A human-ovine rotavirus recombinant plasmid, a human-ovine rotavirus reassortant virus strain, and a construction method and application thereof

By constructing a human-sweet rotavirus recombinant plasmid and reverse genetic virus rescue system, the problem of mismatch between the existing rotavirus vaccine and the epidemic strain was solved, and a variety of combination vaccines matching the epidemic strain were prepared, which improved the protective effect of the vaccine.

CN117867018BActive Publication Date: 2025-07-11INOWELLCOME (BEIJING) BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410059498.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-16
Publication Date
2025-07-11
Estimated Expiration
2044-01-16

AI Technical Summary

Technical Problem

The existing rotavirus vaccine has poor matching of epidemic strains in different regions around the world, resulting in unsatisfactory vaccine effectiveness, especially in some regions such as Africa, and the lack of an effective reverse genetics system limits the acquisition of viral reassorption strains.

Method used

By constructing a human-glus rotavirus recombinant plasmid, using reverse genetics technology to operate the VP7 and VP4 genes, a variety of human rotavirus vaccines were developed, including pT7-VP7/Hu01 (G1), pT7-VP7/Hu02 (G2), pT7-VP7/Hu03 (G3), pT7-VP7/Hu04 (G4), pT7-VP7/Hu05 (G8), pT7-VP7/Hu06 (G9), pT7-VP4/Hu02 (P[4]) and pT7-VP4/Hu06 (P[8]), and a human-glus rotavirus reassorption virus strain was prepared.

Benefits of technology

A variety of vaccines that match the epidemic strains are provided, which makes up for the gap in the mismatch between the existing vaccines and the epidemic strains. It can customize the development of vaccines based on local epidemic genotypes and population characteristics, improving the protective effect of the vaccine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117867018B_ABST
    Figure CN117867018B_ABST
Patent Text Reader

Abstract

The present invention provides a human-ovine rotavirus recombinant plasmid, a human-ovine rotavirus reassortant virus strain, and a construction method and application thereof, belonging to the technical field of rotavirus vaccines. The sequences of 8 human rotavirus infectious clone plasmids of the present invention are respectively shown as SEQ ID NO:1 to SEQ ID NO:8. By using the above 8 human rotavirus plasmids and 11 ovine rotavirus infectious clone plasmids, 8 human-ovine rotavirus reassortant strains were successfully prepared through a reverse genetics virus rescue system, filling the gap that the main antigens of existing rotavirus vaccine strains in China do not match the main epidemic strains in China.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of rotavirus vaccines, and particularly relates to a human-sheep rotavirus recombinant plasmid and a human-sheep rotavirus reassortant virus strain, and a construction method and application thereof. Background Art

[0002] Rotavirus (RV) belongs to the Reoviridae family and the Rotavirus genus; it has been confirmed as the most common pathogen causing acute gastroenteritis in infants and young children worldwide. Rotavirus infection causes diarrhea in approximately 125 million infants and young children globally every year, and rotavirus diarrhea causes 900,000 deaths of infants and young children under 5 years old globally every year, seriously affecting the health of infants and young children and bringing a huge disease burden to the world. There is still no specific drug for the treatment of diarrhea caused by rotavirus, and vaccination is currently the only proven and most effective preventive method.

[0003] The rotavirus genome consists of 11 discontinuous double-stranded RNA segments, which encode 6 structural proteins (VP1-VP4, VP6, VP7) and 6 non-structural proteins (NSP1-6) of the virus respectively. VP6 accounts for 51% of the viral protein amount, forms the middle shell of the virus in the form of a trimer, and is the group common antigen and subgroup specific antigen of rotavirus. VP4 and VP7 form the outer shell of RV, have neutralizing antigen activity, and can stimulate the body to produce neutralizing antibodies. Among them, VP7 is a glycoprotein, VP4 is a protease-sensitive protein, is the outer shell spike protein, and accounts for about 15% of the total viral protein amount. VP6 is the group common antigen and subgroup specific antigen of rotavirus. According to the different antigenicity of VP6, RV can be divided into 7 groups (A-G), and groups A, B, and C can infect humans. VP4 and VP7 are the type-specific antigens of rotavirus. Among them, VP7 is the main antigen, and according to its different antigenicity, RV can be divided into 15 G genotypes, written as GX. VP4 can also induce the production of neutralizing antibodies in the host, and according to its different antigenicity, RV can be divided into 25 P genotypes, but there is a large difference between the serotype and genotype of VP4, so when expressing the genotype of VP4, it is written as P[X]. In recent years, the main epidemic strain types globally are G1P[8], G2P[4], G3P[8], G4P[8], and G9P[8], accounting for 90% of RV strains.

