, centrifugation, filtration, and dilution to obtain the required biological samples and input them into the biochip;

[0235] Control module 52: used to control the voltage applied to the sensor and to control the sample flow;

[0236] Data acquisition and processing module 53: used to acquire and process data obtained from the biochip;

[0237] Judgment and output module 54: compares the data obtained by the data acquisition and processing module with the data obtained by the 1μg / mL negative control group, and outputs the judgment result. The judgment standard is: if the response of the test sample is greater than the sum of the average response of the negative sample and 3 times the standard deviation, then it is judged as positive.

[0238] User interface: Used for operation and interaction.

[0239] In some implementations, the control module and data acquisition and processing module can be connected to a mobile user interface via Bluetooth, allowing parameter settings and signal visualization to be completed on the mobile device.

[0240] Example 10 Electronic Device

[0241] This embodiment provides an electronic device, which can be manifested in the form of a computing device (e.g., a server device), including a memory, a processor, and a computer program stored in the memory and executable on the processor, wherein the processor can implement the applications described above when executing the computer program.

[0242] Figure 15 This embodiment shows a hardware structure diagram, and the electronic device 9 specifically includes:

[0243] At least one processor 91, at least one memory 92, and a bus 93 for connecting different system components (including processor 91 and memory 92), wherein:

[0244] Bus 93 includes a data bus, an address bus, and a control bus.

[0245] The memory 92 includes volatile memory, such as random access memory (RAM) 921 and / or cache memory 922, and may further include read-only memory (ROM) 923.

[0246] The memory 92 also includes a program tool 925 having a set (at least one) of program modules 924, including but not limited to: an operating system, one or more application programs, other program modules, and program data, each or some combination of these examples may include an implementation of a network environment.

[0247] The processor 91 performs various functional applications and data processing by running computer programs stored in the memory 92, such as processing sequence information in samples and sequence information in a database.

[0248] Electronic device 9 can further communicate with one or more external devices 94 (e.g., keyboard, pointing device, etc.). This communication can be performed via input / output (I / O) interface 95. Furthermore, electronic device 9 can also communicate with one or more networks (e.g., local area network (LAN), wide area network (WAN), and / or public network, such as the Internet) via network adapter 96. Network adapter 96 communicates with other modules of electronic device 9 via bus 93. It should be understood that, although not shown in the figures, other hardware and / or software modules can be used in conjunction with electronic device 9, including but not limited to: microcode, device drivers, redundant processors, external disk drive arrays, RAID (disk array) systems, tape drives, and data backup storage systems, etc.

[0249] It should be noted that although several units / modules or sub-units / modules of the electronic device have been mentioned in the detailed description above, this division is merely exemplary and not mandatory. In fact, according to embodiments of the present invention, the features and functions of two or more units / modules described above can be embodied in one unit / module. Conversely, the features and functions of one unit / module described above can be further divided and embodied by multiple units / modules.

[0250] In hardware implementations, the division between functional modules / units mentioned above does not necessarily correspond to the division of physical components; for example, a physical component may have multiple functions, or a function or step may be executed collaboratively by several physical components. Some or all components may be implemented as software executed by a processor, such as a digital signal processor or a microprocessor, or as hardware, or as integrated circuits, such as application-specific integrated circuits (ASICs).

[0251] Example 11 Computer-readable medium

[0252] This invention provides a computer-readable medium having a computer program stored thereon, which, when executed by a processor, implements the steps of the above-described application.

[0253] The readable medium may be more specifically, including but not limited to: portable disks, hard disks, random access memory, read-only memory, erasable programmable read-only memory, optical storage devices, magnetic storage devices, or any suitable combination thereof.

[0254] In a possible implementation, the present invention can also be implemented as a program product comprising program code, which, when the program product is run on a terminal device, is used to cause the terminal device to perform the steps of implementing the above-described identification method.

[0255] The program code for executing the present invention can be written in any combination of one or more programming languages. The program code can be executed entirely on the user device, partially on the user device, as a standalone software package, partially on the user device and partially on a remote device, or entirely on a remote device.

[0256] Software can be distributed on computer-readable media, which can include computer storage media (or non-transitory media) and communication media (or temporary media). Computer storage media includes, but is not limited to, RAM, ROM, EEPROM, flash memory or other memory technologies, CD-ROM, digital versatile disc (DVD) or other optical disc storage, magnetic cartridges, magnetic tape, disk storage or other magnetic storage devices, or any other medium that can be used to store desired information and is accessible to a computer. As is known to those skilled in the art, the term computer storage media includes volatile and non-volatile, removable and non-removable media implemented in any method or technology for storing information (such as computer-readable instructions, data structures, program modules, or other data). Furthermore, it is known to those skilled in the art that communication media typically contain computer-readable instructions, data structures, program modules, or other data in modulated data signals such as carrier waves or other transmission mechanisms, and can include any information delivery medium.

[0257] Those skilled in the art will understand that all or some of the steps, systems, or devices disclosed above can be implemented as software, firmware, hardware, or suitable combinations thereof.

Claims

1. A monoclonal antibody against Staphylococcus aureus enterotoxin A, characterized in that, It comprises a light chain variable region and a heavy chain variable region. The amino acid sequence of LCDR1 in the light chain variable region is shown in SEQ ID NO: 1, the amino acid sequence of LCDR2 is RMS, and the amino acid sequence of LCDR3 is shown in SEQ ID NO:

2. The amino acid sequences of HCDR1 to HCDR3 in the heavy chain variable region are shown in SEQ ID NO: 3, 4, and 5, respectively.

