An anti-Mycobacterium tuberculosis acyltransferase target Rv1505c and its application
By inhibiting the activity or content of Rv1505c protein, the problem of unclear control mechanism of Mycobacterium tuberculosis in host cells and the innate immune response is solved, effective treatment and prevention of tuberculosis is achieved, and new anti-tuberculosis drug targets are provided.
Patent Information
- Application Number
- CN202311751926.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-19
- Publication Date
- 2025-03-25
- Estimated Expiration
- 2043-12-19
AI Technical Summary
The prior art is difficult to effectively solve the treatment and prevention of tuberculosis, especially the regulatory mechanism of Mycobacterium tuberculosis in host cells and the innate immune response is unclear.
By inhibiting or reducing the activity or content of the Rv1505c protein, products are developed for the treatment or adjuvant treatment of tuberculosis, or methods for preventing Mycobacterium tuberculosis infection. As an acyltransferase, the protein is knocked out through the CRISPR-Cas9 system or uses specific inhibitors to achieve inhibition of its function.
Effectively inhibiting the interaction between Mycobacterium tuberculosis and the host, weakening its ability to survive in cells, and improving pathological inflammatory infiltration, providing new targets and theoretical guidance for the development of anti-tuberculosis drugs.
Smart Images
Figure HDA0004616060280000011 
Figure HDA0004616060280000012 
Figure HDA0004616060280000021
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and in particular relates to an anti-mycobacterium tuberculosis acyltransferase target Rv1505c and an application thereof. Background Art
[0002] Tuberculosis (TB) is a chronic infectious disease caused by infection with a single pathogen, Mycobacterium tuberculosis (M.tb). During the pathogenesis of TB, M.tb uses effectors to target host factors to hijack the host immune response and promote its intracellular survival.
[0003] Currently, the pathogen-host interaction interface based on M.tb effectors and their host targets is considered to be a potentially effective strategy and target for tuberculosis immunotherapy and drug development. Previous studies have shown that after M.tb enters the cell, it can use acyltransferases to regulate host protein acetylation and innate immune responses to promote the intracellular survival of the pathogen. However, the role of most M.tb acyltransferases in affecting M.tb intracellular survival and the mechanism of regulating innate immune responses remain unclear. Summary of the invention
[0004] The technical problem to be solved by the present invention is how to treat or assist in the treatment of tuberculosis.
[0005] In order to solve the above problems, the present invention first provides a new use of a substance for inhibiting the activity of Rv1505c protein or a substance for reducing the content of Rv1505c protein.
[0006] The present invention provides the use of a substance for inhibiting the activity of Rv1505c protein or a substance for reducing the content of Rv1505c protein in any of the following A1)-A4):
[0007] A1) Preparation of products for the treatment or auxiliary treatment of tuberculosis;
[0008] A2) preparing products for preventing or inhibiting infection with Mycobacterium tuberculosis;
[0009] A3) Treatment or auxiliary treatment of tuberculosis;
[0010] A4) Prevent or inhibit Mycobacterium tuberculosis infection.
[0011] In order to solve the above technical problems, the present invention further provides a product, the function of which is any one of the following C1) or C2):
[0012] C1) Treatment or auxiliary treatment of tuberculosis;
[0013] C2) Prevent or inhibit Mycobacterium tuberculosis infection.
[0014] The active ingredient of the product provided by the invention is a substance that inhibits the activity of the Rv1505c protein or a substance that reduces the content of the Rv1505c protein.
[0015] In any of the above-mentioned applications or products, the inhibition of Mycobacterium tuberculosis infection is embodied in any one of the following B1)-B3):
[0016] B1) reducing the survival number of Mycobacterium tuberculosis in macrophages (such as THP-1 macrophages);
[0017] B2) reducing the load of Mycobacterium tuberculosis in the lung tissue of mice;
[0018] B3) Reduce or improve the pathological inflammatory infiltration of Mycobacterium tuberculosis in mouse lung tissue.
[0019] In any of the above-mentioned applications or products, the substance that inhibits the activity of Rv1505c protein or the substance that reduces the content of Rv1505c protein can effectively inhibit the interaction between Mycobacterium tuberculosis and the host, thereby inhibiting the survival of Mycobacterium tuberculosis in the cell.
[0020] In any of the above-mentioned applications or products, the substance that inhibits the activity of the Rv1505c protein may be a protein, polypeptide or small molecule compound that inhibits the function of the Rv1505c protein.
