A sea cucumber-derived polypeptide with moisturizing function

Abstract

The present invention relates to an amino acid sequence with moisturizing function derived from sea cucumber, the amino acid sequence is TIGLEVEPSDTIENGK. The present invention also relates to a polypeptide with moisturizing function derived from sea cucumber, the amino acid sequence of the polypeptide is (TIGLEVEPSDTIENGK) n , n is a positive integer of 1 to 5. The present invention extracts a polypeptide with high moisturizing performance composed of a repeated short amino acid sequence from sea cucumbers, and its hydrophilicity makes it have excellent moisturizing properties. Moreover, since it comes from natural sea cucumber components, it will not cause irritation or side effects to the user's skin when further preparing moisturizers and cosmetics containing the moisturizers.

Description

Technical Field

[0001] The invention relates to the biological field, and mainly relates to a polypeptide and application thereof in preparing a moisturizing agent or a cosmetic. Background Art

[0002] The ocean is the source of life for all things on Earth. More than 80% of the biological resources live in the ocean. The ecological environment of marine organisms is very different from that of terrestrial organisms. Marine organisms have extremely rich biodiversity and functional diversity. Due to their special living environment, they have formed unique genetic metabolic mechanisms and chemical defense mechanisms in the process of evolution to adapt to the environment. They are currently the main source of new structural or new active natural products, and have attracted the attention of many researchers due to their potential biological activity.

[0003] Sea cucumber is a general term for animals of the class Holothuria of the phylum Echinodermata. Although sea cucumbers are cylindrical, their thickness, shape and size vary greatly from species to species. Common large edible sea cucumbers are all relatively sturdy cylindrical, with warty feet on the back and tube feet on the ventral side. The body wall of sea cucumbers is flexible and rich in connective tissue, and the thickness varies with the species. Because of its cucumber-like appearance, it is called "sea cucumber" in English. There are more than 900 species of sea cucumbers in the world, and about 140 species in China. Since ancient times, sea cucumbers have been a precious and fine product for nourishing the body and a good medicine for preventing and treating some diseases. There are many records in Chinese medical books of successive dynasties. Sea cucumbers are sweet and warm in nature. They have the effects of nourishing the kidney and essence, nourishing blood and moistening dryness, and prolonging life, which can be comparable to the human body. Sea cucumbers are one of the potential marine organisms that have a beneficial effect on human health. Modern pharmacological studies have shown that sea cucumber peptides, as a marine bioactive peptide, have multiple biologically active functions, such as anti-oxidation, anti-inflammatory, anti-fatigue, anti-tumor, immune regulation, and lowering blood pressure. Protein is the main nutrient component of sea cucumbers. Because it contains more collagen, it is difficult to digest and absorb. Previous studies have reported that the effective utilization rate of sea cucumber protein is only about 20%. Sea cucumber polypeptides are active peptides with special physiological functions that are hydrolyzed from sea cucumbers. They are generally small molecule peptides or polypeptides composed of 2 to 12 amino acids. Such as neuropeptides, glycopeptides, and antibacterial active peptides. Sea cucumber polypeptides can resist aging, improve immunity, scavenge oxygen free radicals, increase the activity of red blood cell SOD, and resist fatigue. Polypeptides have excellent properties such as solubility, low viscosity, and strong thermal stability, and are easily absorbed by the human body. Summary of the invention

[0004] Sea cucumber polypeptides have many physiological functions, but in the prior art, research mainly focuses on the anti-oxidation and anti-inflammatory effects of sea cucumber polypeptides, and little research is done on other functions. The purpose of this application is to provide an active polypeptide derived from sea cucumbers with a moisturizing function.

[0005] Specifically, the present invention relates to the following:

[0006] 1. An amino acid sequence with moisturizing function, wherein the amino acid sequence is Seq ID No.1 (TIGLEVEPSDTIENGK).

[0007] 2. A polypeptide with moisturizing function, wherein the polypeptide comprises the following amino acid sequence: (TIGLEVEPSDTIENGK) n , n is a positive integer from 1 to 5.

