Method for biosynthesis of human structural material type XVII collagen

Abstract

Provided are methods of biosynthesizing human structural collagen XVII. The collagen of the present application comprises an amino acid sequence set forth in SEQ ID NO: 2 or a variant amino acid sequence that is mutated from the amino acid sequence set forth in SEQ ID NO: 2, the variant amino acid sequence retaining the function of the amino acid sequence set forth in SEQ ID NO: 2. The collagen of the present application is capable of promoting cell adhesion and has a triple helix structure.

Description

Technical Field

[0001] This application relates to the field of proteins or peptides, and more specifically to collagen, its preparation methods and uses. Background Technology

[0002] Collagen is a type of protein widely distributed in human connective tissue and is the most abundant protein in the human body, accounting for 25% to 35% of total protein. Its main functions include maintaining the extracellular environment, preserving the normal physiological functions of tissues and organs, and repairing bodily damage. Collagen is a natural biological resource with biocompatibility, cell support elasticity, and biodegradability unmatched by other polymers. Therefore, collagen has wide applications in the pharmaceutical and cosmetic industries.

[0003] Natural collagen molecules can form a special superhelical structure, which is a left-handed helix with three amino acid residues as basic repeaters, usually Gly-XY. Gly is essential for the formation of hydrogen bonds in collagen. It itself has no side chains to allow collagen to stack tightly, maintaining skin tension and elasticity.

[0004] In recent years, with the widespread application of genetic engineering technology, researchers have created various types of recombinant collagen. For example, recombinant collagen can be constructed by selecting short amino acid sequences from natural human collagen. Recombinant collagen constructed in this way has advantages such as low immunogenicity, high bioactivity, and good stability. Theoretically, the shorter the amino acid sequence of this recombinant collagen, the better its transdermal absorption performance. However, shorter amino acid sequences are not always better. How to design short amino acid sequences to achieve better transdermal absorption performance in the constructed recombinant collagen remains a theoretical challenge, lacking any existing theoretical guidance.

[0005] Type XVII collagen (COL17) is a transmembrane protein primarily expressed in epidermal basal keratinocytes. Epidermal-dermal adhesion requires COL17 expression on hemidesmosomes in the epidermal basement membrane region, as congenital COL17 deficiency leads to junctional bullous epidermolysis. In addition to promoting epidermal-dermal adhesion, COL17 serves as a niche for hair follicle stem cells, regulates interfollicular epidermal proliferation, and is present along the non-hemidemembrane membrane of epidermal basal keratinocytes. COL17 plays a crucial role in stem cell maintenance and is associated with signaling pathways, maintaining stable adhesion between the dermis and epidermis. The function and stability of collagen depend on the triple helix formation of different polypeptide chains. The formation of triple helix structures is thought to depend on specific triple helix regions. However, little is known about the physiological relevance of these coiled helical structures. COL17 and other members of the membrane-associated collagen subfamily undergo triple helix assembly from the N-terminus (proximal membrane) to the C-terminus.

[0006] There is a need in this field for new type XVII collagen and its preparation methods. Summary of the Invention

[0007] To address current needs, the inventors have provided a novel type XVII collagen. This type XVII collagen exhibits cell adhesion-promoting properties and possesses a triple helix structure. The invention also provides a method for biosynthesizing type XVII collagen, a structural material for the human body.

[0008] In a first aspect, a collagen protein is provided comprising a plurality of repeating units, each repeating unit comprising an amino acid sequence represented by SEQ ID NO:1 or an amino acid sequence in which one or more amino acid residues have been mutated in the amino acid sequence represented by SEQ ID NO:1; the number of repeating units is 10-20, 12-18 or 13-16.

[0009] In one implementation, the number of repeating units is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.

[0010] In one embodiment, the repeating units are directly linked or linked via a linker consisting of one or more amino acid residues. In one embodiment, the linker comprises 2, 3, 4, 5, 6, 7, or 8 amino acid residues.

[0011] In one implementation, the mutation is a substitution, insertion, deletion, or addition. In one implementation, the substitution is a conserved amino acid substitution.

[0012] In one embodiment, the collagen is derived from human tissue. In one embodiment, the collagen has a triple helix structure. In one embodiment, the collagen has cell adhesion properties. In one embodiment, the collagen is recombinant collagen, recombinant humanized collagen, or recombinant humanized type XVII collagen.

[0013] In one embodiment, collagen comprises the following amino acid sequence:

[0014] (1) The amino acid sequence shown in SEQ ID NO: 2;

[0015] (2) An amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 2; or

[0016] (3) An amino acid sequence in which one or more amino acid residues have been mutated in the amino acid sequence shown in SEQ ID NO: 2.

[0017] In one implementation, the mutation is a substitution, insertion, deletion, or addition. In one implementation, the substitution is a conserved amino acid substitution.

[0018] In the second aspect, nucleic acids are provided that encode the collagen described herein.