[0004] The currently used rotavirus vaccines mainly include: Rotarix, RotaTeq, Rotavac, ROTASIIL, Rotavin-M1 and LLR. Among them, the first 4 have passed the prequalification for use by the WHO, and Rotavin-M1 and LLR have been approved for use in Vietnam and China respectively. LLR is a monovalent live attenuated vaccine developed by inoculating the neonatal calf kidney cells with the lamb rotavirus strain G10P

[15] first isolated in 1985. However, the LLR vaccine is an animal-derived live attenuated vaccine, which does not match the epidemic strains and has a poor effect in preventing infection. Rotateq is obtained by the classical reassortment method of human rotavirus G1, G2, G3, G4 and P[8] and bovine rotavirus, does not contain G9 and G8 genotypes, and the G1, G2, G3, G4 and P[8] used for reassortment are the early epidemic strains in Europe and the United States, which cannot match well with the current RV epidemic strains in China; in addition, the reassortment technology used is different from the reassortment technology in the present invention, and the efficiency of the present reassortment technology is greatly improved, reducing a large amount of cumbersome work and various specific antibodies required. At present, there have been great changes in the prevalent dominant types of rotavirus and the corresponding antigenic determinants, and new vaccines need to be developed; the currently marketed rotavirus vaccines have poor effects in some regions such as Africa, and new vaccines need to be developed or the previous vaccine components need to be adjusted. Therefore, it is urgent to solve the problem that the rotavirus vaccine components match the dominant epidemic strains monitored by epidemiological surveillance, and even develop different formulations of vaccines according to different regions and different ethnic groups, etc.

[0005] Reverse genetics technology refers to the related technology that, based on the known gene sequence, uses modern biological theories and technologies to create mutants by changing gene characteristics and study the phenotypic effects caused by the mutations. Among them, the research strategy of performing in vitro artificial operations on the virus at the cDNA molecular level, such as gene point mutation, deletion, insertion, transversion, transposition and complementation, etc., to obtain an infectious molecular clone of the virus is called the "virus rescue" technology. Through reverse genetics technology, we can directly operate on the neutralizing antigen encoding genes VP7 and VP4 of rotavirus to artificially obtain different GP gene combinations. Compared with the traditional vaccine strain construction technology, reverse genetics technology can obtain more reassortant strains for vaccine preparation selection faster, and can provide a rich virus library for the screening of rotavirus vaccine strains. However, due to the lack of an effective reverse genetics system, there is still a lack of in-depth and systematic original research on the infection mechanism, pathogenic mechanism, host restriction, etc. of rotavirus, as well as the non-randomness of the reassortment events of the members of the Reoviridae family and the genetic compatibility between the two parental strains, it is difficult to obtain the required reassortant strains. Summary of the Invention

[0006] The object of the present invention is to provide a human-ovine reassortant rotavirus containing VP7 and / or VP4 of human rotavirus epidemic strains as a vaccine, which can be used to develop human rotavirus vaccines with various formulations, filling the gap that the main antigens of existing rotavirus vaccine strains in China do not match the main epidemic strains in China; and corresponding rotavirus vaccines with customized formulations can also be developed according to local epidemic genotypes and population characteristics.