[0008] 3. The polypeptide according to claim 2, wherein the amino acid sequence of the polypeptide is TIGLEVEPSDTIENGKTIGLEVEPSDTIENGK TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK (Seq ID No. 5).

[0009] 4. The amino acid sequence according to claim 1 or the polypeptide according to any one of claims 2 to 4, wherein the amino acid sequence or polypeptide is derived from sea cucumber.

[0010] 5. A nucleic acid sequence encoding the amino acid sequence of claim 1 or the polypeptide of any one of claims 2 to 4.

[0011] 6. A method for preparing a polypeptide, wherein the polypeptide is the polypeptide according to any one of claims 2 to 4.

[0012] 7. The method according to claim 6, comprising:

[0013] The polypeptide is obtained by expressing and purifying Pichia pastoris, wherein the Pichia pastoris carries an expression vector comprising the nucleic acid sequence of claim 6.

[0014] 8. The method according to claim 7, wherein the Pichia pastoris is Pichia pastoris GS115, and preferably the expression vector is pPIC9K.

[0015] 9. Use of the amino acid sequence according to claim 1, the polypeptide according to any one of claims 2 to 3, or the polypeptide prepared by the method according to any one of claims 6 to 8 in the preparation of a moisturizer.

[0016] 10. Use of the amino acid sequence of claim 1, the polypeptide of any one of claims 2 to 3, or the polypeptide prepared by the method of any one of claims 6 to 8 in the preparation of cosmetics.

[0017] 11. A moisturizer comprising the amino acid sequence of claim 1 or the polypeptide of any one of claims 2 to 3 or the polypeptide prepared by the method of any one of claims 6 to 8.

[0018] 12. A cosmetic comprising the amino acid sequence of claim 1, or the polypeptide of any one of claims 2 to 3, or the polypeptide prepared by the method of any one of claims 6 to 8.

[0019] Effects of the Invention

[0020] The present application discloses a polypeptide with high moisturizing properties composed of a repetitive short amino acid sequence extracted from sea cucumbers. Its hydrophilicity gives it excellent moisturizing properties, and because it comes from natural sea cucumber components, it will not cause irritation or side effects to the user's skin when further making moisturizers and cosmetics containing the moisturizers. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The mass spectrum obtained by mass spectrometry detection of sea cucumber polypeptides in Example 1 is shown.

[0022] Figure 2 The mass spectrum obtained by mass spectrometry detection of sea cucumber polypeptides in Example 1 is shown.

[0023] Figure 3 Shown is the net charge of the sea cucumber polypeptide sequence with moisturizing function in Example 2.

[0024] Figure 4 Shown are the moisturizing performance test results of the sea cucumber polypeptide sequence with moisturizing function in Example 3 and Comparative Example 1. DETAILED DESCRIPTION

[0025] The present application is further described in detail below in conjunction with specific implementation methods. The examples given are intended to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0026] It should be noted that certain words are used in the specification and claims to refer to specific components. Those skilled in the art should understand that technicians may use different nouns to refer to the same component. This specification and claims do not use the difference in nouns as a way to distinguish components, but use the functional differences of components as the criterion for distinction. As mentioned throughout the specification and claims, "including" or "comprising" are open-ended terms and should be interpreted as "including but not limited to". The subsequent description of the specification is a preferred embodiment of the present application, but the description is based on the general principles of the specification and is not intended to limit the scope of the present application. The scope of protection of the present application shall be determined by the attached claims.

[0027] In the following amino acid sequences and polypeptide sequences, capital letters such as I, P, V, Q, E, S, T, and W represent an amino acid or its amino acid residue. The correspondence between the capital letters and the amino acids is shown in Table 1.

[0028] Table 1 Amino acids and their corresponding capital letters

[0029] Chinese name Alphabet abbreviation Chinese name Alphabet abbreviation Glycine G Serine S Alanine A Threonine T Valine V Cysteine C Leucine L Asparagine N Isoleucine I Glutamine Q Proline P Aspartic acid D Phenylalanine F Glutamate E Tryptophan W Lysine K Methionine M Arginine R Tyrosine Y Histidine H

[0030] The present application provides an amino acid sequence with moisturizing function. Specifically, the amino acid sequence provided by the present application has excellent hydrophilicity due to its rich free amino groups and carboxyl groups.