[0019] In one embodiment, the nucleic acid has the nucleotide sequence shown in SEQ ID NO: 3.

[0020] In a third aspect, a vector is provided that comprises a nucleic acid as described herein. In one embodiment, the vector comprises a nucleotide encoding a purification tag, a nucleotide encoding a leader, and / or a regulatory element.

[0021] In one implementation, the purification tag is selected from His tag, GST tag, MBP tag, SUMO tag, or NusA tag.

[0022] In one embodiment, the regulating element is selected from promoters, terminators, and / or enhancers.

[0023] In the fourth aspect, a host cell is provided, which contains the nucleic acid or the vector described herein.

[0024] In one embodiment, the host cell is a eukaryotic or prokaryotic cell. In one embodiment, the eukaryotic cell is a yeast cell, animal cell, and / or insect cell, and / or the prokaryotic cell is an Escherichia coli cell, such as Escherichia coli BL21.

[0025] In the fifth aspect, methods for producing collagen are provided, including:

[0026] (1) Culture the host cells described herein under suitable culture conditions;

[0027] (2) Harvesting host cells and / or culture medium containing collagen; and

[0028] (3) Purifying collagen, for example, including (1) crude collagen purification on a Ni affinity chromatography column; (2) collagen tool digestion; and / or (3) ion exchange column purification of collagen.

[0029] In a sixth aspect, compositions are provided comprising the collagen, nucleic acid, carrier, and / or host cell described herein.

[0030] In one embodiment, the composition is a pharmaceutical composition or a cosmetic composition.

[0031] In one embodiment, the composition is one or more of the following: bio-dressings, human biomimetic materials, plastic and cosmetic materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection filling materials, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials and pharmaceutical excipients.

[0032] In one embodiment, the composition comprises a pharmaceutically and / or cosmetically acceptable carrier.

[0033] In one embodiment, the composition is a solid, liquid, or gel composition.

[0034] In one embodiment, the composition is an oral and / or topical composition, preferably an ointment composition.

[0035] In one embodiment, the composition is a kit.

[0036] In one embodiment, the composition is a liquid formulation comprising the collagen described herein and a pharmaceutically and / or cosmetically acceptable carrier.

[0037] In one implementation, the carrier is a buffer, such as D-PBS buffer or PBS buffer.

[0038] In a seventh aspect, a method for promoting cell adhesion or fixation is provided, the method comprising contacting the cells with the collagen and / or composition herein.

[0039] In the eighth aspect, the uses of the collagen, nucleic acids, carriers, host cells and / or compositions described herein are provided in bio-dressings, biomimetic materials, plastic and cosmetic materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection fillers, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials or 3D printed artificial organ biomaterials.

[0040] In a ninth aspect, the use of the collagen and / or compositions described herein in the preparation of medicaments or kits for promoting cell adhesion or cell fixation is provided.

[0041] The advantages of this invention include: the collagen described herein is a novel humanized type XVII collagen, which has the effect of promoting cell adhesion and has a triple helix structure; the recombinant humanized collagen C17T15 described herein has higher (more than 2 times) cell adhesion activity than bovine type I collagen, achieving unexpected technical effects. Attached Figure Description

[0042] Figure 1Electrophoretic image of recombinant humanized type XVII collagen C17T15 is shown.

[0043] Figure 2 The mass spectrum of recombinant humanized type XVII collagen C17T15 is shown.

[0044] Figure 3 Cell adhesion of recombinant humanized type XVII collagen C17T15 was demonstrated.

[0045] Figure 4 The circular dichroism chromatogram of recombinant humanized type XVII collagen C17T15 is shown.

[0046] Figure 5 The cell viability of recombinant humanized type XVII collagen C17T15 in HeLa cells was demonstrated. Detailed Implementation

[0047] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions in the embodiments of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0048] As used herein, recombinant humanized collagen is a full-length or partial amino acid sequence fragment encoded by a sex-specific gene of human collagen, prepared using DNA recombination technology, or a combination containing functional fragments of human collagen. In this article, recombinant humanized collagen is recombinant humanized type XVII collagen, which is a peptide or polypeptide consisting of multiple amino acid residues linked by peptide bonds.

[0049] As used herein, “one or more” can be any suitable integer. In the case of collagen mutations (e.g., substitution, deletion, insertion, or addition), “one or more” is a number readily determined by those skilled in the art, such as 1-90 and any integers and ranges therebetween, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, or 39, etc.

[0050] As used herein, "nucleic acid" refers to a plurality of nucleotides linked together by nucleotides. The nucleotide linkages can be, for example, phosphodiester bonds. The nucleic acids described herein may comprise polynucleotides encoding the polypeptides of the present invention. To facilitate subsequent processing of the polypeptides, the nucleic acids of the present invention may also comprise nucleotides encoding purification tags, such as His tags, GST tags, MBP tags, SUMO tags, or NusA tags, and, when necessary, nucleotide sequences encoding a leader sequence.

