A tropical Candida engineered bacterium for efficiently synthesizing β-ionone and its application

Abstract

The present invention discloses an engineering strain of tropical Candida for efficiently synthesizing β-ionone and its application, belonging to the field of enzyme engineering and metabolic engineering. The present invention selects the carotenoid cleavage dioxygenase gene PhCCD1 from the plant petunia, randomly mutates PhCCD1 by error-prone PCR, takes tropical Candida β-carotene production strain ANT-06 as chassis cell, expresses PhCCD1 enzyme mutants in its peroxisome and cytoplasm respectively, screens and obtains three tropical Candida engineering strains capable of efficiently synthesizing β-ionone, with the yield reaching 173.6±7.0mg / L, 136±3.9m / L, 177.9±4.3mg / L, and obtains PhCCD1 enzyme mutants by cloning and sequencing from the engineering bacteria.

Description

Technical Field

[0001] The invention relates to an engineering bacterium of Candida tropicalis for efficiently synthesizing beta-ionone and application thereof, and belongs to the field of enzyme engineering and metabolic engineering. Background Art

[0002] β-ionone is a natural plant aromatic volatile, with a main chain composed of thirteen carbons, and is an irregular monoterpene compound. β-ionone is the product of oxygenated cleavage of the 9, 10 and 9', 10' double bonds of β-carotene, and is a light yellow oily liquid. In nature, it is widely found in various plants, such as flowers, osmanthus, petunia, sunflower, etc.; fruits, such as apples, raspberries and figs, etc.; vegetables, such as carrots and tomatoes, etc. β-ionone has been widely used in commercial production, such as food, cosmetics, daily necessities and other industries. Because β-ionone has certain effects in antibacterial, anti-embryotoxicity, hypolipidemic, anti-tumor, anti-cancer, etc., it is currently very popular in the medical and pharmaceutical industries. Globally, the market demand is large and has good application prospects.

[0003] There are two methods for synthesizing β-ionone: chemical synthesis and plant extraction. Among them, chemical synthesis is the main method. For example, citral is used as the raw material, and after the aldol condensation reaction with acetone, concentrated sulfuric acid is added for cyclization to generate β-ionone. Although the process route is simple and the raw materials are abundant, the process is relatively complex, the total recovery rate is low, and the synthesis cycle is long. At present, consumers prefer natural products, so the value of the products obtained by chemical synthesis is lower than that of natural products; natural products can be extracted from plants. Plant extraction often uses raspberries as raw materials to extract β-ionone, but the concentration of the obtained product is low, and the plant growth cycle is long and land resources are scarce, so the price of naturally extracted β-ionone is expensive.

[0004] In addition to the above two methods, the microbial synthesis of β-ionone is becoming increasingly popular. The microbial synthesis method has the advantages of short growth cycle, simple process and high yield. The terpene fragrance produced by this method has been recognized as a natural product by European and American legislation and is a good substitute for natural products. At present, there are many reports on the biosynthesis of terpenoids, and the metabolic pathways are clear, which lays a good foundation for the biosynthesis of β-ionone. Some researchers have produced β-ionone or increased its yield in Saccharomyces cerevisiae, Escherichia coli and Yarrowia lipolytica through engineering means such as heterologous gene expression, metabolic pathway reconstruction and key enzyme modification.

[0005] Candida tropicalis is a diploid non-conventional yeast with the characteristics of fast cell growth, large biomass, wide substrate range, and strong environmental tolerance. It has strong industrialization potential and commercial application prospects. It has been reported that Candida tropicalis has been industrialized and commercialized in the production of long-chain dibasic acids and xylitol. In addition, Candida tropicalis has the ability to produce high oils and is a potential chassis cell for efficient synthesis of terpenes.

[0006] There are currently no reports on the synthesis of β-ionone by Candida tropicalis, nor on the directed evolution of carotenoid cleavage dioxygenase PhCCD1 in yeast to increase β-ionone production. Therefore, providing enzyme mutants that can efficiently synthesize β-ionone and new engineered strains that efficiently produce β-ionone is of great value for further production and application of β-ionone. Summary of the invention

[0007] The present invention selects a carotenoid cleavage dioxygenase gene PhCCD1 from the plant petunia, randomly mutates PhCCD1 through error-prone PCR, takes tropical Candida as a chassis cell, expresses the PhCCD1 enzyme mutant in its peroxisome and cytoplasm, respectively, and screens and obtains an engineered strain of tropical Candida that can efficiently synthesize β-ionone.