[0031] In a specific embodiment, the amino acid sequence is Seq ID No.1 (TIGLEVEPSDTIENGK).

[0032] The present application also provides a polypeptide with moisturizing function, wherein the polypeptide comprises the following amino acid sequence: (TIGLEVEPSDTIENGK) n , n is a positive integer from 1 to 5, for example, it can be 1, 2, 3, 4, 5.

[0033] When n=1, the amino acid sequence of the polypeptide is:

[0034] TIGLEVEPSDTIENGK(Seq ID No. 1).

[0035] When n=2, the amino acid sequence of the polypeptide is:

[0036] TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK (Seq ID No. 2).

[0037] When n = 3

[0038] TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK (Seq ID No. 3).

[0039] When n = 4

[0040] TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK (Seq ID No. 4).

[0041] When n = 5

[0042] TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK TIGLEVEPSDTIENGKTIGLEVEPSDTIENGK (Seq ID No. 5).

[0043] In a specific embodiment, the amino acid sequence of the polypeptide is TIGLEVEPSDTIENGKTIGLEVEPSDTIENGK TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK (Seq ID No. 5).

[0044] In one embodiment, the amino acid sequence or polypeptide is derived from sea cucumber. In some embodiments, the amino acid sequence or polypeptide is obtained by hydrolyzing sea cucumber by enzymatic hydrolysis.

[0045] In the embodiments of the present application, a nucleic acid sequence encoding the amino acid sequence or the polypeptide is also included.

[0046] In some embodiments, the amino acid sequence or polypeptide can be produced by chemical synthesis. In some embodiments, the polypeptide can be produced by biosynthesis. In some embodiments, the polypeptide can be extracted from food or obtained by enzymatic hydrolysis.

[0047] In a specific embodiment, the polypeptide is expressed and purified using recombinant Pichia pastoris, wherein the recombinant Pichia pastoris has the above-mentioned nucleic acid sequence.

[0048] Pichia pastoris is a unicellular fungus belonging to the family Saccharomyces. The Pichia pastoris ferments under anaerobic conditions. Its cell morphology is usually elliptical or spherical, with a diameter of 2 to 4 microns, and sometimes pseudohyphae are formed. The optimal growth temperature of Pichia pastoris is 28 to 30°C, but it can also grow at 37°C. The Pichia pastoris has an AOX1 gene, which is a methanol utilization gene of Pichia pastoris. The AOX1 gene promoter is one of the promoters with the strongest regulatory mechanism and the strictest regulation mechanism. At the same time, the constructed Pichia pastoris can be stably integrated in the form of a single copy or multiple copies at a specific site of the genome of Pichia pastoris, and the strain of Pichia pastoris is easy to ferment at a high density, with a high expression of exogenous proteins. There are also peroxisomes in Pichia pastoris, in which the expressed proteins are stored, which can be protected from degradation by proteases and reduce toxic effects on cells.

[0049] In a specific embodiment, the Pichia pastoris is Pichia pastoris GS115.

[0050] The Pichia pastoris GS115 strain is a yeast commonly used in biotechnology and protein expression systems. It has an AOX1 gene, which can be normally expressed to produce an enzyme that converts methanol into formaldehyde, and is a normal methanol-utilizing yeast.

[0051] In a specific embodiment, the expression vector is pPIC9K.

[0052] The pPIC9K plasmid is a plasmid used in the expression system of Escherichia coli, and is usually used to express foreign genes in Escherichia coli. pPIC9K contains a selection marker, which is mainly used to screen and maintain the presence of the plasmid in the culture medium of Pichia pastoris. A selection marker is a gene or DNA fragment that allows only cells with a specific plasmid to grow and reproduce. pPIC9K usually contains multiple cloning sites, allowing researchers to insert foreign genes of interest into it. These sites are usually located around some restriction enzyme cutting sites to facilitate the insertion of DNA fragments.