[0051] As used herein, the term "vector" is a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When a vector enables the expression of a protein encoded by the inserted polynucleotide, it is called an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material elements they carry to be expressed in the host cells. Vectors are well known to those skilled in the art and include, but are not limited to: plasmids; phage particles; Cos plasmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC); bacteriophages such as λ phage or M13 phage, and animal viruses. Vectors may contain various elements controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, vectors may contain a replication initiation site. Vectors may contain the nucleic acids of this invention for introduction into cells for expression. Vectors may contain expression control elements operatively linked to the nucleic acids, such as promoters, terminators, and / or enhancers.

[0052] As used herein, the term "host cell" refers to a cell into which nucleic acid molecules have been introduced using molecular biology techniques. These techniques include transfection with viral vectors, transformation with plasmid vectors, and accelerated introduction of naked DNA via electroporation, lipid transfection, and particle gun techniques. Host cells can be eukaryotic or prokaryotic cells. For example, eukaryotic cells include yeast cells, animal cells, and / or insect cells. Prokaryotic cells can be E. coli cells.

[0053] As used in this article, "bio-dressing" is a new type of medical dressing used for wound repair and treatment. It is a special medical material made by professionals using biomaterials and combined with drugs or other therapeutic substances. The collagen in bio-dressing forms a protective layer on the wound surface, promoting cell proliferation and regeneration, and accelerating wound healing.

[0054] As used in this article, "bionic materials" refers to materials developed by imitating various characteristics or properties of living organisms. Generally, artificial materials designed and manufactured in accordance with the operational patterns of living systems and the structural principles of biological materials are called biomimetic materials. "Human biomimetic materials" refers to materials developed by imitating various characteristics or properties of the human body. Generally, artificial materials designed and manufactured in accordance with the operational patterns of living systems and the structural principles of biological materials are called biomimetic materials.

[0055] As used in this article, "organoid culture material" refers to artificial materials used to culture and construct organoid functions to address the needs of organ transplantation and replacement.

[0056] As used in this article, "biomaterials" refers to materials that are compatible with living tissues and are typically used to manufacture artificial organs or replacement tissues. "3D-printed artificial organ biomaterials" refers to biomaterials used in 3D-printed artificial organs.

[0057] As used herein, the degree of association between two amino acid sequences or two nucleotide sequences is described by the parameter “sequence identity”. For the purposes of this invention, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) implemented by the Needleman program in the EMBOSS software package (EMBOSS: European Open Software Suite for Molecular Biology, Rice et al., 2000, Trends Genet. 16: 276-277) (preferably version 5.0.0 or later) is used to determine the sequence identity between two amino acid sequences. The parameters used are a vacancy opening penalty of 10, a vacancy extension penalty of 0.5, and an EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needleman labeled “longest identity” (obtained using the non-simplification option) is used as the identity percentage and calculated as follows:

[0058] (Identical residues × 100) / (Alignment length - Total number of vacancies in the alignment)

[0059] For the purposes of this invention, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, ibid.) implemented by the Niedle program in the EMBOSS software package (EMBOSS: European Molecular Biology Open Software Suite, Rice et al., 2000, ibid.) (preferably version 5.0.0 or later) is used to determine sequence identity between two deoxynucleotide sequences. The parameters used are a vacancy opening penalty of 10, a vacancy extension penalty of 0.5, and an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The Niedle output labeled “Longest Identity” (obtained using the non-simplification option) is used as the identity percentage and calculated as follows:

[0060] (Identical deoxyribonucleotides x 100) / (Alignment length - Total number of vacancies in the alignment)

[0061] In the context of this invention, a conserved amino acid substitution or conservative substitution may be defined by substitution within one or more amino acid categories reflected in one or more of the following tables:

[0062] Conserved amino acid residues:

[0063]

[0064] Physical and functional classification of the alternative amino acid residues:

[0065]

[0066] Recombinant humanized type XVII collagen

[0067] In this document, the recombinant humanized type XVII collagen of the present invention may contain certain mutations. For example, one or more amino acid sequences in these portions may have substitutions, deletions, additions, or insertions of amino acid residues. That is, the present invention may use variants, as long as the variants retain the activity of promoting cell adhesion and / or proliferation. Specifically, the variants may have a certain percentage identity with the specified sequence, for example, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity. The specified sequence may be any sequence of the present invention, such as SEQ ID NO: 1 or 2, but preferably these variants retain the function of the recombinant humanized type XVII collagen of the present invention. The recombinant humanized type XVII collagen of the present invention can have good cell adhesion efficacy and has a triple helix structure.

[0068] The recombinant humanized type XVII collagen of the present invention can be prepared by any suitable method, such as by synthesis. Preferably, the recombinant humanized type XVII collagen of the present invention can be prepared by recombinant methods.