[0021] The substance that reduces the content of Rv1505c protein can be a substance that inhibits the synthesis of Rv1505c protein or promotes the degradation of Rv1505c protein or knocks down or knocks out the Rv1505c gene.
[0022] Furthermore, the substance for knocking down the Rv1505c gene may be any substance that can render the gene encoding the Rv1505c protein unable to be expressed, such as a substance for silencing the Rv1505c gene (such as miRNA, siRNA, dsRNA, shRNA, etc.).
[0023] The substance for knocking out the Rv1505c gene can be a substance that achieves the non-production of the functional protein product of the Rv1505c gene in the Mycobacterium tuberculosis cell in any way, such as removing all or part of the coding gene sequence, introducing a frameshift mutation so that no functional protein is produced, removing or changing the regulatory component (such as promoter editing) so that the coding gene sequence is not transcribed, preventing translation by binding to mRNA, etc. Usually, the knockout is performed at the genomic DNA level, so that the offspring of the cell also permanently carry the knockout.
[0024] Furthermore, the substance for knocking out the Rv1505c gene may be any substance that can cause the Rv1505c gene to mutate (the mutation may be a deletion mutation and / or an insertion mutation and / or a base substitution) and thereby lose its activity, such as a zinc finger protein ZFN gene editing system or a TALENs gene editing system or a CRISPR / Cas9 gene editing system.
[0025] Furthermore, the substance for knocking out the Rv1505c gene can be a CRISPR / Cas9 gene editing system for knocking out the Rv1505c gene. The CRISPR / Cas9 gene editing system for knocking out the Rv1505c gene includes a Cas9 nuclease and an sgRNA targeting the Rv1505c gene.
[0026] In a specific embodiment of the present invention, the target sequences of the sgRNA targeting the Rv1505c gene are tacgccaaactgaacggtgt and ccggtgcccagcacggagtt.
[0027] The material for knocking out the Rv1505c gene includes a pYC1876-Rv1505c-sgRNA plasmid containing the target sequence of the sgRNA targeting the Rv1505c gene, a pNHEJ-Cas9sth1 plasmid and a pYC1759 plasmid.
[0028] In any of the above-mentioned uses or products, the Mycobacterium tuberculosis is specifically Mycobacterium tuberculosis H37Rv.
[0029] In any of the above-mentioned uses or products, the product may be a drug or an inhibitor.
[0030] The use of the above Rv1505c protein or Rv1505c gene as a target in the preparation, development, design or screening of anti-tuberculosis drugs or inhibitors also falls within the protection scope of the present invention.
[0031] The amino acid sequence of any of the above-mentioned Rv1505c proteins is shown as SEQ ID No.1, and the Rv1505c gene sequence is shown as SEQ ID No.2.
[0032] The present invention firstly discovered the presence of a signal peptide in Mycobacterium tuberculosis Rv1505c through bioinformatics analysis, predicting that it may be a secreted acyltransferase, and then used a knockout system coupled with a CRISPR-Cas9 system-mediated genome cleavage and a non-homologous end-joining system (NHEJ) to knock out the Rv1505c gene knockout strain ΔRv1505c and a Rv1505c gene complementation strain ΔRv1505c:Rv1505c, and confirmed that Rv1505c is a secreted expression effector protein through Rv1505c antibody detection. Further, by overexpressing the Rv1505c protein in 293T cells, the host protein interacting with Rv1505c was identified by immunoprecipitation, Western Blotting experiments and mass spectrometry, confirming that Rv1505c interacts with proteins such as Vimentin in eukaryotic cells, thereby hijacking the activation of the host's innate immune signaling pathway. Finally, macrophages and mice were used to confirm that Rv1505c is a virulence factor of Mycobacterium tuberculosis and a key acetyltransferase that promotes the intracellular and in vivo survival of Mycobacterium tuberculosis. Therefore, Rv1505c can be used as a potential new target for anti-tuberculosis drugs. Inhibitors or drugs targeting Rv1505c can effectively inhibit the interaction between Mycobacterium tuberculosis and the host, thereby inhibiting the intracellular survival of Mycobacterium tuberculosis. The present invention helps to better understand the immunological pathogenesis of tuberculosis, not only provides a new target for clinical tuberculosis treatment and anti-tuberculosis drug development, but also provides theoretical guidance for the research and development of anti-tuberculosis drugs such as chemical small molecule preparations and polypeptide antagonists targeting the Rv1505c acyltransferase domain. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 This is the result of Western Blotting to detect the expression of Rv1505c in the culture supernatant and cells of Mycobacterium tuberculosis.