[0008] The first object of the present invention is to provide a carotenoid cleavage dioxygenase mutant, wherein one or more mutations occur at positions 11, 82, 98, 297, and 422 of the amino acid sequence of the carotenoid cleavage dioxygenase mutant as shown in SEQ ID NO.8.

[0009] In one embodiment, the glutamic acid at position 297 is mutated to glycine; alternatively, the glutamic acid at position 11 is mutated to glycine and the glycine at position 82 is mutated to serine and the arginine at position 112 is mutated to glycine; alternatively, the glycine at position 98 is mutated to serine and the tyrosine at position 422 is mutated to histidine.

[0010] In one embodiment, the amino acid sequence of the carotenoid cleavage dioxygenase mutant is shown in SEQ ID NOs. 9-11.

[0011] In one embodiment, the PhCCD1 is from the plant Petunia hybrida, and the nucleotide sequence is shown in SEQ ID NO.7.

[0012] The second object of the present invention is to provide a gene encoding any of the above carotenoid-cleaving dioxygenase mutants.

[0013] In one embodiment, the nucleotide sequence of the carotenoid cleavage dioxygenase mutant is shown in SEQ ID NOs. 1-3.

[0014] The invention also provides a recombinant plasmid carrying the gene.

[0015] The present invention also provides a host cell carrying the above gene or the above recombinant plasmid.

[0016] In one embodiment, the host may be Candida tropicalis or Saccharomyces cerevisiae or Pichia pastoris or Kluyveromyces. Optionally, the host is Candida tropicalis.

[0017] The third object of the present invention is to provide a catalyst comprising any one of the above carotenoid-cleaving dioxygenase mutants or any one of the above host cells.

[0018] The present invention also provides a method for synthesizing β-ionone, which uses the catalyst to catalyze β-carotene to synthesize β-ionone.

[0019] In one embodiment, the enzyme is randomly mutated using error-prone PCR technology to obtain random mutation fragments of PhCCD1, and the PhCCD1 mutation fragments are inserted into a pre-constructed gene expression cassette vector to obtain a PhCCD1 random mutation library for Candida tropicalis transformation.

[0020] In one embodiment, by using low-fidelity Taq enzyme, changing the Mn 2+ concentration to carry out error-prone PCR to achieve random mutation of PhCCD1 enzyme and obtain PhCCD1 random mutation fragment library.

[0021] In one embodiment, the system contains Mn 2+ The concentrations are 0.05 / 0.1 / 0.2 / 0.3 / 0.4 / 0.5 / 0.6mmol / L.

[0022] In one embodiment, different concentrations of Mn 2+ The obtained PCR product was recovered by gel into one tube, and three groups were paralleled, with a total of three tubes of PCR product for connection with the vector.

[0023] In one embodiment, the random mutation library structural unit is "T vector-homologous arm-selection marker-promoter-PhCCD1 random mutation fragment-terminator".

[0024] In one embodiment, the reusable selection marker is URA3; the promoter is the endogenous promoter PGAPDH of Candida tropicalis; the terminator is the endogenous TENO1 of Candida tropicalis; and the homology arms are derived from any endogenous gene in Candida tropicalis that does not affect yeast growth.

[0025] In one embodiment, the nucleotide sequence of the screening marker URA3 gene is shown as SEQ ID NO.4; the nucleotide sequence of the promoter PGAPDH is shown as SEQ ID NO.5; and the nucleotide sequence of the terminator TENO1 is shown as SEQ ID NO.6.

[0026] In one embodiment, the random mutation library for transformation of Candida tropicalis is obtained by connecting the random mutation fragment of PhCCD1 to a pre-constructed vector, transforming Escherichia coli, and extracting the plasmid. Before transforming Candida tropicalis, it can be linearized by enzyme digestion.

[0027] The invention screens out an engineered Candida tropicalis strain capable of efficiently synthesizing β-ionone, integrates the random mutation library into any site on the Candida tropicalis genome that does not affect its growth, and verifies the strain by two-phase fermentation in a shake flask after multiple rounds of plate screening.

[0028] In one embodiment, the tropical Candida β-ionone engineered bacteria, the precursor substance β-carotene is orange, the product β-ionone is light yellow, and the PhCCD1 enzyme catalyzes β-carotene to produce β-ionone, so the color of the tropical Candida engineered bacteria will be lighter than the starting strain, and potential positive mutant strains can be obtained through multiple rounds of plate screening.