[0069] The collagen of this invention can have a triple-helix structure region, that is, collagen in the form of a triple-helix structure, i.e., having three identical collagen chains. For example, collagen has a flexible triple-helix structure region. The collagen of this invention can form a triple-helix structure. It has been determined that the recombinant humanized type XVII collagen C17T15 of this invention can form a triple-helix structure. The triple-helix structure of collagen is formed by three polypeptide chains intertwined. Each polypeptide chain is composed of many amino acids linked together, among which glycine, proline, and hydroxyproline are particularly important in the structure of collagen. Each of these amino acids can form hydrogen bonds, which can link the three polypeptide chains together to form a triple-helix structure. In this process, each polypeptide chain intertwines with the other two polypeptide chains in the same way. Studies have shown that the triple-helix structure of collagen plays a crucial role in its thermal stability. The three-dimensional structure formed when polypeptide chains intertwine through hydrogen bonds is very stable. Numerous experimental results show that high temperatures or pH levels are required to disrupt the triple-helix structure of collagen. In vivo, the thermal stability of collagen offers many benefits. For example, due to its high thermal stability, collagen can maintain its stability and function in the human body over a long period of time. This stability also provides collagen with resilience, enabling it to withstand the stress generated during daily physical activity and metabolism without breaking down or decomposing.

[0070] Composition

[0071] The recombinant humanized type XVII collagen of the present invention can be prepared into a composition. The composition may comprise the recombinant humanized type XVII collagen described herein, nucleic acids, a carrier, and / or host cells. The composition may also comprise a pharmaceutically and / or cosmetically acceptable carrier or solvent. The composition may be a pharmaceutical composition or a cosmetic composition for pharmaceutical and / or cosmetic purposes. For example, the composition is one or more of the following: bio-dressings, biomimetic materials, plastic and cosmetic materials, organoid culture materials, cardiovascular scaffold materials, coating materials, tissue injection fillers, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials, and pharmaceutical excipients.

[0072] There are no particular restrictions on the application area of ​​the cosmetic composition; it can be the face, hands, legs, torso, etc. There are also no particular restrictions on the form of the composition, as long as it achieves the intended function. For example, the composition can be a solid, liquid, or gel composition.

[0073] The composition can be applied in any suitable manner, such as for oral and / or topical application. The composition can also be prepared as a kit. The kit may contain additional ingredients, such as excipients like buffers, and may include instructions for use. In particular, the composition can be formulated into a suitable formulation, such as a liquid formulation. The formulation may contain a buffer, such as D-PBS buffer or PBS buffer.

[0074] Methods and uses

[0075] This document provides methods for inducing cell adhesion or attachment, the methods comprising contacting cells with the recombinant humanized type XVII collagen, compositions, and / or liquid formulations described herein. The methods of the present invention can be performed in vitro to increase cell adhesion to a culture vessel. Alternatively, the methods of the present invention can also be performed in vivo. The present invention also provides the use of the recombinant humanized type XVII collagen, compositions, and / or liquid formulations described herein in the preparation of pharmaceuticals and / or kits for increasing cell adhesion. In addition to the collagen described herein, the kits may also contain suitable carriers, diluents, or excipients, and include instructions for use of the collagen.

[0076] Example

[0077] The following embodiments are provided to illustrate the present invention. Those skilled in the art should understand that the embodiments are merely illustrative and not restrictive. The invention is limited only by the scope of the appended claims.

[0078] Example 1: Construction, expression, and screening of humanized type XVII collagen fragments

[0079] 1. Large-scale functional region screening was conducted to obtain the target gene functional regions of humanized type XVII collagen.

[0080] C17T15 amino acid sequence: ghkgekgdkgdq ghkgekgdkgdq ghkgekgdkgdq ghkgekgdkgdqghkgekgdkgdq ghkgekgdkgdq ghkgekgdkgdq ghkgekgdkgdq ghkgekgdkgdq ghkgekgdkgdqghkgekgdkgdq ghkgekgdkgdq ghkgekgdkgdq ghkgekgdkgdq ghkgekgdkgdq (SEQ ID NO: 2; the repeating unit is ghkgekgdkgdq, SEQ ID NO: 1).

[0081] The inventors designed the C17T15 nucleotide sequence based on the C17T15 amino acid sequence.

[0082] C17T15 nucleotide sequence:

[0083] GGATCCGAGAACCTGTATTTTCAGGGTCATAAAGGTGAGAAAGGCGACAAAGGTGACCAGGGTCATAAAGGTGAAAAAAGGTGATAAAGGCGATCAGGGTCATAAAGGTGAAAAAGGTGATAAAGGTGACCAGGGTCATAAAGG TGAAAAAGGTGATAAAAGGCGATCAGGGTCATAAAGGTGAAAAAGGTGATAAAGGCGATCAGGGCCATAAAGGTGAAAAAGGTGATAAAGGTGACCAGGGTCATAAAGGTGAAAAAGGTGATAAAGGCGATCAGGGTCATAAAG GCGAAAAAGGTGATAAAGGCGATCAGGGTCATAAAGGTGAAAAAGGTGATAAAGGCGATCAGGGCCATAAAGGTGAAAAAGGTGATAAAGGTGATCAGGGCCATAAAGGTGAAAAAGGCGATAAAGGTGACCAGGGTCATAAA GGCGAAAAAGGTGATAAAGGTGATCAGGGTCATAAAGGCGAAAAAGGTGATAAAGGTGATCAGGGTCATAAAGGCGAAAAAGGTGATAAAGGCGATCAGGGTCATAAAGGCGAAAAAGGTGATAAAGGTGATCAGTAACTCGAG (SEQ ID NO: 3).

