An engineered circRNA encoding NGF protein, a pharmaceutical composition, and a preparation method and application thereof

Abstract

The present invention discloses an engineered circRNA encoding NGF protein, a pharmaceutical composition, and a preparation method and application thereof. The engineered circRNA encoding nerve growth factor (NGF) has the advantages of enhancing the stability and expression efficiency of NGF. By packaging the engineered circRNA in nanolipid particles (LNP), effective drug delivery and release can be achieved. The pharmaceutical composition can be applied by topical administration, gastrointestinal administration or parenteral administration to provide neuroprotection and treatment of nerve damage. A single administration has a significant neuroprotective effect, does not require continuous administration, and avoids the risk of viral infection of animal-derived proteins. Compared with viral gene delivery, one advantage of circRNA-based therapy is that mRNA will not be transported to the cell nucleus, thereby reducing the risk of sequence insertion into the genome and inducing carcinogenesis.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and more specifically, to an engineered circRNA encoding NGF protein, a pharmaceutical composition, and a preparation method and application thereof. Background Art

[0002] Nerve growth factor (NGF), also known as NGF protein, is widely used clinically to treat optic nerve damage, keratitis, etc. However, existing animal-derived NGF proteins have the risk of prion infection, the recombinant protein fermentation process and purification process are expensive, and require daily intramuscular injections, which brings great pain to patients.

[0003] circRNA is a type of closed RNA without 5' or 3' ends. For a long time, it was considered to be a byproduct of rare and abnormal splicing of the 5' splice junction with the upstream 3' splice junction. Recently, due to the rapid development of high-throughput RNA sequencing and bioinformatics analysis, a large number of biological functions of natural circRNAs have been revealed, ranging from protein and gene sponges, cell activity regulators to protein translation templates. In addition, as people's understanding of the physiological functions of natural circRNAs continues to deepen, in recent years, people have become increasingly interested in developing circRNA synthesis technology and exploring the application of synthetic circRNAs in disease treatment. So far, synthetic circRNAs have not only been used for treatment, such as replacement of therapeutic proteins and peptides and vaccines, but also as biosensors. At the same time, in order to optimize the therapeutic effect while reducing side effects, various methods have been tried to synthesize circRNA. Previously, circRNAs were mainly considered to be non-coding RNAs, but recent studies have shown that they can encode and translate proteins and peptides through natural circRNAs and synthetic circRNAs. CircRNA has its unique advantages in the development of vaccines and nucleic acid drugs. First, it is less prone to degradation and is more stable than mRNA vaccines and nucleic acid drugs. Secondly, the amount required for rolling circle translation is lower than that of messenger RNA, so it is less toxic. The covalently closed ring structure surrounded by circRNAs can protect it from degradation by nucleases and can address the vulnerability of mRNA vaccines to degradation. These properties give circRNA great potential as a peptide / protein replacement therapy and vaccine. However, there are no reports on engineered circRNAs for NGF protein. Summary of the invention

[0004] The purpose of the present invention is to overcome the above-mentioned defects and deficiencies in the prior art and provide a nucleic acid that promotes the formation of an engineered circRNA encoding NGF protein.

[0005] The second object of the present invention is to provide a recombinant expression vector containing the nucleic acid

[0006] The third object of the present invention is to provide a recombinant bacterium containing the recombinant expression vector.

[0007] The fourth object of the present invention is to provide a method for preparing an engineered circRNA encoding NGF protein.

[0008] The fifth object of the present invention is to provide an engineered circRNA encoding NGF protein prepared by the above preparation method.

[0009] The sixth object of the present invention is a lipid nanoparticle encapsulated with the engineered circRNA encoding the NGF protein.

[0010] The seventh object of the present invention is a method for preparing the lipid nanoparticles.

[0011] The eighth object of the present invention is the application of the engineered circRNA encoding NGF protein or the lipid nanoparticles.