[0029] In one embodiment, the engineered Candida tropicalis is characterized in that the PhCCD1 enzyme mutant is localized to the peroxisome or cytoplasm; the peroxisome localization signal peptide used is a codon-optimized ePTS derived from Saccharomyces cerevisiae, and its nucleotide sequence is shown in SEQ ID NO.12.

[0030] In one embodiment, chromosomal integration of the PhCCD1 enzyme mutant can be achieved using CRISPR-Cas9 gene editing technology.

[0031] The invention provides several PhCCD enzyme mutants capable of efficiently synthesizing beta-ionone. The tropical Candida engineering bacteria capable of synthesizing beta-ionone are used to obtain PhCCD1 enzyme mutants through in vitro cloning.

[0032] In one embodiment, the sequence of the PhCCD1 enzyme mutant is obtained by snager sequencing.

[0033] In one embodiment, the PhCCD1 enzyme mutants are respectively named PhCCD1 C61 PhCCD1 E13 PhCCD1 E43 ;

[0034] In one embodiment, the PhCCD1 mutant PhCCD1 C61 , is cytoplasmic expression, the copy number is 2, and the nucleotide sequence is shown in SEQ ID NO.1;

[0035] In one embodiment, the PhCCD1 mutant PhCCD1 E13 , is expressed in peroxisomes, has a copy number of 1, and a nucleotide sequence as shown in SEQ ID NO.2;

[0036] In one embodiment, the PhCCD1 mutant PhCCD1 E43 , is expressed in peroxisomes, has a copy number of 2, and the nucleotide sequence is shown in SEQ ID NO.3;

[0037] The present invention also provides a method for producing beta-ionone by fermentation, wherein any of the tropical candida engineered bacteria is added to a fermentation medium, and shake flask two-phase fermentation is performed to obtain beta-ionone.

[0038] In one embodiment, Y60 medium is used for fermentation to produce β-ionone.

[0039] In one embodiment, the Y60 medium composition is a YPD medium with a glucose content of 60 g / L.

[0040] In one embodiment, the strain was streaked on 2x YPD plates and cultured at 30°C for 48h;

[0041] Pick a single colony and inoculate it into 20 mL 2xYPD liquid medium for seed liquid culture until the seed liquid OD reaches 600 8 to 15;

[0042] The seed solution was inoculated into a 250 ml conical flask containing 15 mL of Y60 medium until the OD 600 About 0.1, placed at 30°C, 200rpm shaker culture for 8h;

[0043] Add 10% n-dodecane, place in a shaker at 30°C and 200 rpm for two-phase fermentation in a shake flask for 96 hours.

[0044] The present invention also provides the use of any of the above carotenoid cleavage dioxygenase mutants or the above gene or the above recombinant plasmid or any of the above host cells in synthesizing β-ionone.

[0045] The present invention also provides the use of any of the above carotenoid cleavage dioxygenase mutants or any of the above host cells in the fields of food, chemical industry, and medicine. The present invention also provides the use of the above tropical Candida engineered bacteria and PhCCD1 mutants in the fields of food, daily chemicals, chemical industry, medical treatment, or pharmaceuticals.

[0046] Beneficial Effects

[0047] The invention selects a carotenoid cleavage dioxygenase gene PhCCD1 from petunia, randomly mutates PhCCD1 through error-prone PCR, takes a tropical Candida β-carotene production strain ANT-06 as a chassis cell, expresses the PhCCD1 enzyme mutant in the peroxisome and cytoplasm, screens and obtains an engineered Candida tropicalis strain capable of efficiently synthesizing β-ionone, clones and sequences the engineered strain, and obtains the PhCCD1 enzyme mutant.

[0048] The tropical Candida engineered bacteria constructed by the PhCCD1 enzyme mutant obtained by the method of the present invention were subjected to shake flask two-phase fermentation. In 15 mL Y60 liquid medium, 30° C., 200 rpm conditions, the shake flask two-phase fermentation was carried out for 96 h. The engineered bacteria C61 expressed the mutant PhCCD1 in the cytoplasm. C61 , the copy number was 2, and the β-ionone production was 173.6±7.0mg / L (5.4±0.3mg / gDCW; Dry Cell Weight is cell dry weight), which was 109% higher than that of the control group of engineered bacteria cytPh-D (83.1±2.9mg / L) with a copy number of 2 and expression of non-mutated PhCCD1 in the cytoplasm;

[0049] Expression of mutant PhCCD1 in peroxisomes by engineered bacteria E13 E13 , the copy number was 1, and the β-ionone production was 136±3.9m / L (4.1±0.1mg / g DCW), which was 386% higher than the control group with the copy number of 1 and the engineered bacteria Ph-S (27.6±1.6mg / L) expressing the non-mutated PhCCD1 in the peroxisomes, which was 4.9 times higher;

[0050] Expression of mutant PhCCD1 in peroxisomes by engineered bacteria E43 E43 , with a copy number of 2, and β-ionone production of 177.9±4.3mg / L (5.7±0.1mg / g DCW), an increase of 75% compared with the control group Ph-D (101.4±7.0mg / L) with a copy number of 2 and peroxisome expression of unmutated PhCCD1.