[0084] 2. Construction of genetically engineered Escherichia coli

[0085] The C17T15 nucleotide sequence was cloned into an expression vector, which was then transformed into an Escherichia coli expression strain, and the genetically engineered Escherichia coli strain was obtained by screening.

[0086] Specifically, based on the amino acid sequence of C17T15 (SEQ ID NO: 2), the codon gene SEQ ID NO: 3 preferred by *E. coli* was optimized and selected. The nucleotide sequence of SEQ ID NO: 3 was synthesized. The C17T15 gene fragment was inserted into the pET-32a expression vector (Beijing Liuhe Huada Genomics Co., Ltd.) through the restriction enzyme sites of KpnI (NEB, catalog number: R0136L) and Xho I (NEB, catalog number: R0146L), thus constructing the pET-32a-C17T15 expression vector. The expression vector was introduced into *E. coli* BL21(DE3), and positive *E. coli* genetically engineered bacteria were screened. The above operations were performed by Beijing Liuhe Huada Genomics Co., Ltd.

[0087] 3. Fermentation culture of genetically engineered Escherichia coli

[0088] The successfully constructed expression plasmid was transformed into E. coli competent cells BL21(DE3). The specific process is as follows:

[0089] (1). Take out Escherichia coli competent cells BL21(DE3) from the ultra-low temperature freezer and place them on ice. Take 2 μl of the plasmid to be transformed and add it to the competent cells BL21(DE3), and mix slightly 2-3 times.

[0090] (2). Place the mixture in an ice bath for 30 minutes, then heat shock it in a water bath at 42°C for 45-90 seconds, and then place it in an ice bath for 2 minutes.

[0091] (3). Transfer to a biosafety cabinet and add 700 μl of liquid LB medium, then incubate at 37°C and 220 rpm for 60 min.

[0092] (4) Take 200 μl of bacterial solution and spread it evenly on an LB agar plate containing ampicillin sodium.

[0093] (5) Incubate the plates in a 37°C incubator for 15-17 hours until uniformly sized colonies grow.

[0094] (6) Pick 5-6 single colonies from the transformed LB plates and place them in a shake flask containing LB medium with antibiotic stock solution. Incubate at 220 rpm and 37°C for 7 hours in a constant temperature shaker. Then cool the shake flask to 16°C, add IPTG to induce expression for a period of time, aliquot the bacterial culture into centrifuge bottles, centrifuge at 8000 rpm and 4°C for 10 minutes, collect the bacterial cells, record the cell weight, and take samples for electrophoresis detection.

[0095] (7) The collected bacterial cells were resuspended in equilibration working solution (200mM sodium chloride, 25mM Tris, 20mM imidazole, pH 8.0). The bacterial solution was cooled to ≤15℃ and homogenized twice by high-pressure homogenization. After completion, the bacterial solution was collected. The homogenized bacterial solution was aliquoted into centrifuge bottles and centrifuged at 17000 rpm and 4℃ for 30 min. The supernatant was collected, and the supernatant and precipitate were used for electrophoresis.

[0096] (8). The C17T15 was purified and digested by enzymes. The specific process was as follows: (1) Crude purification: a. Wash the column (Ni6FF, Cytiva) with water for 5 CVs. b. Equilibrate the column with equilibration buffer (200mM sodium chloride, 25mM Tris, 20mM imidazole, pH 8.0) for 5 CVs. c. Loading the sample: Add the supernatant after centrifugation to the column until the liquid has flowed out, and then take the flow-through for electrophoresis. d. Washing off contaminating proteins: Add 25mL of washing buffer (200mM sodium chloride, 25mM Tris, 20mM imidazole) until the liquid has flowed out, and take the flow-through for electrophoresis. e. Collecting the target protein: Add 20mL of elution buffer (200mM sodium chloride, 25mM Tris, 250mM imidazole, pH 8.0), collect the flow-through, detect the protein concentration, calculate the protein amount, and perform electrophoresis. f. Wash the column with 1M imidazole working solution. g. Wash the column with purified water. (2) Enzyme digestion: Add TEV enzyme at a ratio of total protein to total TEV enzyme of 50:1, digest at 16℃ for 4h, and take samples for electrophoresis detection. Put the digested protein solution into a dialysis bag, dialyze at 4℃ for 2h, and then transfer it to a new dialysis solution for overnight dialysis at 4℃. (3) Purification: a. Equilibrate the column (Ni6FF, Cytiva): Equilibrate the column with solution A (20mM Tris, 20mM sodium chloride, pH 8.0) at a flow rate of 10ml / min. b. Load the sample: Load the sample at a flow rate of 5ml / min and collect the flow through, and perform electrophoresis detection. c. Gradient elution: Set up 0-15% B solution (20mM Tris, 1M sodium chloride, pH 8.0) for 2 min, then hold for 3 CVs; 15-30% B solution for 2 min, then hold for 3 CVs; 30-50% B solution for 2 min, then hold for 3 CVs; and 50-100% B solution for 2 min, then hold for 3 CVs. Collect the eluent peaks and perform electrophoresis to detect the purified protein. d. Wash the column. Store the protein at 4°C.