[0053] In a specific embodiment, the method for preparing the polypeptide is: codon optimization of the amino acid sequence or the polypeptide to obtain a nucleic acid sequence encoding the amino acid sequence or the polypeptide sequence; connecting the nucleic acid sequence with the vector pPIC9K to obtain a recombinant vector; electroporating the recombinant vector into Pichia pastoris GS115 to obtain a recombinant Pichia pastoris; inducing fermentation of the recombinant Pichia pastoris to obtain the polypeptide.

[0054] In a specific embodiment, the induced culture is induced culture using methanol.

[0055] In a specific embodiment, the fermentation medium used for induction culture includes BMGY medium, whose components include 20g / L peptone, 10g / L yeast extract, 13.4g / L YNB, 10g / L glycerol, and 0.1M KH2P04 / K2HP04 buffer with a pH of 6.0; BMMY medium, whose components include 20g / L peptone, 10g / L yeast extract, 13.4g / LYNB, 10g / L methanol, and 0.1MPH=6.0 KH2P04 / K2HP04 buffer.

[0056] In one embodiment, after the recombinant Pichia pastoris GS115 / pPIC9K is activated, it is transferred to 30 mL of BMGY medium, cultured at 30 ° C for 24 hours at a speed of 220 rpm, transferred to a sterile centrifuge tube, centrifuged at 5000 r / min for 5 minutes, and washed twice with sterile water. The obtained bacteria are resuspended in 30 mL of BMMY medium, cultured at 28 ° C for 4 days at a speed of 220 rpm, and methanol is added every 24 hours for induction, each time to a final concentration of 1% (v / v). After the induction is completed, the supernatant is collected by centrifugation at 8000 r / min for 5 minutes to obtain a crude extract.

[0057] In a specific embodiment, after obtaining the crude enzyme solution, it is necessary to purify the crude enzyme solution.

[0058] In a specific embodiment, the purification is performed using a Ni column.

[0059] Furthermore, an embodiment of the present application also provides use of the amino acid sequence or the polypeptide in preparing a moisturizer.

[0060] In some embodiments, use of the amino acid sequence or the polypeptide in preparing cosmetics is also provided.

[0061] The present application also provides a moisturizer, the moisturizer comprising the amino acid sequence as described above or the polypeptide as described above. In some embodiments, the moisturizer comprises the amino acid sequence as described above or one, two or more of the polypeptides as described above with moisturizing function.

[0062] The present application also provides a cosmetic, which comprises the amino acid sequence or the polypeptide as described above.

[0063] The present application extracts a polypeptide with high moisturizing performance composed of a repeated short amino acid sequence from sea cucumbers, and its hydrophilicity makes it have excellent moisturizing properties. The moisturizing rate of the sea cucumber polypeptide is significantly higher than that of glycerol under the same conditions, and the moisturizing rate can reach 90.9% when left to stand for 8 hours in an environment of 22°C and 40% humidity. And because it comes from natural sea cucumber components, it will not cause irritation or side effects to users when further making moisturizers and cosmetics containing the moisturizers.

[0064] Example

[0065] Example 1 Extraction of sea cucumber polypeptides

[0066] Fresh sea cucumber, remove the mouth, viscera and inner membrane, wash and crush, add 6 times the amount of ultrapure water, adjust the pH to 7.0, add 1% neutral protease, control the enzymatic hydrolysis at 27°C for 8 hours, heat the hydrolyzate at 100°C for 40 minutes, inactivate the enzyme, cool to room temperature, and obtain sea cucumber hydrolyzate; add 95% ethanol to the sea cucumber hydrolyzate until the ethanol volume fraction is 80%, let it stand for 12 hours, centrifuge at 10000rpm for 30 minutes, recover the ethanol in the supernatant, decolorize and remove the fishy smell of the sea cucumber polypeptide mixture through anion resin, and obtain the sea cucumber polypeptide extract. Use a dialysis bag to perform desalting at 4°C. Place the extract in liquid nitrogen for rapid freezing and drying to obtain sea cucumber polypeptide freeze-dried powder.