[0007] To achieve the above object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a recombinant plasmid of a human-ovine rotavirus infectious clone, and its sequence characteristics are as follows:

[0009] pT7-VP7 / Hu01(G1) is of G1 type;

[0010] pT7-VP7 / Hu02(G2) is of G2 type; pT7-VP7 / Hu03(G3) is of G3 type; pT7-VP7 / Hu04(G4) is of G4 type; pT7-VP7 / Hu05(G8) is of G8 type; pT7-VP7 / Hu06(G9) is of G9 type; pT7-VP4 / Hu02(P[4]) is of P[4] type; pT7-VP4 / Hu06(P[8]) is of P[8] type;

[0011] The sequence of the pT7-VP7 / Hu01(G1) is as shown in SEQ ID NO:1 or has a similarity of 80-90% or more with the sequence shown in SEQ ID NO:1;

[0012] The sequence of the pT7-VP7 / Hu02(G2) is as shown in SEQ ID NO:2 or has a similarity of 80-90% or more with the sequence shown in SEQ ID NO:2;

[0013] The sequence of the pT7-VP7 / Hu03(G3) is as shown in SEQ ID NO:3 or has a similarity of 80-90% or more with the sequence shown in SEQ ID NO:3;

[0014] The sequence of the pT7-VP7 / Hu04(G4) is as shown in SEQ ID NO:4 or has a similarity of 80-90% or more with the sequence shown in SEQ ID NO:4;

[0015] The sequence of the pT7-VP7 / Hu05(G8) is as shown in SEQ ID NO:5 or has a similarity of 80-90% or more with the sequence shown in SEQ ID NO:5;

[0016] The sequence of pT7-VP7 / Hu06(G9) is as shown in SEQ ID NO:6 or has a similarity of 80-90% or more with the sequence shown in SEQ ID NO:6;

[0017] The sequence of pT7-VP4 / Hu02(P[4]) is as shown in SEQ ID NO:7 or has a similarity of 80-90% or more with the sequence shown in SEQ ID NO:7;

[0018] The sequence of pT7-VP4 / Hu06(P[8]) is as shown in SEQ ID NO:8 or has a similarity of 80-90% or more with the sequence shown in SEQ ID NO:2.

[0019] The present invention also provides a rotavirus infectious clone plasmid of sheep. Any one of the rotavirus infectious clone plasmids of human is used to separately replace the corresponding rotavirus infectious clone plasmid of sheep in the rotavirus infectious clone plasmid group of sheep;

[0020] The rotavirus infectious clone plasmid group of sheep includes pT7-VP1 / LLRV, pT7-VP2 / LLRV, pT7-VP3 / LLRV, pT7-VP4 / LLRV, pT7-VP6 / LLRV, pT7-VP7 / LLRV, pT7-NSP1 / LLRV, pT7-NSP2 / LLRV, pT7-NSP3 / LLRV, pT7-NSP4 / LLRV and pT7-NSP5 / LLRV;

[0021] The replacement is as follows: pT7-VP7 / Hu01(G1), pT7-VP7 / Hu02(G2), pT7-VP7 / Hu03(G3), pT7-VP7 / Hu04(G4), pT7-VP7 / Hu05(G8), pT7-VP7 / Hu06(G9) are respectively used to replace pT7-VP7 / LLRV in the rotavirus infectious clone plasmid group of sheep;

[0022] Or pT7-VP4 / Hu02(P[4]) and pT7-VP4 / Hu06(P[8]) are respectively used to replace pT7-VP4 / LLRV.

[0023] The present invention also provides a reverse genetic virus rescue system of human-ovine rotavirus, including the rotavirus infectious clone plasmid group of human-ovine, the helper plasmid pCMV-868CP, MA104 or MA104 N * V engineering cell line and BHK-T7 / 9 cells.

[0024] Preferably, the auxiliary plasmid pCMV-868CP uses CMV as a promoter, (G4S)4 as a linker peptide, and fusion-expresses the African swine fever virus capping enzyme NP868R and T7 RNAP.

[0025] Preferably, the N protein of BVDV and the V protein of PIV5 are integrated into the genome of MA104 cells to construct the MA104 N * V engineering cell line.