[0097] For concentration detection, accurately measure an appropriate amount of sample, dilute it 10-50 times with elution buffer, and stir thoroughly with a glass rod. Use a UV-Vis spectrophotometer to measure the absorbance at 280 nm. Calculate the protein concentration using the formula C(mg / ml) = A280 × absorbance coefficient × dilution factor (Note: absorbance value should be between 0.1 and 1).

[0098] The specific procedure for electrophoresis detection was as follows: 40 μl of sample solution was taken and 10 μl of 5× protein loading buffer (250 mM Tris-HCl (pH: 6.8), 10% SDS, 0.5% bromophenol blue, 50% glycerol, 5% β-mercaptoethanol) was added. The buffer was then boiled in water at 100℃ for 10 min. Next, 10 μl of the buffer was added to each well of an SDS-PAGE protein gel. The gel was run at 80V for 2 h. Afterward, the protein was stained with Coomassie Brilliant Blue (0.1% Coomassie Brilliant Blue R-250, 25% isopropanol, 10% glacial acetic acid) for 20 min, followed by destaining with protein destaining solution (10% acetic acid, 5% ethanol). Experimental results are shown in [link to experimental results]. Figure 1 The first lane from the left shows the target protein obtained after enzyme digestion, the second lane from the left shows the remaining carrier protein after enzyme digestion, and the rightmost lane shows the marker. As shown in the figure, the target protein band is a single band without any other protein bands.

[0099] The specific process of mass spectrometry detection is as follows:

[0100] A. After removing salt components by dialysis with ultrapure water, the purified protein is freeze-dried under vacuum to form protein powder.

[0101] B. Dissolve the protein powder in ultrapure water or matrix buffer containing 50% acetonitrile and 0.1% trifluoroacetic acid, and dilute to 0.1-10 pmol / μl.

[0102] C. Mix the protein sample solution and the saturated matrix solution in a 1:1 ratio until homogeneous.

[0103] D. Take 1 μl of the above mixture and add it to the sample target, then air dry.

[0104] E. Place the sample target containing protein standards and sample protein into a MALDI-TOF-MS mass spectrometer. Ion source: ESI. Detection mode: positive ion. Precursor ion scan range: 500-4000 m / z. Compare the difference between the measured precise molecular weight of the target protein molecule and the relative molecular weight deduced from the protein's amino acid sequence.

[0105] Mass spectrometry analysis of purified recombinant humanized collagen C17T15 protein showed that... Figure 2 .like Figure 2 As shown, the theoretical molecular weight of collagen C17T15 of the present invention is 18577.43 kDa, and the highest peak on the mass spectrum shows that the actual molecular weight is 18577.1 kDa, which is consistent with the theoretical molecular weight.

[0106] Example 2: Bioactivity assay of recombinant humanized collagen

[0107] The method for detecting the adhesion activity of recombinant humanized collagen can be found in the reference Juming Yao, Satoshi Yanagisawa, Tetsuo Asakura, Design, Expression and Characterization of Collagen-Like Proteins Based on the Cell Adhesive and Crosslinking Sequences Derived from Native Collagens, J Biochem. 136, 643-649 (2004). The specific implementation method is as follows:

[0108] (1) The concentration of the protein samples to be tested was detected using ultraviolet absorption, including bovine type I collagen (China National Institutes for Food and Drug Control, No.: 380002) and recombinant humanized collagen C17T15 provided in this invention. Specifically, the ultraviolet absorption of the samples at 215 nm and 225 nm was measured respectively, and the protein concentration was calculated using the empirical formula C(μg / mL) = 144 × (A215 - A225). Note that the detection must be performed when A215 < 1.5. The principle of this method is: to measure the characteristic absorption of peptide bonds under far-ultraviolet light, which is not affected by the content of chromophores, has few interfering substances, is simple to operate, and is suitable for detecting human collagen and its analogues that are not colorimetric by Coomassie Brilliant Blue. (Reference: Walker JM. The Protein Protocols Handbook, second edition. HumanaPress. 43-45). After the protein concentration was measured, the concentration of all the proteins to be tested was adjusted to 0.5 mg / mL with PBS.