[0067] Determination of the molecular weight range of sea cucumber polypeptides: Take the above-mentioned sea cucumber polypeptide freeze-dried powder, dissolve it in 50% acetonitrile (0.1% TFA), centrifuge it at 10000rpm for 5min, and set it aside. Prepare 10mg / mL10mg / mL CHCA matrix solution containing 70% acetonitrile (0.1% TFA) before the experiment. During the experiment, take 1μL of the test sample and the matrix solution, mix them at 1:1, and use them as matrix-assisted laser desorption ionization (MALDI) targets. The MALDI-TOF mass spectrum is obtained on an AXIMA-CFPplus (KRATOS Analytical, Shimadzu Group Company) mass spectrometer equipped with a nitrogen laser (337.1nm). In the positive ion linear mode, the mass spectrum is obtained with an average of more than 100 emissions at an acceleration voltage of 20kV. Cytochrome C is used for external standard calibration at m / z66256.00 and 12328.00, and the mass measurement accuracy is about 50ppm.

[0068] Example 2 Screening of polypeptide sequences with moisturizing function

[0069] Take the sea cucumber polypeptide freeze-dried powder obtained in Example 1 and dissolve it in 1% formic acid solution. Use orbital ion trap mass spectrometer (Thermo, America) for analysis. The flow rate is 0.300μl / min, the analytical column is Acclaim PepMap RSLC column (75μm ID, 250mm length, C18), the mobile phase A is composed of 0.1% formic acid-water, and the mobile phase B is composed of 80% acetonitrile and 0.1% formic acid. Gradient elution conditions: 0-5min, 3% B; 5-80min, 22% B; 80-92min, 35% B; 92-103min, 90% B; 103-109min, 90% B; 109-110min, 3% B. The scanning range is 600-10000 m / z, and the resolution is 60000.

[0070] Screening of peptide sequences with moisturizing function: Orbitrap-MS analysis was performed on freeze-dried sea cucumber powder. By searching the corresponding ncbi sea cucumber protein database, a total of 327 peptide spectra, 74 proteins, 24 proteomes, and 197 peptides were obtained. The theoretical molecular weight of 98.98% of the peptides was between 800Da and 2000Da. The MS / MS spectra were searched according to the above selected sea cucumber protein database using the software byonic (version 3.2.0). GO analysis was performed on 74 proteins (Gene Ontology (GO) analysis was performed by the GO tool provided by the UniProt community (http: / / www.uniprot.org / )). 64 IDs were expressed, 8 molecular functions were obtained, 11 biological processes were involved, and 5 cellular components were present. The sea cucumber peptide sequence with moisturizing function was screened as TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK TIGLEVEPSDTIENGKTIGLEVEPSDTIENGK (Seq ID No.5).

[0071] The following examples will use the polypeptide with the sequence TIGLEVEPSDTIENGKTIGLEVEPSDTIENGK TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK (Seq ID No. 5) obtained in Example 2 as an experimental sample.

[0072] Example 3 Determination of the Moisturizing Performance of Sea Cucumber Peptide

[0073] Use a weighing bottle as a carrier to weigh 1 g of the polypeptide obtained in Example 2 (accurate to 0.0001 g), record the mass of the weighing bottle and the mass of the sample, place the sample in an environment with a temperature of 22±2°C and a humidity of 40±5%, weigh and record the data at regular intervals, calculate the moisture retention rate, and draw a change curve.

[0074] The formula for calculating the moisturizing rate is as follows:

[0075] Moisture retention rate (%) = (sample weight after standing / sample weight before standing) × 100%.

[0076] Comparative Example 1

[0077] The difference between this comparative example and Example 2 is that a 5% glycerol aqueous solution is used.

[0078] Experimental results analysis:

[0079] The statistical table of test results for 1h, 2h, 4h and 8h is shown in Table 1.