[0026] The present invention also provides a method for rescuing a human-ovine rotavirus reassortant virus strain. Mix the infectious clone plasmid group of the human and ovine rotaviruses, the auxiliary plasmid pCMV-868CP and Opti-MEM, then mix with the TransIT-LT1 transfection reagent, let it stand, and then transfect it into BHK-T7 / 9 cells; after culturing and changing the medium, mix the MA104 N * V engineering cell line with the transfected BHK-T7 / 9 cells for co-culture to rescue the human-ovine rotavirus reassortant virus strain.

[0027] Preferably, the culturing time is 42-54 h; the co-culturing time is 2-5 days.

[0028] The present invention also provides a human-ovine rotavirus reassortant virus strain prepared according to the above-mentioned rescue method.

[0029] The present invention also provides the application of the human-ovine rotavirus reassortant virus strain in the preparation of human rotavirus vaccines.

[0030] The present invention also provides the application of the human-ovine rotavirus reassortant virus strain in the development as a vector.

[0031] By adopting the above technical solutions, the present invention has the following beneficial effects: The present invention provides 8 human-ovine rotavirus recombinant plasmids, namely pT7-VP7 / Hu01(G1), pT7-VP7 / Hu02(G2), pT7-VP7 / Hu03(G3), pT7-VP7 / Hu04(G4), pT7-VP7 / Hu05(G8), pT7-VP7 / Hu06(G9), pT7-VP4 / Hu02(P[4]) and pT7-VP4 / Hu06(P[8]), which are respectively shown in SEQ ID NO:1 to SEQ ID NO:8. The present invention provides human-ovine reassortant rotaviruses containing VP7 and / or VP4 of human rotavirus epidemic strains, which can be used to develop human rotavirus vaccines with multiple formulations, filling the gap that the main antigens of the existing rotavirus vaccines in China do not match the main epidemic strains in China; it can also customize the development of corresponding formulations of rotavirus vaccines according to local epidemic types and population characteristics. Description of the Drawings

[0032] Figure 1 It is a genetic evolution analysis diagram of the VP4 gene of the prevalent strain. The strains marked in red are the prevalent strains used for reassortment in the present invention.

[0033] Figure 2 It is a genetic evolution analysis diagram of the VP7 gene of the prevalent strain. The strains marked in red are the prevalent strains used for reassortment in the present invention.

[0034] Figure 3 It is the comparison of amino acid sites of surface-exposed antigen epitopes of prevalent strains and vaccine strains Rotarix and RotaTeq in China; among them, A is the VP8 * antigen epitope; B is the VP7 antigen epitope; S is serine; E is glutamic acid; N is asparagine; D is aspartic acid; the yellow background represents the difference from Rotarix; the green background represents the amino acid sites different from RotaTeq; the blue background represents the difference from both Rotarix and RotaTeq.

[0035] Figure 4 It is a schematic diagram of the construction of the LLR genomic infectious clone plasmid (Note: The full-length cDNA of 11 LLR genomic fragments is located in the plasmid containing the pT7 promoter, connected to the T7 promoter upstream and the HDV ribozyme downstream to ensure that the full-length LLR(+)RNA has authentic 5' and 3' ends).

[0036] Figure 5 It is a schematic diagram of the construction of the pCMV-868CP helper plasmid.

[0037] Figure 6 It is a schematic diagram of the construction of the plvx-BVDV-N-PIV5-V plasmid.

[0038] Figure 7 It is a diagram of the expression identification results of STAT1 and IRF3.

[0039] Figure 8 It is a morphological diagram of P1 generation MA104 cells after transfection with the LLR infectious clone recombinant plasmid (10×).

[0040] Figure 9 It is a morphological diagram of P1 generation MA104 cells after transfection with the human-sheep reassortment plasmid (10×).

[0041] Figure 10 It is the identification result of the VP7 or VP4 gene reassortant based on the LLR backbone; among them,

[0042] A is the silver staining result of dsRNA-PAGE;

[0043] B is the RT-PCR amplification result.