[0109] (2) Add 100 μL of various protein solutions (bovine type I collagen or recombinant humanized collagen C17T15) or D-PBS solution (blank control group) to a 96-well plate.

[0110] (3) Add 10 to each hole 5 A well-cultured 3T3 cell was incubated at 37°C for 60 minutes.

[0111] (4) Wash each well with PBS 4 times.

[0112] (5) The absorbance at OD492nm was measured using an LDH detection kit (Roche, 04744926001). The cell adhesion rate could be calculated based on the values ​​from the blank control. The calculation formula is as follows:

[0113]

[0114] In the formula:

[0115] P: Relative cell adhesion ratio;

[0116] OD1: The average absorbance of each duplicate well of the collagen sample at OD492nm;

[0117] OD2: The average absorbance of each duplicate well of the control collagen sample at OD492nm;

[0118] OD0: The average absorbance of each replicate well in the blank control group at OD492nm.

[0119] Cell adhesion rate reflects the adhesion activity of various proteins. The higher the activity of a protein, the better it can provide a high-quality external environment for the cell in a short time, helping the cell to adhere.

[0120] The results are as follows Figure 3 As shown in the comparison, the recombinant collagen C17T15 of the present invention has superior bioadhesion activity compared to bovine type I collagen (PC group, 0.5 mg / ml). Figure 3 The relative cell adhesion activity of recombinant humanized collagen C17T15 compared to bovine type I collagen was described, indicating that recombinant humanized collagen C17T15 exhibits significantly higher (more than 2-fold) cell adhesion activity than bovine type I collagen. Such high cell adhesion activity of recombinant humanized collagen C17T15 is unexpected.

[0121] Example 3: Circular dichroism spectroscopy of recombinant humanized collagen C17T15

[0122] 1) Sample preparation

[0123] Prepare 1X phosphate buffered saline (PBS) solution by dissolving 8g NaCl, 0.2g KCl, 3.62g Na2HPO4·12H2O and 0.24g KH2PO4 in 800ml distilled water, adjusting the pH of the solution to 7.4 with HCl, adding water to a final volume of 1L, autoclaving, and storing at room temperature. If the storage time is more than 1 week, it must be filtered through a 0.45 filter membrane before use.

[0124] Sample dissolution: Dissolve the lyophilized flocculent sample in PBS—each vial contains 4 mg of recombinant humanized collagen C17T15 protein. Draw 2 mL of PBS into the vial using a syringe (note the negative pressure in the vial, and the syringe must accurately draw 2 mL of PBS). The final concentration is 2 mg / mL. Incubate overnight at 4°C (preparation time: 23:37 on November 22, 2021; sample production date: August 14, 2021).

[0125] Note: For protein samples, try to select samples with an absorbance (A) below 2 (A: UV absorbance value). The detection voltage (HT) should be controlled between 170-700. If the HT is >700, the test results will not be accurate. You can try reducing the sample concentration, using a shorter wavelength cuvette, or changing the solvent. The recommended maximum concentration is 1-0.5 mg / mL; it is suggested to adjust the concentration according to the instrument's sensitivity.

[0126] Sample testing:

[0127] Gradual dilution sample preparation: 1. Use an ice box ice maker to obtain ice. Perform two-fold serial dilutions on the overnight sample at 4 degrees Celsius (remember to change pipette tips). Take 500µl of the overnight sample and dilute it with PBS to concentrations of 1.0, 0.5, 0.25, and 0.125 mg / mL.

[0128] 2) Instrument (Circular Dichroism Spectrometer, JASCO J-815; JASCO Corporation) Parameter Settings

[0129] Band width: 1.0nm

[0130] Step: 1.0nm

[0131] Measurement range: 190-260nm

[0132] Time per point: 1 second

[0133] Scanning speed: 50 nm / min

[0134] Repeats: 3 times

[0135] Temperature measurement: 4

[0136] 3) Standard CD scanning

[0137] Set the scanning wavelength to 190-260 nm for baseline testing of blank buffer, and collect the circular dichroism absorption of the sample solution PBS in the range of 190-260 nm.

[0138] 4) Scanning of the spectrum.

[0139] Figure 4 The circular dichroism chromatogram of recombinant humanized collagen C17T15 is shown. Recombinant humanized collagen C17T15 exhibits a negative peak near 195 nm and a positive peak near 221 nm, suggesting that the protein possesses a triple helix structure under these conditions.

[0140] Example 4: CCK8 assay

[0141] 1. Digest, centrifuge, and count the HeLa cells cultured the previous day.

[0142] 2. Seed 100 μL of 3-7kJ / well HeLa cells into a 96-well plate and culture for 24 hours at 37°C, 5% CO2, and 90% humidity.

[0143] 3. Observe the cell growth status and density under a microscope, and select wells with good growth status and uniform cell distribution and density for experiments.