[0012] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0013] A nucleic acid that promotes the formation of an engineered circRNA encoding NGF protein, which has the following structure: 5'→3' is in sequence an in vitro transcription promoter-3' type I intron and 3' homology arm-exon sequence E1-spacer sequence (Spacer) 1-internal ribosome entry site (IRES)-NGF protein coding sequence-spacer sequence (Spacer) 2-exon sequence E2-5' type I intron and 5' homology arm; the NGF protein coding sequence is a CDS sequence encoding human or mouse NGF, and its nucleotide sequence is shown in SEQ ID NO.2 or SEQ ID NO.4, respectively.

[0014] The nucleic acid of the present invention can be based on the self-splicing of type I introns, and can promote the cyclization of circRNA under the catalysis of GTP (guanosine). In order to further improve the cyclization efficiency of self-splicing precursor RNA, the homology arm and spacer sequence in its sequence structure can solve the problem of cyclization of long coding RNA sequences and obtain better cyclization efficiency.

[0015] Furthermore, the in vitro transcription promoter is T7, T3 or SP6 promoter.

[0016] Preferably, the in vitro transcription promoter is a T7 promoter.

[0017] Furthermore, the 3'-type I intron and 3'-homology arm-exon sequence E1, and the exon sequence E2-5'-type I intron and 5'-homology arm are derived from Anabaena.

[0018] Furthermore, the exon sequence E1 is AAAATCCGTTGACCTTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCA, and the exon sequence E2 is AGACGCTACGGACTT.

[0019] Further, the spacer sequence 1 is CGCCGGAAACGCAATAGCCGAAAAACAAAAAACAAAAAAAACAAAAAA AAACCAAAAAAACAAAACACA; and the spacer sequence 2 is AAAAAACAAAAAACAAAACGGCTATTATGCGTTACCGGCG.

[0020] Furthermore, the internal ribosome entry site is the internal ribosome entry site IRES of Coxsackievirus B3.

[0021] Furthermore, the NGF protein coding sequence is a sequence of the CDS sequence of human NGF after codon optimization, and its nucleotide sequence is shown in SEQ ID NO.6.

[0022] Furthermore, a protein tag sequence is connected to the 3' end of the NGF protein coding sequence.

[0023] Preferably, the protein tag sequence is 3×FLAG.

[0024] Furthermore, a restriction site is inserted between the NGF protein coding sequence and two adjacent components, which can be used for gene replacement and save costs.

[0025] Furthermore, the sequence of the nucleic acid is shown as SEQ ID NO.1 or SEQ ID NO.11 or SEQ ID NO.12.

[0026] The present invention also provides a recombinant expression vector containing any of the above-mentioned nucleic acids.

[0027] The present invention also provides a recombinant bacterium containing the recombinant expression vector.

[0028] The present invention also provides a method for preparing an engineered circRNA encoding NGF protein, comprising the following steps:

[0029] S1. synthesizing any of the above-mentioned nucleic acid sequences;

[0030] S2. Connect the nucleic acid sequence of step S1 to the basic plasmid template, transform the host bacteria, extract the plasmid, and obtain the transcription template;

[0031] S3. Linearize the transcription template in step S2, transcribe it in vitro, digest it to remove DNA, precipitate it to obtain the circRNA precursor, add GTP to incubate it to achieve circularization, and then purify it to obtain the circularized RNA, that is, the engineered circRNA encoding the NGF protein.

[0032] Furthermore, the sequence of the circRNA precursor is shown in SEQ ID NOs: 8-10.

[0033] Further, the purification in step S3 is to digest and purify the circularized circRNA using an RNA purification kit and RNaseR enzyme. The purified circRNA is dissolved in an acidic sodium citrate buffer and purified using HPLC, and the second peak product of HPLC is collected and purified using an RNA purification kit.

[0034] The present invention also provides an engineered circRNA encoding NGF protein prepared by the preparation method.

[0035] The present invention also provides a lipid nanoparticle (LNPs) encapsulating the engineered circRNA encoding the NGF protein.