[0044] Figure 11 The indirect immunofluorescence (10×) after diluting the VP7 or VP4 gene reassortant strain by 10 -5 times.

[0045] Figure 12 are the titers and replication kinetic curves of the VP7 or VP4 gene reassortant strain; where A is the titer of the virus reassortant strain and B is the replication kinetic curve of the virus reassortant strain.

[0046] Figure 13 is the electron micrograph of the human - ovine reassortant virus strain (rLLR) after cesium chloride gradient purification.

[0047] Figure 14 are the IgG antibody titers in the sera of immunized mice, where A is the titer of the specific IgG antibody in the mouse sera and B is the titer of the cross - reactive IgG antibody in the mouse sera.

[0048] Figure 15 is the construction flow chart of the human - ovine rotavirus reassortant virus strain of the present inventor. Detailed implementation manners

[0049] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0050] Experimental reagents:

[0051]

[0052] Experimental instruments and consumables:

[0053]

[0054] Experimental animals:

[0055] 60 Balb / c mice, female, 4 - 6 weeks old, were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. The animal experiment was approved by the Ethics Review Committee of the Chinese Center for Disease Control and Prevention, with the approval number 20220510047.

[0056] Cell lines and virus strains

[0057] MA104 cells (African green monkey embryonic kidney cells), preserved by the Viral Diarrhea Laboratory of the Chinese Center for Disease Control and Prevention, with the passage number of 23.

[0058] HEK - 293T cells (human embryonic kidney cells), preserved by the Viral Diarrhea Laboratory of the Chinese Center for Disease Control and Prevention, with the passage number of 19.

[0059] BHK - T7 / 9 cells are BHK cells (Syrian hamster kidney cells) stably expressing T7 RNAP, with the passage number of 10.

[0060] The rotavirus vaccine strain LLR (G10P

[15] ) is preserved by the Viral Diarrhea Laboratory of the Chinese Center for Disease Control and Prevention and passaged in MA104 cells.

[0061] Plasmid

[0062] Plasmids encoding infectious clones of 11 segments of rotavirus SA11 strain (i.e., pT7-VP1 / SA11, pT7-VP2 / SA11, pT7-VP3 / SA11, pT7-VP4 / SA11, pT7-VP6 / SA11, pT7-VP7 / SA11, pT7-NSP1 / SA11, pT7-NSP2 / SA11, pT7-NSP3 / SA11, pT7-NSP4 / SA11, and pT7-NSP5 / SA11), plasmids encoding vaccinia virus capping enzyme subunits (i.e., pCAG-D1R and pCAG-12L), plasmids encoding the FAST-p10 protein of Nelson Bay virus (i.e., pCAGFAST-p10), plasmid encoding African swine fever virus capping enzyme NP868R (pCMV / NP868R), and plasmid encoding fluorescent protein GFP (pT7-LIET-GFP) were purchased from the Addgene website.

[0063] LLR is the abbreviation of Rotarix, a human vaccine produced by Lanzhou Institute of Biological Products.

[0064] The human-ovine reassortant strain (rLLR) is the abbreviation of the rotavirus formed by the reassortment of human rotavirus and LLR.

[0065] Example 1 Genetic evolution and neutralizing antigen epitope analysis of RVA epidemic strains

[0066] One fecal sample each of G1P[8], G2P[4], G3P[8], G4P[8], G8P[8], and G9P[8] that were positive for rotavirus recheck in 2019 was randomly selected from the sample bank of the Viral Diarrhea Laboratory of the National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, and stored at -20°C for later use. The sample information is shown in Table 1.