[0051] The invention obtains a PhCCD1 enzyme mutant capable of efficiently catalyzing the synthesis of β-ionone through directed evolution of the enzyme. The tropical Candida β-ionone engineered bacteria can efficiently synthesize β-ionone using simple carbon source glucose, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 : Schematic diagram of the β-ionone synthesis pathway in Candida tropicalis;

[0053] Figure 2 : Principles of directed evolution of enzymes;

[0054] Figure 3 : The β-ionone yield of the tropical Candida β-ionone engineered bacteria constructed by the present invention in two-phase fermentation in shake flasks;

[0055] Figure 4 : The plasmid Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1-TENO1 constructed by the present invention;

[0056] Figure 5 : The plasmid Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1-ePTS-TENO1 constructed by the present invention. DETAILED DESCRIPTION

[0057] 1. MM culture medium:

[0058] 20g / L glucose, 10g / L ammonium sulfate, 6.7g / L YNB (Yeast Nitrogen Base Without Aminoacids);

[0059] 2. Source of enzyme

[0060] Ordinary Taq enzyme, purchased from Norvegian, 2×Taq Plus Master MixⅡ(Dye Plus), catalog number: P213-01;

[0061] High-fidelity Taq enzyme was purchased from Takara. HSDNA Polymerase, Code No. R010A.

[0062] 3. Expression cassette vector construction

[0063] The construction method of Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1-ePTS-TENO1 is as follows:

[0064] (1) Construction of the linearized fragment -PGAPDH-PhCCD1-ePTS-TENO1-

[0065] The carotenoid cleavage dioxygenase gene PhCCD1 from the plant petunia was synthesized by Tianlin Biotechnology Company after codon optimization according to the tropical candidum codon preference (the nucleotide sequence of the sequence is shown in SEQ ID NO.7), and it was connected to the plasmid pUC57. The synthesized plasmid was named pUC57-PhCCD1. Primers PXPS-F / R were designed (primers are shown in Table 1), and the plasmid was used as a template for PCR amplification to obtain a linear fragment -PhCCD1-ePTS-, which contained restriction sites SacⅠ and XhoⅠ at both ends of the linear fragment, and also contained partial homologous fragments of the promoter PGAPDH (nucleotide sequence is shown in SEQ ID NO.5) and the terminator TENO1 (nucleotide sequence is shown in SEQ ID NO.6); the linear fragment was purified by a gel recovery purification kit for use.

[0066] Using the plasmid Ts-TPGK1-carB-PFBA1-PGAPDH-carRP-TENO1 constructed in the laboratory as a template (for details, please refer to the literature "Systematic Metabolic Engineering of Tropical Candida to Produce Terpene Natural Products"), the fragment -TENO1-Ts-TPGK1-carB-PFBA1-PGAPDH- was obtained after gel digestion with SalⅠ and NheⅠ. The fragment was connected with the linear fragment -PhCCD1-ePTS- through a one-step ligation kit and then transformed into Escherichia coli JM109 by chemical transformation, coated with ampicillin-resistant LB plates, and cultured at 37°C for 10-12h; colony PCR was used to screen the correct transformants, and the plates were inoculated into ampicillin-resistant LB liquid culture medium, and cultured at 37°C, 200rpm for 10-12h; the plasmid was extracted for enzyme digestion verification;

[0067] Using the above verified plasmid as a template, primers guPPT-F / R were designed (primers are shown in Table 1), and the linear fragment -PGAPDH-PhCCD1-ePTS-TENO1- was amplified by PCR, and purified by a gel recovery purification kit for later use.