[0080] Table 1

[0081] Time / h Example 1 Moisture Retention Rate (%) Comparative Example 1 Moisturizing Rate (%) 1 98.9％ 98.4％ 2 96.7％ 96.1％ 4 93.6％ 93.4％ 8 90.9％ 90.2％

[0082] Example 4 Human Safety Test of Sea Cucumber Polypeptide

[0083] According to the "Technical Specifications for Safety of Cosmetics" (2015 edition), 40 subjects who met the criteria were screened, and the sequence obtained using Example 2 was TIGLEVEPSDTIENGK

[0084] TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK

[0085] The peptide of TIGLEVEPSDTIENGK (Seq ID No.5) was used as the experimental sample to carry out human patch test. The test results are shown in Table 2.

[0086] 0 pole Mild itching reaction Mild erythema 38 people 1 person 1 person

[0087] The results showed that among the 40 subjects, 38 were grade 0, meaning no reaction; 1 subject showed mild itching reaction, and 1 subject had mild erythema.

[0088] According to the test results, glycerol has excellent moisturizing properties, and the moisturizing rates of the sea cucumber polypeptide sequence obtained in Example 2 for 1h, 2h, 4h, and 8h are 98.9%, 96.7%, 93.6%, and 90.9%, respectively, which are better than the 5% glycerol aqueous solution used in Comparative Example 1, indicating that the moisturizing properties of the sea cucumber polypeptide sequence obtained in Example 2 are significantly better than the 5% glycerol aqueous solution under the same conditions. In addition, the sea cucumber polypeptide sequence obtained in Example 2 comes from natural sea cucumber components, and will not cause irritation to the user's skin when further making cosmetics, and can replace the glycerol component.

[0089] Example 5 Preparation of sea cucumber polypeptides using recombinant vectors

[0090] The culture medium involved in this embodiment is as follows:

[0091] BMGY liquid culture medium: its components include 20 g / L peptone, 10 g / L yeast extract, 13.4 g / L YNB, 10 g / L glycerol, and 0.1 M KH2PO4 / K2HPO4 buffer with a pH of 6.0.

[0092] BMMY liquid culture medium: Its components include 20 g / L peptone, 10 g / L yeast extract, 13.4 g / L YNB, 10 g / L methanol, and 0.1 M KH2PO4 / K2HPO4 buffer with a pH of 6.0.

[0093] YPD solid culture medium: its components include 20g / L peptone, 10g / L yeast extract, 20g / L glucose, and 20g / L agar powder.

[0094] BSM liquid culture medium: its components include 85% H3PO4 26.7 mL / L, CaSO42H2O 0.93 g / L, K2SO4 18.2 g / L, MgSO42H2O 14.9 g / L, KOH 4.13 g / L, glycerol 40 g / L, and PTM1 4.0 mL / L.

[0095] LB liquid culture medium: its components include 10g / L peptone, 5g / L yeast extract, and 10g / L NaCl.

[0096] The operation of the electric shock method involved in this embodiment is:

[0097] Mix the competent cells with the linearized DNA and transfer to an ice-cold electroporation cuvette. Tap the cuvette gently to ensure that the cells sink to the bottom.

[0098] (2) Apply electric shock to the electric shock cup.

[0099] (3) Immediately after the electric shock, add 1 mL of ice-cold sorbitol to the cup and transfer it to a 1.5 mL centrifuge tube.

[0100] (4) Place the centrifuge tube in a static culture at 28°C for 1 to 2 hours.

[0101] (5) Take 100 μL of cell solution and spread it evenly on the MD plate.

[0102] (6) Incubate the plate inverted at 28°C for 3 to 10 days until colonies appear.

[0103] (7) Screening was carried out on YPD medium containing 0.5 g / L, 2 g / L, 4 g / L, and 6 g / L of G418, respectively.