[0067] Table 1 Information on RV-positive clinical fecal samples

[0068] Sample Number G / P Genotyping Week Age Province Year Hu01 G1P[8] 56 Jilin 2019 Hu02 G2P[4] 34 Hebei 2019 Hu03 G3P[8] 30 Shandong 2019 Hu04 G4P[8] 62 Sichuan 2019 Hu05 G8P[8] 42 Henan 2019 Hu06 G9P[8] 28 Guangdong 2019

[0069] 1. Viral RNA nucleic acid extraction

[0070] Take 100 μL or a pea-sized amount of the above fecal specimen, add 900 μL of HBSS (1×) balanced salt solution to dilute the fecal specimen into an approximately 10% fecal suspension. Vortex each sample for about 1 min, centrifuge at 13,000 rpm for 5 min, take out 200 μL from the centrifuged virus supernatant, place it in a new EP tube, add 500 μL of Buffer GTC (before use, add 20 μL of β-mercaptoethanol to every 1 mL of Buffer GTC and vortex thoroughly) to fully lyse the cells, extract the total cellular RNA with reference to the OMEGA bio-tek HPT Total RNA Kit instruction manual, and store it at -80 °C for later use.

[0071] 2. Amplification of VP4 and VP7 gene sequences

[0072] Use the universal amplification primers for the VP4 and VP7 genes of RVA epidemic strains to perform RT-PCR amplification on the nucleic acids of 6 fecal samples. The primer sequences are shown in Table 2.

[0073] Table 2 Universal amplification primers for RVA VP4 and VP7 genes

[0074]

[0075] The denaturation reaction system is shown in Table 3:

[0076] Table 3 Denaturation reaction system:

[0077] Component Volume (μL) Forward Primer (10μM) 0.5 Reverse Primer (10μM) 0.5 <![CDATA[ddH2O]]> 2 RNA Template 4 Total 7

[0078] Place it in a PCR instrument, at 98 °C for 5 min, and quickly place it on ice for later use.

[0079] The one-step RT-PCR reaction system is shown in Table 4:

[0080] Table 4 RT-PCR reaction system

[0081] Component Volume (μL) 5×Buffer 6 10μM dNTPs 1 Enzyme Mix 1 Denatured Product 7 <![CDATA[ddH2O]]> 15 Total 30

[0082] The RT-PCR reaction program is shown in Table 5:

[0083] Table 5 RT-PCR reaction program

[0084]

[0085] Agarose gel electrophoresis and gel extraction of the amplified product:

[0086] After mixing in the ratio of 5 μL of PCR product + 1 μL of 6× Loading buffer, 50 μL of RT-PCR product and 2 μL of DNA Marker were loaded onto a 1.5% agarose gel for electrophoresis. Electrophoresis was carried out at 120 V for 30 min. The gel was imaged and the results were observed in a gel imager to obtain the amplification products of rotavirus VP7 and VP4 genes of the above 6 specimens. The gel was cut and gel recovery purification was performed.

[0087] 3. Ligate the pCE2 TA / Blunt-Zero vector

[0088] The above purified product was ligated to the pCE2-TA / Blunt-Zero vector according to the optimal usage amount of [0.05 × number of base pairs of the fragment] ng, and the reaction system was configured as shown in Table 6:

[0089] Table 6 Ligation system of the inserted fragment and the linearized vector

[0090] Component Volume (μL) 5×TA / Blunt-Zero Cloning Mix 1 Gel Extraction Product 1~4 <![CDATA[ddH2O]]> Make up to 5

[0091] Flick the bottom of the tube to mix, and centrifuge at low speed instantaneously to collect all the liquid at the bottom of the 0.2 mL centrifuge tube. Place it in a PCR instrument at 25 °C for 5 min.

[0092] 4. Cell transformation

[0093] (1) TreliefTM 5α competent cells taken out from the -80 °C refrigerator were placed on ice to thaw;

[0094] (2) 5 μL of the ligation product from step 3 was added to the TreliefTM 5α competent cells, and then placed on ice and left standing for 5 min;

[0095] (3) After 45 s in a 42 °C metal bath, it was quickly placed in an ice bath and left standing for 2 min;

[0096] (4) 500 μL of LB liquid medium without antibiotics was added and mixed to obtain a resuscitation solution. Part of the transformed product was spread on a kan+LB medium plate and evenly spread with an L-shaped cell spreading rod. After the liquid dried, the culture dish was inverted and placed in a 37 °C incubator overnight.