[0068] (2) Construction of plasmid Ts19-GRE3-gda324-URA3-PGAPDH-PhCCD1-ePTS-TENO1

[0069] Plasmid Ts19-GRE3-gda324-URA3 was constructed in the laboratory in the early stage. For details, see the literature "Metabolic Engineering of Candida tropicalis to Produce 1,2,4-Butanetriol" (the original plasmid name is Ts UDGRE3-gda-URA3-UDGRE3, abbreviated here as Ts19-GRE3-gda324-URA3), and the nucleotide sequence of URA3 is shown in SEQ ID NO.4. Plasmid T19-GRE3-gda324-URA3 was digested and purified by EcoRI to obtain a linear fragment -Ts19-GRE3-gda324-URA3-, which has 20 bp specific sequences at both ends, of which the sequence at the 3' end is homologous to the 20 bp sequence at the end of the terminator TENO1; the 5' end of the linear fragment -PGAPDH-PhCCD1-ePTS-TENO1- has a 20 bp sequence that is homologous to the linear fragment -Ts19-GRE3-gda3 The two linear fragments were connected by a one-step ligation kit and transformed into Escherichia coli JM109, and spread on ampicillin-resistant LB plates. The correct transformants were screened by colony PCR using primers GRE3-F / R (primers are shown in Table 1). After culturing in liquid medium, the plasmid Ts19-GRE3-gda324-URA3-PGAPDH-PhCCD1-ePTS-TENO1 was extracted using a plasmid extraction kit. The plasmid map is shown in Figure 5 As shown, restriction enzyme digestion verifies whether the plasmid is correct, and sequencing verifies the target gene and signal peptide.

[0070] Table 1 Expression cassette vector primers

[0071]

[0072] The construction method of Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1-TENO1 is as follows:

[0073] Primers cytPh-F and cytPh-R (primers are shown in Table 2) were designed. The plasmid pUC57-PhCCD1 constructed in step (1) was used as a template for PCR amplification to obtain a linear fragment -PhCCD1-ePTS-. The two ends of the linear fragment contained restriction sites SacⅠ and XhoⅠ. The linear fragment was purified by gel recovery and purification kit for later use. The remaining steps were the same as above. The plasmid map is shown in Figure 4 shown.

[0074] Table 2 Expression cassette vector primers

[0075] Primers Sequence (5'-3') cytPh-F CGCTCGAGATGGGTAGAAAGGAATCCG cytPh-R GCGAGCTCttaCAACTTAGCTTGTTCTTGGATTT

[0076] 4. Principles of directed evolution of enzymes

[0077] Principles of directed evolution of carotenoid cleavage dioxygenase PhCCD1 Figure 2 First, the mutant library is obtained by error-prone PCR, then linearized and transferred into chassis cells, and high-yield engineered strains are obtained through multiple rounds of strain screening.

[0078] Example 1: Construction of a PhCCD1 random mutation library for Candida tropicalis transformation

[0079] 1. Random mutation of PhCCD1 gene

[0080] (1) Determine the Mn content in error-prone PCR systems 2+ concentration

[0081] The PhCCD1 gene was obtained by Tianlin Biotechnology Co., Ltd. through codon optimization of tropical Candida. The sequence is shown in SEQ ID NO.7 (the amino acid sequence is shown in SEQ ID NO.8). The gene PhCCD1 was integrated into the plasmid pUC57 to construct the plasmid pUC57-PhCCD1. Using this plasmid as a template, primers Ph-F, Ph-R (containing ePTS), and cytPh-R (primers are shown in Table 3) were designed. Mn 2+ The concentrations were set to 0, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, and 1.0 mmol / L, respectively. Low-fidelity Taq enzyme was used to perform error-prone PCR to amplify PCR products. The PCR products at six concentrations were recovered into one tube. Agarose gel electrophoresis was used to verify whether the PCR product successfully amplified the target fragment. The brightness of the bands was used to judge whether Mn 2+ The concentrations of 0, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, and 0.6 mmol / L were error-prone PCR condition variables.

[0082] Table 3 Primer sequences

[0083]

[0084] (2) Obtaining PhCCD1 random mutation fragments

[0085] The plasmid pUC57-PhCCD1 constructed in step (1) was used as a template, primers Ph-F, Ph-R (ePTS), cytPh-R (primers see Table 3), and low-fidelity Taq enzyme were used to add Mn at concentrations of 0, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, and 1.0 mmol / L, respectively. 2+ , error-prone PCR was performed, and the amplification products were mixed to obtain -PhCCD1-ePTS-, -PhCCD1- random mutation fragments.

[0086] 2. Construction of PhCCD1 random mutation library

[0087] The PhCCD1 random mutation fragment prepared in 1 was taken, and fragment -PhCCD1-ePTS- and fragment -PhCCD1- were obtained after digestion with XhoⅠ and SacⅠ; the pre-constructed gene expression cassette vectors Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1-ePTS-TENO1 and Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1-TENO1 were double digested with XhoⅠ and SacⅠ to obtain vector fragment -TENO1-Ts-GRE3-gda324-URRA3-PGAPDH- (for peroxisomes) and vector fragment TENO1-Ts-GRE3-gda324-URRA3-PGAPDH- (for cytoplasm).