2. The monoclonal antibody as described in claim 1, characterized in that, The light chain variable region comprises a sequence as shown in SEQ ID NO: 6, and the heavy chain variable region comprises a sequence as shown in SEQ ID NO:

8.

3. The monoclonal antibody as described in claim 1, characterized in that, The monoclonal antibody comprises a heavy chain and a light chain, the light chain comprising the sequence shown in SEQ ID NO: 7, and the heavy chain comprising the sequence shown in SEQ ID NO:

9.

4. A polynucleotide, characterized in that, The polynucleotide encodes the monoclonal antibody as described in any one of claims 1-3.

5. The polynucleotide as described in claim 4, characterized in that, The polynucleotides include polynucleotides encoding a light chain as shown in SEQ ID NO: 10 and / or polynucleotides encoding a heavy chain as shown in SEQ ID NO:

11.

6. A recombinant expression vector, characterized in that, It includes the polynucleotides as described in claim 4 or 5.

7. A transformant, characterized in that, It includes the polynucleotide as described in claim 4 or 5 or the recombinant expression vector as described in claim 6.

8. The transformant as described in claim 7, characterized in that, The host cells of the transformant are prokaryotic cells and / or eukaryotic cells.

9. The transformant as described in claim 8, characterized in that, The host cell is Escherichia coli.

10. A biosensitive membrane, characterized in that, The biosensitive membrane is loaded with a monoclonal antibody as described in any one of claims 1-3.

11. A biochip, characterized in that, The biochip includes the biosensitive membrane as described in claim 10.

12. The biochip as described in claim 11, characterized in that, The biochip also includes one or more of the following: substrate, thin-film transistor, reference electrode, and microfluidic chip; The thin-film transistor structure and the reference electrode are disposed on the substrate; The biosensitive membrane is placed on top of the thin-film transistor; The microfluidic chip is placed on top of the thin-film transistor, the biosensitive membrane, and the reference electrode.

13. The biochip as described in claim 11 or 12, characterized in that, The thin-film transistor is composed of a channel, a gate insulating layer, a source electrode, a drain electrode, a second gate electrode, and a first gate electrode.

14. The biochip as described in claim 13, characterized in that, The channel is made of oxide semiconductor, low-temperature polycrystalline silicon, or organic semiconductor material, and the first gate electrode is made of Au or ITO.

15. The biochip as described in claim 14, characterized in that, The reference electrode is a solid Ag / AgCl or Pt, and / or the biosensitive membrane is fixed to the surface of the first gate electrode by a chemical method.

16. A detection system for detecting Staphylococcus aureus enterotoxin A, characterized in that, The detection system includes a monoclonal antibody as described in any one of claims 1-3 or a biochip as described in any one of claims 11-15.

17. The detection system as described in claim 16, characterized in that, The detection system also includes one or more of the following components: (1) Sample processing module, (2) Control module, (3) Data acquisition and processing module, and (4) User interface; The sample processing module obtains the required biological sample through sample pretreatment, centrifugation, filtration, and dilution, and inputs it into the biochip. The control module controls the voltage applied to the sensor and the sample flow; The data acquisition and processing module acquires and processes data obtained from the biochip.

18. The detection system as described in claim 17, characterized in that, The detection system also includes a judgment and output module, which compares the data obtained by the data acquisition and processing module with the data obtained by the 1µg / mL negative control group and outputs the judgment result. The judgment criterion is: if the responsivity of the test sample is greater than the sum of the average responsivity of the negative sample and three times the standard deviation, then it is judged as positive.

19. A method for manufacturing a biochip as described in any one of claims 11-15, characterized in that, The method includes: Design and fabrication of microfluidic chips comprising the monoclonal antibody as described in any one of claims 1-3; The microfluidic chip is bonded to a thin-film transistor; The biosensitive membrane is immobilized on the surface of the first gate electrode.

20. A method for detecting Staphylococcus aureus enterotoxin A, characterized in that, The sample to be tested is detected using the monoclonal antibody as described in any one of claims 1-3, the biochip as described in any one of claims 11-15, or the detection system as described in any one of claims 16-18. The method described herein is for non-disease diagnostic purposes.

21. The method as described in claim 20, characterized in that, The method includes: slowly injecting the sample to be tested into the microfluidic channel of the biochip to fully contact and react with the biosensitive membrane; A constant drain voltage is set between the source electrode and the drain electrode of the biochip, a constant gate voltage within a range is given to the second gate electrode, and a constant reference electrode voltage within a range is given to the reference electrode. The change in the channel current between the source electrode and the drain electrode is measured in real time, and the content of Staphylococcus aureus enterotoxin A in the sample to be tested is calculated.

22. The method as described in claim 21, characterized in that, The drain voltage is between 0.5V and 1V; the gate voltage is between 0V and 5V; the reference electrode voltage is between -5V and 0V; and / or, the sample to be tested is a raw solution, a diluted solution, or a purified solution obtained from milk; and / or, the buffer solution used in the method is 0.01 mM PBS, pH 7.

4.

23. The application of the monoclonal antibody as described in any one of claims 1-3, the biochip as described in any one of claims 11-15, or the detection system as described in claims 16-18 in the analysis of biological samples, chemical samples, food, and / or environmental samples against Staphylococcus aureus enterotoxin A; in, The application is for non-disease diagnostic purposes.

Images