[0034] Figure 2 The Rv1505c protein can target and bind to host proteins and mediate acetylation modification of host proteins. A is the result of Western Blotting detection of overexpressed Rv1505c and immunoprecipitation products. B is the verification result of Western Blotting detection of immunoprecipitation products.
[0035] Figure 3 The result is that Rv1505c inhibits the activation of NF-κB innate immune signaling pathway.
[0036] Figure 4 The survival ability of different Mycobacterium tuberculosis strains in macrophages.
[0037] Figure 5 The effect of Rv1505c knockout Mycobacterium tuberculosis on mouse lung tissue. A is the survival ability of different Mycobacterium tuberculosis in mouse lung tissue. B is the pathological changes in mouse lung tissue caused by different Mycobacterium tuberculosis infection. DETAILED DESCRIPTION
[0038] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.
[0039] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.
[0040] The amino acid sequence of Mycobacterium tuberculosis Rv1505c in the present invention is shown in SEQ ID No.1, and the coding gene sequence thereof is shown in SEQ ID No.2.
[0041] The pLVX-Flag plasmid in the following example is recorded in the document “Xu Y, Cheng S, Zeng H, et al. ARFGTPases activate Salmonella effector SopF to ADP-ribosylate host V-ATPase and inhibit endomembrane damage-induced autophagy[J]. Nature Structural&Molecular Biology, 2022, 29(1): 67-77.”
[0042] The pNHEJ-Cas9sth1 plasmid in the following example is described in the document “Yan MY, Li SS, Ding XY, et al. ACRISPR-assisted nonhomologous end-joining strategy for efficient genome editing in Mycobacterium tuberculosis [J]. MBio, 2020, 11(1): 10.1128 / mbio.02364-19.”.
[0043] Example 1. Secretory expression and identification of Mycobacterium tuberculosis acyltransferase Rv1505c
[0044] I. Construction of ΔRv1505c and ΔRv1505c:Rv1505c strains
[0045] 1. Prediction of the N-terminal signal peptide of Mycobacterium tuberculosis Rv1505c
[0046] According to the amino acid sequence of Mycobacterium tuberculosis Rv1505c, the N-terminal signal peptide of the protein was predicted and analyzed using Signa IP 4.1 software. The results showed that the 1-53 amino acid sequence of the N-terminal of Rv1505c protein was a signal peptide, and it was predicted that Rv1505c might be a secreted acyltransferase.
[0047] 2. Construction and identification of ΔRv1505c strain
[0048] 1) Design of sgRNA
[0049] According to the Rv1505c gene sequence of Mycobacterium tuberculosis, a small guide RNA (sgRNA) for targeted knockout of the Rv1505c gene based on CRISPR-NHEJ technology was designed. Finally, two sgRNAs were designed, named Rv1505c-sgRNA1 and Rv1505c-sgRNA2, and the target sequences of Rv1505c-sgRNA1 and Rv1505c-sgRNA2 are as follows:
[0050] Rv1505c-sgRNA1:tacgccaaactgaacggtgt;
[0051] Rv1505c-sgRNA2:ccggtgcccagcacggagtt.
[0052] 2) Construction of Rv1505c knockout plasmid
[0053] The Rv1505c-sgRNA1 and Rv1505c-sgRNA2 sequences designed and synthesized in 1) above were cloned into the pYC1876 plasmid (the nucleotide sequence of the pYC1876 plasmid is shown in SEQ ID No. 3) to obtain the Rv1505c knockout plasmid pYC1876-Rv1505c-sgRNA.
[0054] 3) Obtaining Mycobacterium tuberculosis with Rv1505c gene knockout
[0055] 200-500 ng of pNHEJ-Cas9sth1 plasmid and 200-500 ng of pYC1876-Rv1505c-sgRNA plasmid were introduced into wild-type Mycobacterium tuberculosis H37Rv competent cells containing pYC1759 plasmid (the nucleotide sequence of pYC1759 plasmid is shown in SEQ ID No. 4), and electroporation was performed at room temperature. Immediately after transformation, 1 mL of 7H9 medium (BD, USA, Catalog No.: 271310) containing enrichment solution OADC (BD, USA, Catalog No.: 212351) was added, transferred to a 15 mL centrifuge tube and placed in a 37°C incubator for 48 h, and then spread on a 7H10 plate (BD, USA, Catalog No.: 262710) containing kanamycin, bleomycin dual antibodies and 50 ng / ml tetracycline (anhydrotetracycline, ATc) added with OADC, and cultured at 37°C for 21 to 28 days to obtain Rv1505c gene knockout Mycobacterium tuberculosis (ΔRv1505c).