[0104] 5.1 Preparation of recombinant vector

[0105] Gene synthesis nucleotide sequence

[0106] ACTATTGGTTTGGAAGTTGAACCATCTGATACTATTGAAAACGGTAAG

[0107] ACTATTGGTTTGGAAGTTGAACCATCTGATACTATTGAAAACGGTAAG

[0108] ACTATTGGTTTGGAAGTTGAACCATCTGATACTATTGAAAACGGTAAG

[0109] ACTATTGGTTTGGAAGTTGAACCATCTGATACTATTGAAAACGGTAAG

[0110] The gene encoding the sea cucumber peptide derived from sea cucumber shown in ACTATTGGTTTGGAAGTTGAACCATCTGATACTATTGAAAACGGTAAGCATCATCATCATCATCATCAT (Seq ID No. 6) was constructed with the vector pPIC9K using a one-step cloning method to obtain a recombinant vector.

[0111] 5.2 Preparation of recombinant Pichia pastoris

[0112] The prepared recombinant plasmid was transformed into Pichia pastoris GS115 by electroporation to prepare recombinant Pichia pastoris;

[0113] 5.3 Production of sea cucumber polypeptides by shake flask fermentation of recombinant strains

[0114] The prepared recombinant Pichia pastoris was cultured in a YPD solid medium in a 30°C incubator for 3 days to obtain a single colony; the single colony was inoculated into 30 mL of BMGY liquid medium, and cultured at 30°C for 24 hours at a speed of 220 rpm to prepare a fermentation broth; the prepared fermentation broth was placed in a sterile centrifuge tube, centrifuged at 5000 r / min for 5 minutes, the precipitate was taken and washed twice with sterile water to obtain the bacterial body, the bacterial body was resuspended in 30 mL of BMMY liquid medium, and cultured at 28°C for 4 days at a speed of 220 rpm, and methanol was added every 24 hours for induction, and each time the final concentration was 1% (v / v). After the induction, the supernatant was collected by centrifugation at 8000 r / min for 5 minutes to obtain a crude enzyme solution.

[0115] The crude enzyme solution was subjected to SDS polyacrylamide gel electrophoresis.

[0116] Detection of sea cucumber peptide content:

[0117] The content of sea cucumber peptide was determined by high performance liquid chromatography: Waters, Agilent C18 column, the mobile phase was 10:90 methanol:0.1% formic acid, and the flow rate was 1 mL / min.

[0118] This embodiment constructs a recombinant strain capable of heterologously expressing sea cucumber peptides, and utilizes the recombinant strain to ferment and produce sea cucumber peptides, thereby achieving rapid and large-scale production of a single product of sea cucumber peptides.

[0119] The above is only a preferred embodiment of the present application and does not limit the present application in any form. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment based on the technical essence of the present application without departing from the content of the technical solution of the present application still falls within the protection scope of the technical solution of the present application.

Claims

1. A polypeptide having a moisturizing function, wherein: The amino acid sequence of the polypeptide is TIGLEVEPSDTIENGKTIGLEVEPSDTIENGK TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK TIGLEVEPSDTIENGK (Seq ID No. 5).

2. The polypeptide according to claim 1, wherein the polypeptide is derived from sea cucumber.

3. A nucleic acid sequence encoding the polypeptide of claim 1.

4. A method for preparing a polypeptide, wherein: The polypeptide is the polypeptide according to claim 1.

5. The method according to claim 4, wherein: include: The polypeptide is obtained by expressing and purifying Pichia pastoris, wherein the Pichia pastoris carries an expression vector comprising the nucleic acid sequence of claim 4.

6. The method according to claim 5, wherein: The Pichia pastoris is Pichia pastoris GS115, and preferably the expression vector is pPIC9K.

7. Use of the polypeptide according to claim 1 or the polypeptide prepared by the method according to any one of claims 4 to 6 in the preparation of a moisturizer.

8. Use of the polypeptide according to claim 1 or the polypeptide prepared by the method according to any one of claims 4 to 6 in the preparation of cosmetics.

9. A moisturizing agent comprising the polypeptide according to claim 1 or a polypeptide prepared by the method according to any one of claims 4 to 6.

10. A cosmetic comprising the polypeptide according to claim 1 or a polypeptide prepared by the method according to any one of claims 4 to 6.

Images