[0036] The present invention also provides a method for preparing the lipid nanoparticles, which comprises mixing the engineered circRNA encoding the NGF protein with a cationic or polycationic compound and then packaging the mixture with lipids.

[0037] Preferably, the lipids include, but are not limited to, lipids that can promote self-assembly to form virus-sized particles (~100 nm), lipids that release circRNA from endosomes into cells, lipids that support phospholipid bilayer structures, or lipids used as stabilizers. More preferably, in order to increase the half-life of LNP, the lipids may also include PEGylated lipids.

[0038] The advantages of the circRNA or lipid nanoparticles containing circRNA described in the present invention are: 1. In vitro synthesis, no cell culture required, and no risk of animal-derived contamination; 2. Fast research and development and production, standardized production, easy mass production and quality control, and the same production process is applicable to multiple different products; 3. Continuous expression over a period of time; 4. Support for multiple protein forms, including intracellular proteins, transmembrane proteins, VLPs, etc., and can avoid purification problems caused by low VLP yields; 5. No infection or genome integration risks.

[0039] The present invention shows that the engineered circRNA encoding NGF protein or the lipid nanoparticles (LNPs) have the effect of neuroprotection and treatment of nerve damage. Therefore, the present invention also provides the use of the engineered circRNA encoding NGF protein or the lipid nanoparticles (LNPs) in the preparation of a drug for preventing and / or treating nerve damage and / or neurodegenerative diseases.

[0040] "Prevention" as used in the present invention refers to all actions to avoid symptoms or delay the onset of specific symptoms by administering the product described in the present invention before or after the onset of the disease.

[0041] As used herein, "treatment" refers to therapeutic intervention to improve the signs, symptoms, etc. of a disease or pathological condition after the disease has begun to develop.

[0042] Compared with the prior art, the present invention has the following beneficial effects:

[0043] The present invention provides an engineered circRNA encoding NGF protein and lipid nanoparticles encapsulating the engineered circRNA, wherein the engineered circRNA encoding nerve growth factor (NGF) has the advantages of enhancing the stability and expression efficiency of NGF. By packaging the engineered circRNA in nanolipid particles (LNP), effective drug delivery and release can be achieved. The pharmaceutical composition can be applied by topical administration, gastrointestinal administration or parenteral administration to provide neuroprotection and treatment of nerve damage. A single administration has a significant neuroprotective effect, does not require continuous administration, and avoids the risk of viral infection of animal-derived proteins. Compared with viral gene delivery, one advantage of circRNA-based therapy is that mRNA will not be transported to the nucleus, thereby reducing the risk of sequence insertion into the genome and thus inducing carcinogenesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Schematic diagram of the linear RNA and circular RNA structure encoding NGF protein.

[0045] Figure 2 This is the sequencing result of the sequence encoding wild-type mouse NGF recombinant protein.

[0046] Figure 3 This is the sequencing result of the sequence encoding the wild-type human NGF protein.

[0047] Figure 4 This is the sequencing result of hNGF-MAhek2, the sequence encoding the optimized human NGF protein.

[0048] Figure 5 Detection of circular RNA preparation products.

[0049] Figure 6 The cyclized product was purified by HPLC.

[0050] Figure 7 To optimize the expression of hNGF sequence protein before and after.

[0051] Figure 8 The WB detection results of cell lysate of cells transfected with circ-mNGF.

[0052] Fig. 9 The neuroprotective effect of LNP-circNGF. DETAILED DESCRIPTION

[0053] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0054] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0055] Example 1 Preparation and detection of engineered circRNA encoding NGF protein

[0056] 1. Figure 1 Schematic diagram of the linear RNA and circular RNA structure encoding NGF protein of the present invention. Specifically, the gene sequence of chemically synthesized circ-CVB3-mNGF-3xFlag has a sequence structure of: T7promoter+(3'intron+homology)+E1+spacer1+CVB3+mNGF-3xFlag+spacer2+E2+(5'intron+homology). The specific sequence is as shown in SEQ As shown in IDNO.1; among them, 1-19nt is T7 promoter, 20-183nt is (3'intron+homology), 184-234nt is E1, 235-304nt is spacer1, 305-1045nt is CVB3, 1046-2062nt is mNGF-3xFlag, 2063-2102nt is spacer2, 2103-2117nt is E2, and 2118-2268nt is (5'intron+homology); after ring formation, it is E1+spacer+CVB3+mNGF-3xFlag+spacer2+E2.