[0056] 4) Identification of ΔRv1505c
[0057] Randomly pick 16 to 24 monoclones from 7H10 culture plates containing KZOA (Kana, Zeo, OADC, ATc) and streak them on non-antibiotic 7H10 solid culture plates with OADC added. After the plates were cultured at 37°C for about 14 days, clones were selected from the streaked culture plates and added to 20 μL sterile water, vortexed and mixed, and the bacteria were lysed at 99°C for 30 min. 1 μL of the 25 μL PCR reaction system was used as a template for the PCR reaction, and the mutants were identified using the upstream primer sequence (F: agaattctccttgtggccgg) and the downstream primer sequence (R: tgttgcgcttctgcacgact). The PCR control was the wild-type Mycobacterium tuberculosis strain, and then the detection was performed by agarose gel electrophoresis, and the results were observed by an imaging analysis system and sent for sequencing verification. The sequencing verification results showed that a 426 bp fragment between bases 226-651 in the Mycobacterium tuberculosis Rv1505c gene (sequence 2) was successfully knocked out, and the strain was recorded as ΔRv1505c.
[0058] 3. Construction and identification of ΔRv1505c:Rv1505c strain
[0059] 1) Construction of pYC874_L5-Rv1505c plasmid
[0060] The DNA molecule shown in Sequence 2 was ligated between the NotI and XbaI restriction sites of the pYC874_L5 plasmid (the nucleotide sequence of the pYC874_L5 plasmid is shown in SEQ ID No. 5) to obtain the pYC874_L5-Rv1505c plasmid.
[0061] 2) Acquisition of ΔRv1505c:Rv1505c strain
[0062] The pYC874_L5-Rv1505c plasmid was transferred into ΔRv1505c by electroporation to obtain the ΔRv1505c strain complemented with the Rv1505c gene (ΔRv1505c:Rv1505c strain).
[0063] 3) Identification of ΔRv1505c:Rv1505c strain
[0064] A single clone of ΔRv1505c with complemented Rv1505c gene was picked out and PCR amplified and sequenced using the upstream primer sequence (F: agaattctccttgtggccgg) and downstream primer sequence (R: tgttgcgcttctgcacgact). The strain with successful complementation of Rv1505c gene was recorded as ΔRv1505c:Rv1505c strain.
[0065] 2. Identification of secretory expression of Rv1505c in different Mycobacterium tuberculosis strains
[0066] Wild-type Mycobacterium tuberculosis H37Rv strain, ΔRv1505c strain and ΔRv1505c:Rv1505c strain were cultured in Sutong medium (Shanghai Ruichu Biotechnology Co., Ltd., catalog number T2000). After 4 weeks of culture, the bacterial liquid was collected and centrifuged at 4500 rpm for 10 min to collect the supernatant, which was then filtered and sterilized through a 0.22 μm filter to obtain the culture supernatant; the remaining bacterial liquid was centrifuged at 12000 rpm for 10 min to obtain the bacterial cells. Rv1505c polyclonal antibody (Wuhan Abotek Biotechnology Co., Ltd.) was used to detect secretory proteins in the culture supernatants and cells of different Mycobacterium tuberculosis.
[0067] The results are as follows Figure 1 The results showed that the expression of Rv1505c protein could be detected in the culture supernatant of H37Rv and ΔRv1505c:Rv1505c, but could not be detected in the culture supernatant of ΔRv1505c.
[0068] The above results indicate that Rv1505c is an effector protein secreted and expressed by Mycobacterium tuberculosis.
[0069] Example 2: Rv1505c protein can target and bind to host proteins and mediate acetylation modification of host proteins
[0070] 2 μg of pLVX-Flag-Rv1505c plasmid (pLVX-Flag-Rv1505c plasmid is a plasmid obtained by connecting the DNA molecule shown in sequence 2 to the XhoI multiple cloning site of the pLVX-Flag plasmid) was transfected into 293T cells. 48 hours after transfection, the cells were collected, lysed with immunoprecipitation lysis buffer, and Flag magnetic beads were added to enrich the Flag-Rv1505c protein and its interacting host proteins. Western blotting protein detection was performed, and then the differential protein bands in the Western blotting results were cut and identified by mass spectrometry. At the same time, 293T cells transfected with the pLVX-Flag empty vector were used as a control (Vector).