[0088] The fragment -PhCCD1-ePTS- and the vector -TENO1-Ts-GRE3-gda324-URRA3-PGAPDH- (for peroxisomes) were connected through Solution I and transformed into Escherichia coli JM109. The transformants were scraped into the same tube and the plasmids were extracted after culture to obtain the PhCCD1 random mutation library Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1 mutants -ePTS-TENO1.

[0089] The fragment -PhCCD1- and the vector -TENO1-Ts-GRE3-gda324-URRA3-PGAPDH- (for cytoplasm) were connected by Solution I and transformed into Escherichia coli JM109. The transformants were scraped into the same tube respectively, and the plasmid was extracted after culture to obtain the PhCCD1 random mutation library Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1 mutants -TENO1.

[0090] 3. Construction of a PhCCD1 random mutation library for Candida tropicalis transformation

[0091] Take the PhCCD1 random mutation library Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1 constructed in 2 mutants -ePTS-TENO1,Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1 mutants-TENO1 was linearized by MluⅠ digestion to obtain the PhCCD1 random mutation library for Candida tropicalis transformation-GRE3-gda324-URRA3-PGAPDH-PhCCD1 mutants -ePTS-TENO1-GRE3-, -GRE3-gda324-URRA3-PGAPDH-PhCCD1 mutants -TENO1-GRE3-.

[0092] Example 2: Construction of an engineered strain of Candida tropicalis for efficient synthesis of β-ionone

[0093] 1. Obtaining the sgRNA transient expression cassette targeting GRE3

[0094] The sgRNA targeting the GRE3 site of Candida tropicalis was designed by software sgRNAcas9 analysis. The sgRNA targeting expression cassette plasmid pUC57-ptsgURA3 constructed in the laboratory in the early stage was used as a template (disclosed in "Construction and Application of CRISPR-dCas9 System in Candida tropicalis Based on tRNA-gRNA Strategy"), and primers sgGRE3-F / R (primers are shown in Table 4) were designed. The plasmid was used as a template, and the sgRNA expression cassette containing the targeting GRE3 gene was amplified by whole plasmid PCR. After purification, the plasmid was purified and the expression cassette was cloned into the plasmid. The cassette was transferred into competent cells of E. coli JM109 by chemical transformation, coated with ampicillin-resistant LB plates, and cultured in a 37°C incubator for 10-12 hours; several single colonies were randomly selected for colony PCR to verify whether the sgRNA sequence was inserted correctly; the correct single colony was inoculated into LB liquid culture medium containing ampicillin resistance, cultured at 37°C, 200rpm for 8-10 hours, and the plasmid was extracted by a plasmid extraction kit, and the sgRNA sequence was verified by sequencing to obtain the sgRNA plasmid expression cassette Ts-sgRNA-GRE3 targeting GRE3. Using this plasmid as a template and primers M13-F / R (primers see Table 4), PCR amplification was performed to obtain the sgRNA transient expression cassette -sgRNA-GRE3- targeting GRE3.

[0095] Table 4 Primer sequences

[0096] Primer name Sequence (5'-3') sgGRE3-F CCCATTGTTGGACACCTGGAgttttagagctagaaatagc sgGRE3-R TCCAGGTGTCCAACAATGGGtgcaagaaccgggaatcgaa M13-F TGTAAAACGACGGCCAGT M13-R CAGGAAACAGCTATGAC

[0097] The β-carotene engineering bacteria ANT-06 constructed in the laboratory in the early stage was used as the starting strain (the specific construction method can be referred to the literature "Systematic metabolic engineering of tropical Candida to produce terpenoid natural products"), and the marker gene URA3 was ejected by LiCl transformation method to obtain uracil-deficient strain ANT-07. The PhCCD1 random mutation library for tropical Candida transformation constructed in Example 1 - GRE3-gda324-URRA3-PGAPDH-PhCCD1 mutants -ePTS-TENO1-GRE3-, -GRE3-gda324-URRA3-PGAPDH-PhCCD1 mutants -TENO1-GRE3- was mixed with the sgRNA transient expression box targeting GRE3 -sgRNA-GRE3- in a 1:1 ratio, and ethanol precipitated to obtain a high-concentration DNA fragment to be transformed, which was integrated into the genome of the engineered bacterium ANT-07 by the LiCl transformation method to obtain transformants. For specific transformation methods, please refer to the literature "Systematic metabolic engineering of tropical Candida for the production of terpene natural products".