[0144] 4. Prepare C17T15 sample solutions with different concentration gradients. Add three replicates of each concentration to a 96-well plate and incubate for 24 hours at 37°C, 5% CO2, and 90% humidity.

[0145] 5. Add 50 μL of CCK-8 solution diluted according to the kit (Tongren Chemical Research Institute; Cell counting KIT-8, YZ-CK04) instructions to each well.

[0146] 6. Incubate at 37℃, 5% CO2, and 90% humidity for 0.5 hours.

[0147] 7. Measure the absorbance at 450 nm using an ELISA reader.

[0148] 8. Process and analyze the results using Graphpad Prism.

[0149] The results are as follows Figure 5 The results showed that the recombinant type 17 humanized collagen constructed did not exhibit significant cytotoxicity against human cervical cancer cells (HeLa cells) at concentrations below 250 µg / mL, indicating that it is safe for human use.

[0150] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. Collagen, whose amino acid sequence is SEQ ID NO:

2.

2. Collagen in the form of a triple helix structure, wherein the triple helix structure of collagen is formed by three polypeptide chains intertwined, and the amino acid sequence of the polypeptide chains is SEQ ID NO:

2.

3. Nucleic acid encoding the collagen as described in claim 1 or 2.

4. A nucleic acid, the nucleotide sequence of which is shown in SEQ ID NO:

3.

5. A vector comprising the nucleic acid according to claim 3 or 4.

6. The vector according to claim 5, wherein the vector comprises a nucleotide sequence encoding a purification tag, a nucleotide sequence encoding a leader, and / or a regulatory element.

7. The vector according to claim 6, wherein the purification tag is selected from His tag, GST tag, MBP tag, SUMO tag or NusA tag.

8. The carrier according to claim 6, wherein the adjustment element is selected from promoters, terminators, and / or enhancers.

9. A host cell comprising the nucleic acid according to claim 3 or 4 or the vector according to any one of claims 5-8.

10. The host cell according to claim 9, wherein the host cell is a eukaryotic cell or a prokaryotic cell.

11. The host cell according to claim 10, wherein the eukaryotic cell is a yeast cell, an animal cell, and / or an insect cell, and / or the prokaryotic cell is an Escherichia coli cell.

12. The host cell according to claim 10, wherein the Escherichia coli is Escherichia coli BL21.

13. Methods for producing collagen, including: (1) Culture the host cell according to any one of claims 9-12 under suitable culture conditions; (2) Harvesting host cells and / or culture medium containing collagen; and (3) Purify collagen.

14. The method according to claim 13, wherein step (3) comprises: crudely purifying collagen on a Ni affinity chromatography column; adding collagen-derived enzymes for enzymatic digestion; and / or purifying collagen on an ion exchange column.

15. A composition comprising the collagen according to claim 1 or 2, the nucleic acid according to claim 3 or 4, the carrier according to any one of claims 5-8, and / or the host cell according to any one of claims 9-12.

16. The composition according to claim 15, wherein the composition is a pharmaceutical composition, a food composition, or a cosmetic composition.

17. The composition according to claim 15, wherein the composition is one or more of the following: biological dressings, human biomimetic materials, plastic and cosmetic materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection filling materials, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printed artificial organ biomaterials, cosmetic raw materials and pharmaceutical excipients.

18. The composition according to any one of claims 15-17, wherein the composition comprises a pharmaceutically and / or cosmetically acceptable carrier.

19. The composition according to any one of claims 15-17, wherein the composition is a solid, liquid, or gel composition.

20. The composition according to any one of claims 15-17, wherein the composition is an oral and / or topical composition.

21. The composition of claim 20, wherein the composition for topical application is a topical composition.

22. The composition according to any one of claims 15-17, wherein the composition is a kit.

23. The composition according to any one of claims 15-17, wherein the composition is a liquid formulation comprising the collagen according to claim 1 or 2 and a pharmaceutically and / or cosmetically acceptable carrier.

24. The composition of claim 23, wherein the carrier is a buffer.

25. The composition of claim 24, wherein the buffer is a D-PBS buffer or a PBS buffer.

26. An in vitro method for promoting cell adhesion or cell fixation, the method comprising contacting cells with collagen according to claim 1 or 2 and / or a composition according to any one of claims 15-25.

27. Use of the collagen according to claim 1 or 2, the nucleic acid according to claim 3 or 4, the carrier according to any one of claims 5-8, the host cell according to any one of claims 9-12, and / or the composition according to any one of claims 15-25 in the preparation of bio-dressings, human biomimetic materials, coating materials, organoid culture materials, 3D printed artificial organ biomaterials, plastic and cosmetic materials, cardiovascular stent materials, tissue injection filling materials, ophthalmic materials, obstetric and gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials, or vascular repair and regeneration materials.

28. Use of the collagen according to claim 1 or 2 and / or the composition according to any one of claims 15-25 in the preparation of a kit for promoting cell adhesion or cell fixation.

Images