[0071] The results are as follows Figure 2 The results showed that the acetylation levels of 100kDa, 50kDa and 15kDa protein bands in the whole cell protein overexpressing Rv1505c were significantly increased compared with the whole protein acetylation modification of the empty vector control group. The protein bands enriched by immunoprecipitation that interacted with Rv1505c and had significantly increased acetylation were mainly located in the 20kDa and 50kDa bands ( Figure 2 A). Mass spectrometry results showed that the host proteins that interacted with Rv1505c protein and were significantly upregulated in acetylation mainly included: Vimentin, RNA splicing ligase RtcB (RTCB) and myosin light chain 12A (MYL12A) and other proteins; among them, the candidate protein with the highest credibility (score) and semi-quantitative abundance (emPAI) was Vimentin protein. Further immunoprecipitation showed that Rv1505c had a specific interaction with Vimentin ( Figure 2 B).
[0072] The above results indicate that Rv1505c can target and interact with multiple host proteins and mediate their acetylation modification, including but not limited to Vimentin.
[0073] Example 3: Rv1505c inhibits activation of NF-κB innate immune signaling pathway
[0074] The wild-type Mycobacterium tuberculosis H37Rv strain, ΔRv1505c strain and ΔRv1505c:Rv1505c strain were dispersed into single bacteria by a bacterial dispersion instrument and measured by McFarland turbidimetry. A certain amount of bacterial solution was added to RPMI 1640 complete cell culture medium (Corning, USA, catalog number 10040070) containing 10% fetal bovine serum (ThermoFisher, catalog number 10099141C) according to the multiplicity of infection (MOI=5) for dilution. 1 mL of the complete culture medium containing different strains was added to a cell culture dish containing macrophage THP-1 to infect macrophage THP-1 (National Biomedical Experimental Cell Resource Bank, Cell Resource Center, Institute of Basic Medicine, Chinese Academy of Medical Sciences, resource number: 1101HUM-PUMC000057). The cells were collected and lysed 0.5 hour and 1 hour after infection, respectively, and Western blot protein detection was performed.
[0075] The results are as follows Figure 3 The results showed that Mycobacterium tuberculosis infection could significantly induce the activation of the NF-κB innate immune signaling pathway. However, at different time points of infection, compared with the NF-κB activation induced by infection with the wild-type Mycobacterium tuberculosis H37Rv strain and the ΔRv1505c:Rv1505c strain, the NF-κB phosphorylation level induced by infection with the ΔRv1505c strain was significantly increased.
[0076] The above results indicate that Rv1505c inhibits the activation of the host NF-κB innate immune signaling pathway and the immune response mediated by it, thereby promoting its own survival in the cell.
[0077] Example 4: The survival ability of the ΔRv1505c strain in macrophages was significantly reduced
[0078] The wild-type Mycobacterium tuberculosis H37Rv strain, ΔRv1505c strain and ΔRv1505c:Rv1505c strain were respectively infected with macrophages THP-1 according to the infection method in Example 3. The cells were collected 6 hours and 72 hours after infection, respectively, and 0.1% SDS was added to lyse the cells. After pipetting and mixing, the lysate was diluted 10 times and coated on a 7H10 culture plate. After further culture in a 37°C incubator for 2-3 weeks, the colony count (CFU) of Mycobacterium tuberculosis was calculated.
[0079] The results are as follows Figure 4 The results showed that after 72 hours of infection, the number of wild-type Mycobacterium tuberculosis H37Rv bacteria surviving in macrophages was 1.0×10 6 The number of bacteria surviving in macrophages of the ΔRv1505c strain for the same culture time was only 4.3×10 5ΔRv1505c: The number of bacteria surviving in macrophages of Rv1505c strain was 11.7×10 5 From the above results, it can be seen that the number of bacteria surviving in macrophages of the ΔRv1505c:Rv1505c strain increased significantly by 7.4×10 compared with the ΔRv1505c strain. 5 The survival number of the ΔRv1505c strain in macrophages was 60% and 41% lower than that of the wild-type Mycobacterium tuberculosis H37Rv strain and the ΔRv1505c:Rv1505c strain, respectively.
[0080] The above results indicate that Rv1505c plays a key role in promoting the intracellular survival of Mycobacterium tuberculosis.