[0057] In addition, the above-mentioned wild-type mouse NGF (mNGF) sequence was replaced with wild-type human NGF (hNGF) or optimized human NGF (hNGF-MAhek3) to obtain Circ-CVB3-hNGF-3xflag (the specific sequence is shown in SEQ ID NO.11) and Circ-CVB3-hNGF-MAhek3-3xflag (the specific sequence is shown in SEQ ID NO.12).

[0058] 2. Synthesize short nucleotide chains (primers) by solid phase phosphoramidite triester method, the primers are as follows:

[0059] primer1(F): gctagc TAATACGACTCACT, where " gctagc ” is the NheⅠ restriction site;

[0060] Primer2(R): AAGCTT CTAGATATGCTGTT, where " AAGCTT " is the Hind III restriction site.

[0061] 3. Using the gene sequence synthesized in step 1 as a template, perform PCR amplification using the primers synthesized in step 2.

[0062] 4. Connect the product amplified in step 3 to the pUC57 vector and transform it for sequencing.

[0063] 5. The results were verified by sequencing. Figure 2-4 Specifically, Figure 2 The sequencing results of the sequence encoding the wild-type mouse NGF recombinant protein containing a signal peptide are shown, and the nucleotide sequence is shown in SEQ ID NO: 2, and the amino acid sequence is shown in SEQ ID NO: 3. Figure 3 The sequencing results of the sequence encoding the wild-type human NGF protein are shown, and its nucleotide sequence is shown in SEQ ID NO: 4, and its amino acid sequence is shown in SEQ ID NO: 5. Figure 4 The sequencing results of the sequence hNGF-MAhek2 encoding the optimized human NGF protein are shown, and its nucleotide sequence is shown in SEQ ID NO: 6, and its amino acid sequence is shown in SEQ ID NO: 7, indicating that the sequence is consistent with expectations.

[0064] 6. Use shake flask fermentation strains and purify the transcription template using an endotoxin-free plasmid extraction kit. Linearize the transcription template with restriction endonuclease BbsI. Transcribe with a T7 in vitro transcription kit to obtain the mRNA of the transcribed precursor shown in SEQ ID NO: 8-10. Digest the transcription template with DNaseI and purify the circRNA precursor by precipitation. Circularize the circRNA with GTP, and digest and purify the circularized circRNA with an RNA purification kit and RNaseR enzyme, respectively ( Figure 5 The purified circRNA was dissolved in acidic sodium citrate buffer and purified by HPLC ( Figure 6 ), collect the second peak product (F2) by HPLC, and purify it using an RNA purification kit.

[0065] Use formaldehyde denaturing gel to detect RNA at each stage, such as Figure 6 As shown, F2 is the successfully circularized circNGF, and it can be seen that the RNA is of the correct size and is basically not degraded.

[0066] Example 2 Comparison of hNGF sequence protein expression efficiency before and after optimization

[0067] circ-hNGF and circ-hNGF-MAhek2 circular RNA were transfected into hek293 cells, and the supernatant was taken for ELISA. Figure 7 As shown, the protein expression level of circ-hNGF-MAhek2 was higher than that of circ-hNGF.

[0068] Example 3 Preparation of mRNA Drugs

[0069] 1. Raw material preparation

[0070] 1) The cationic lipid SM-102, distearoylphosphatidylcholine DSPC, cholesterol, and PEGylated lipid PEG-DMG are dissolved and mixed in ethanol at a molar ratio of 50:10:38.5:1.5.

[0071] 2) Provide the circRNA encoding mNGF (circ-mNGF) prepared in Example 1.