[0098] The synthetic route of β-ionone is Figure 1 As shown in the figure, since the precursor β-carotene is orange and the product β-ionone is light yellow, the PhCCD1 enzyme catalyzes β-carotene to produce β-ionone, so the color of the tropical Candida engineered bacteria that synthesizes β-ionone will be lighter than the starting strain. Pick the light-colored yeast transformants and streak them on the MM plate. After the bacterial lawn grows, compare the color differences and obtain potential positive mutant strains through multiple rounds of plate screening, which are named C61, E13, and E43 respectively.

[0099] Example 3: Sequence determination of PhCCD enzyme mutants

[0100] The tropical Candida engineered strains C61, E13, and E43 obtained in Example 2 were streaked onto plates to obtain bacterial mosses, and yeast genomes were extracted. Using the yeast genome as a template, primers Ph-F and Te-R (primers are shown in Table 5), high-fidelity enzyme PCR amplification was performed, and then purified to obtain a fragment - PhCCD1 mutants -ePTS-, -PhCCD1 mutants -, the obtained fragment was connected with the commercial vector T-vector19 (Simple), transformed into Escherichia coli JM109, and the plasmid Ts-PhCCD1 was constructed mutants -ePTS, Ts-PhCCD1 mutants ; The plasmid was sequenced by Sanger sequencing to obtain the nucleotide sequence of the PhCCD enzyme mutant, as shown in SEQ ID NO.1-3. Compared with PhCCD1, the enzyme mutant PhCCD1 C61 PhCCD1E13 PhCCD1 E43 The amino acid sequence is changed as shown in Table 6, and the amino acid sequence of the mutant is shown in SEQ ID NOs. 9 to 11.

[0101] Table 5 Primer sequences

[0102] Primer name Sequence (5'-3') Ph-F GCCTCGAGATGGGTAGAAAGGAATCCGATG Te-R gagaccccaagataacgaatatc

[0103] Table 6 Corresponding amino acid mutation points of enzyme mutants

[0104] name Amino acid mutation point PhCCD1 wild type <![CDATA[PhCCD1 C61 ]]> E11G, G82S, R112G <![CDATA[PhCCD1 E13 ]]> G98S, Y422H <![CDATA[PhCCD1 E43 ]]> E297G

[0105] Example 4: Efficient synthesis of β-ionone by engineered bacteria

[0106] The construction method of the tropical Candida engineered bacteria in the control group is as follows:

[0107] (1) Construction of strain Ph-S / D: The plasmid Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1-ePTS-TENO1 constructed in the specific embodiment was digested with MluⅠ to obtain a linearized fragment -GRE3-gda324-URRA3-PGAPDH-PhCCD1-ePTS-TENO1-GRE3-; the linear fragment was mixed with the sgRNA transient expression cassette targeting GRE3 -sgRNA-GRE3- (Example 2, step 1) (1:1), and ethanol precipitated to obtain a high-concentration DNA fragment; yeast ANT-07 was transformed by LiCl transformation method, and PhCCD1-ePTS was integrated into the genomic GRE3 site to obtain PhCCD1-ePTS single-copy strain Ph-S and PhCCD1-ePTS double-copy strain Ph-D.

[0108] (2) Construction of strain cytPh-D: The plasmid Ts-GRE3-gda324-URRA3-PGAPDH-PhCCD1-TENO1 constructed in the specific embodiment was digested with MluⅠ to obtain a linearized fragment -GRE3-gda324-URRA3-PGAPDH-PhCCD1-TENO1-GRE3-; the linear fragment was mixed with the sgRNA transient expression cassette targeting GRE3 -sgRNA-GRE3- (Example 2, step 1) (1:1), and precipitated with alcohol to obtain a high-concentration DNA fragment; yeast ANT-07 was transformed by LiCl transformation method, PhCCD1 was integrated into the genomic GRE3 site, and the PhCCD1 double-copy strain cytPh-D was obtained.

[0109] Take the tropical Candida engineered strains C61, E13, E43 obtained in Example 2 and the tropical Candida engineered strains of the control group and streak them on YPD plates to obtain single colonies; pick a single colony and inoculate it in 20 mL (50 mL conical flask) of YPD liquid culture medium, 30 ° C, 200 rpm, and culture until OD 600 The seed solution was inoculated into 15 mL (250 mL conical flask) of Y60 liquid culture medium until the OD 600 Reach 0.1 (inoculation amount is about 1% v / v), 30°C, 200rpm, after culturing for 8 hours, add 10% v / v n-dodecane, extract in situ, shake flask two-phase fermentation for 96 hours, and produce β-ionone. Collect the upper organic phase, perform GC-MS detection and analysis, and determine the β-ionone content.