[0081] Example 5: The survival ability of the ΔRv1505c strain in mouse lung tissue was significantly reduced
[0082] The wild-type Mycobacterium tuberculosis H37Rv strain, ΔRv1505c strain and ΔRv1505c:Rv1505c strain were cultured in Sutong medium (Shanghai Ruichu Biotechnology Co., Ltd., catalog number T2000), and the bacterial suspensions were collected when they were cultured to the logarithmic phase (A600 = 0.8). Then, each bacterial suspension was dispersed and filtered into a single bacterial body at 5 μm. Different volumes of the bacterial suspensions of the three strains were diluted to the same McFarland's ratio and added to an aerosol generator device (Glas-Col, Inhalation Exposure System, 099C A4224), 4-6 week old C57BL / 6 mice were infected by aerosol inhalation according to the standardized aerosol infection process, 8 mice were infected with each strain, so that the initial bacterial infection amount in the lungs of each mouse was about 500-1000 CFU, 3 mice in each group were killed on the first day of infection to detect and record whether the mouse lungs were successfully infected, 5 mice in each group were killed on the 28th day after infection, the mouse lung tissue was separated and homogenized and coated on 7H10 culture dishes, and the culture was continued in a 37°C incubator for 2-3 weeks, and the CFU was counted; at the same time, the remaining lobe of mouse lung tissue was used for pathological analysis.
[0083] The results are as follows Figure 5 The results showed that on the first day of infection, there was no difference in the bacterial load of wild-type Mycobacterium tuberculosis H37Rv strain, ΔRv1505c strain and ΔRv1505c:Rv1505c strain in the lung tissue of mice. On the 28th day after infection, the bacterial load of ΔRv1505c strain in the lung tissue of mice was significantly reduced by about 12 times (reduced by about 1.2Log) compared with the wild-type Mycobacterium tuberculosis H37Rv strain and ΔRv1505c:Rv1505c strain. 10value), and the pathological inflammatory infiltration in the lung tissue of mice infected with the ΔRv1505c strain was significantly weakened.
[0084] The above results indicate that Rv1505c is a key virulence factor in the occurrence of tuberculosis in mice infected with Mycobacterium tuberculosis.
[0085] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.
Claims
1. Use of a substance that inhibits the activity of Rv1505c protein or a substance that reduces the content of Rv1505c protein in any of the following A1)-A2): A1) Preparation of products for the treatment or adjunctive treatment of tuberculosis; A2) Preparation of products for preventing or inhibiting infection with Mycobacterium tuberculosis; The substance that inhibits the activity of Rv1505c protein or reduces the content of Rv1505c protein is a knockout Rv1505c Genetic material; The knockout Rv1505c Gene knockout Rv1505c CRISPR / Cas9 gene editing system for genes; The knockout Rv1505c The CRISPR / Cas9 gene editing system includes Cas9 nuclease and targeting Rv1505c sgRNA of the gene; The targeting Rv1505c The target sequences of sgRNA for the gene are tacgccaaactgaacggtgt and ccggtgcccagcacggagtt.
2. The use according to claim 1, characterized in that: The inhibition of Mycobacterium tuberculosis infection is embodied in any one of the following B1)-B3): B1) Reduce the number of viable Mycobacterium tuberculosis in cells; B2) reduce the load of Mycobacterium tuberculosis in mouse lung tissue; B3) Attenuated or improved the pathological inflammatory infiltration of Mycobacterium tuberculosis in the lung tissue of mice.
3. A product, the active ingredient of which is a substance that inhibits the activity of Rv1505c protein or a substance that reduces the content of Rv1505c protein; the function of the product is any one of the following C1) or C2): C1) Treatment or adjunctive treatment of tuberculosis; C2) prevent or inhibit Mycobacterium tuberculosis infection; The substance that inhibits the activity of Rv1505c protein or reduces the content of Rv1505c protein is a knockout Rv1505c Genetic material; The knockout Rv1505c Gene knockout Rv1505c CRISPR / Cas9 gene editing system for genes; The knockout Rv1505c The CRISPR / Cas9 gene editing system includes Cas9 nuclease and targeting Rv1505c sgRNA of the gene; The targeting Rv1505c The target sequences of sgRNA for the gene are tacgccaaactgaacggtgt and ccggtgcccagcacggagtt.
4. The product according to claim 3, characterized in that: The inhibition of Mycobacterium tuberculosis infection is embodied in any one of the following B1)-B3): B1) Reduce the number of viable Mycobacterium tuberculosis in cells; B2) reduce the load of Mycobacterium tuberculosis in mouse lung tissue; B3) Attenuated or improved the pathological inflammatory infiltration of Mycobacterium tuberculosis in the lung tissue of mice.
5. The product according to claim 3 or 4, characterized in that: The product described is a drug.
6. The product according to claim 5, characterized in that: The drug is an inhibitor.