[0072] 2. Expression detection

[0073] HEK293 cells were plated in 6-well plates and transfected with 0.5 μg of circRNA encoding NGF (circ-mNGF) after circularization and purification using lipofectamine. For the negative control, only lipofectamine messagerMax transfection reagent was added. After 6h, 12h, 24h, 48h, and 72h of transfection, cell lysates were taken for WB detection. The WB detection results are shown in the figure. Figure 8 As shown in the figure, it can be seen that the expressed protein is of the correct size and can be expressed continuously for 48 hours.

[0074] 3. Preparation of circRNA lipid nanoparticles

[0075] The lipid mixture in step 1:circRNA was mixed and packaged in the Benchtop nanoparticle preparation instrument of Precision Nanosystems at a flow rate ratio of 1:3. The packaged circRNA-LNP was dialyzed and ultrafiltered into DPBS, and the sample for animal experiment was obtained after sterile filtration. The average particle size of the packaged sample was 78.83nm, the PDI value was 0.028, and the intercept was 0.953.

[0076] Example 4 Neuroprotective Effect Test

[0077] 1. Methods

[0078] C57 male mice about 6 weeks old were intravitreally injected with 200 ng of circRNA-LNP prepared in Example 3 on day 0, and ONC surgery was performed on day 4. The mice were killed on day 18, and retinal flat mounts were obtained and stained with RBPMS antibody. GCL was photographed under a confocal microscope, and RBPMS+ cells were counted.

[0079] 2. Experimental results

[0080] The RGC counting results are as follows Fig. 9 As shown, the number of RGCs in a single field of view of normal mice is about 350, the number of RGCs in a single field of view after ONC injury is about 60, the number of RGCs injected with NGF protein is about 90, and the number of RGCs in a single field of view of mice injected with circRNA-LNP drugs after ONC injury is about 140, and the number of surviving RGCs is twice that of the non-drug group, indicating that the engineered circRNA of NGF protein has a better effect in preventing / treating nerve injury and / or neurodegenerative diseases than NGF protein.

Claims

1. A nucleic acid that promotes the formation of an engineered circRNA encoding NGF protein, characterized in that: It has the following structure: 5'→3' is in sequence: in vitro transcription promoter-3' end type I intron and 3' end homology arm-exon sequence E1-spacer sequence 1-internal ribosome entry site-NGF protein coding sequence-spacer sequence 2-exon sequence E2-5' end type I intron and 5' end homology arm; the sequence of the nucleic acid is shown in SEQ ID NO.1 or SEQ ID NO.11 or SEQ ID NO.

12.

2. A recombinant expression vector containing the nucleic acid of claim 1.

3. A recombinant bacterium containing the recombinant expression vector according to claim 2.

4. A method for preparing an engineered circRNA encoding NGF protein, characterized in that: The steps include: S1. Synthesizing the nucleic acid sequence of claim 1; S2. Connect the nucleic acid sequence of step S1 to the basic plasmid template, transform the host bacteria, extract the plasmid, and obtain the transcription template; S3. Linearize the transcription template in step S2, transcribe it in vitro, digest it to remove DNA, precipitate it to obtain the circRNA precursor, add GTP to incubate it, achieve circularization, and purify it to obtain the circularized RNA, that is, obtain the engineered circRNA encoding the NGF protein.

5. The engineered circRNA encoding NGF protein prepared by the preparation method according to claim 4.

6. A lipid nanoparticle, characterized in that: Encapsulated with the engineered circRNA encoding NGF protein as claimed in claim 5.

7. The method for preparing lipid nanoparticles according to claim 6, characterized in that: The engineered circRNA encoding NGF protein according to claim 5 is mixed with a cationic or polycationic compound and then packaged with lipids to obtain the product.

8. Use of the engineered circRNA encoding NGF protein according to claim 5 or the lipid nanoparticles according to claim 6 in the preparation of a drug for preventing and / or treating nerve damage and / or neurodegenerative diseases.

Images