[0110] The specific GC-MS detection conditions are as follows:

[0111] After the two-phase fermentation in the shake flask, the fermentation liquid was separated into layers from bottom to top at 12000rpm for 5min: bacterial cell, aqueous phase, and organic phase. The upper organic phase (dodecane phase) was collected, anhydrous sodium sulfate (0.5g / mL) was added thereto, and the mixture was shaken on an oscillator for 10min and allowed to stand for 2h to remove water; the mixture was centrifuged again at 12000rpm for 5min to remove anhydrous sodium sulfate and collect the organic phase; the organic phase was appropriately diluted with n-hexane, filtered with a 0.22μm organic filter membrane, and the β-ionone yield was detected by GC-MS.

[0112] Detection of β-ionone: GC-MS was used, and the high-resolution GC-MS instrument Exzactive GC (Thermo Fisher Scientific, Germany). Injection volume, 1 μl; split ratio, 10:1. The detection conditions were as follows: the initial column temperature was controlled at 50°C and maintained for 1 min; the temperature was increased to 160°C at a rate of 10°C / min, and then increased to 230°C at a rate of 20°C / min, and maintained for 10 min; the injection port temperature was 250°C; the ion source temperature was 260°C, and the mass spectrometry scanning range was 35-350 m / z. The purity of the standard product used for β-ionone was 98% (Shanghai Yuanye Biotechnology Co., Ltd.), and the concentration was 1 mg / L-50 mg / L.

[0113] The results are as follows Figure 3 As shown, the engineered bacteria C61 expresses the mutant PhCCD1 in the cytoplasm C61 , the copy number was 2, and the β-ionone production was 173.6±7.0mg / L (5.4±0.3mg / g DCW; Dry Cell Weight is cell dry weight), which was 109% higher than that of the control group of engineered bacteria cytPh-D (83.1±2.9mg / L) with a copy number of 2 and expression of non-mutated PhCCD1 in the cytoplasm;

[0114] Expression of mutant PhCCD1 in peroxisomes by engineered bacteria E13 E13 , the copy number was 1, and the β-ionone production was 136±3.9m / L (4.1±0.1mg / g DCW), which was 386% higher than the control group with the copy number of 1 and the engineered bacteria Ph-S (27.6±1.6mg / L) expressing the non-mutated PhCCD1 in the peroxisomes, which was 4.9 times higher;

[0115] Expression of mutant PhCCD1 in peroxisomes by engineered bacteria E43 E43 , with a copy number of 2, and β-ionone production of 177.9±4.3mg / L (5.7±0.1mg / g DCW), an increase of 75% compared with the control group Ph-D (101.4±7.0mg / L) with a copy number of 2 and peroxisome expression of unmutated PhCCD1.

[0116] Although the present invention has disclosed the embodiments as above, they are not intended to limit the present invention. Anyone familiar with the technology can make any changes and modifications without departing from the spirit and scope of the present invention. The protection scope of the present invention shall be based on the definition of the claims.

Claims

1. A carotenoid cleavage dioxygenase mutant, characterized in that: In the carotenoid cleavage dioxygenase mutant, the glycine at position 98 is mutated to serine and the tyrosine at position 422 is mutated to histidine in the amino acid sequence shown in SEQ ID NO.

8.

2. A gene encoding the carotenoid cleavage dioxygenase mutant according to claim 1.

3. A recombinant plasmid carrying the gene according to claim 2.

4. A host cell carrying the gene according to claim 2 or the recombinant plasmid according to claim 3.

5. The host cell according to claim 4, characterized in that The host cell is Candida tropicalis.

6. The host cell according to claim 5, characterized in that The carotenoid cleavage dioxygenase mutant in Candida tropicalis is expressed in the cytoplasm or in the peroxisome.

7. A catalyst, characterized in that The catalyst contains the carotenoid cleavage dioxygenase mutant according to claim 1 or the host cell according to claims 4 to 6.

8. A method for synthesizing β-ionone, characterized in that: The catalyst according to claim 7 is used to catalyze the synthesis of β-ionone from β-carotene.

9. Use of the carotenoid cleavage dioxygenase mutant according to claim 1, the mutant gene according to claim 2, the recombinant plasmid according to claim 3, or the host cell according to any one of claims 4 to 6 in synthesizing β-ionone.

Images