[0097] The next day, well-grown clone colonies were separately selected into 1 mL of kan+ liquid LB medium and cultured with shaking at 180 rpm in a 37 °C constant temperature shaker for 7 h.

[0098] After shaking the bacteria, the universal vector primers T7-F and T7ter-R were used for rapid amplification of the bacterial liquid by PCR. The reaction system was as shown in Table 7:

[0099] Table 7 Bacterial liquid PCR system

[0100] Component Volume (μL) 2×Rapid Taq Master Mix 10 T7-F (10μM) 1 T7ter-R (10μM) 1 Bacterial Liquid 1 <![CDATA[ddH2O]]> 7

[0101] 3 min at 95°C, (15 sec at 95°C, 30 sec at 55°C, 15 sec at 72°C / kb) × 35, 5 min at 72°C; For the positive bacterial solution with the correct position in the agarose gel electrophoresis, preserve the bacteria with 50% glycerol and the bacterial solution in a ratio of 1:1. For the remaining bacterial solution, perform plasmid miniprep on the bacterial solution with reference to the plasmid miniprep kit instructions, and send it to Tsingke Biological for sequencing.

[0102] After successful sequencing, the following plasmids were obtained: pCE2 TA / Blunt-VP7 / Hu01(G1), pCE2 TA / Blunt-VP7 / Hu02(G2), pCE2 TA / Blunt-VP7 / Hu03(G3), pCE2 TA / Blunt-VP7 / Hu04(G4), pCE2 TA / Blunt-VP7 / Hu05(G8), pCE2 TA / Blunt-VP7 / Hu06(G9), TA / Blunt-VP4 / Hu02(P[4]), and pCE2 TA / Blunt-VP4 / Hu06(P[8]).

[0103] 5. Genetic evolution and neutralizing antigen epitope analysis

[0104] Use MEGA11.0 software to perform sequence alignment of the VP4 and VP7 genes of the epidemic strains, select the optimized nucleotide substitution model GTR (General Time Reversible) + G (Gamma Distributed), use MEGA11.0 software to reconstruct the phylogenetic tree by the maximum likelihood method (Maximum Likehood, ML), and estimate the number of repetitions of the Bootstrap confidence value as 1000. The results are as Figure 1 、 Figure 2 shown.

[0105] As Figure 1 can be seen, the results of VP4 gene sequencing and genetic evolution analysis show that Hu01 and Hu03 - Hu06 belong to the P[8] genomic group, Hu02 belongs to the P[4] genomic group, and all represent the epidemic characteristics of this genotype in recent years.

[0106] As Figure 2 can be seen, the results of VP7 gene sequencing and genetic evolution analysis show that Hu01, Hu02, Hu03, Hu04, Hu05, and Hu06 belong to the G1, G2, G3, G4, G8, and G9 genomic groups respectively, and represent the epidemic characteristics of this genotype in recent years.

[0107] The amino acid neutralizing antigenic epitopes of the prevalent strains, the RVA vaccines Rotarix and RotaTeq strains were analyzed using the BioEdit 4.8.10 software, and the analysis results are as Figure 3 shown.

[0108] As Figure 3 can be seen, the results of the analysis of the VP8 * neutralizing antigenic epitopes of the 6 RV prevalent strains and the vaccine strains showed that: when compared with Rotarix, there were 0, 13, 6, 6, 7, and 6 amino acid site differences respectively; while when compared with RotaTeq, there were 4, 12, 3, 3, 4, and 3 amino acid site differences respectively (as Figure 3 shown in A); the results of the analysis of the VP7 neutralizing antigenic epitopes of the 6 RV prevalent strains and the vaccine strains showed that: when compared with Rotarix, there were 5, 18, 12, 14, 17, and 14 amino acid site differences respectively; while when compared with RotaTeq, there were 2, 1, 1, 1, 7, and 2 amino acid site differences respectively (as Figure 3 shown in B).

[0109] From the evolutionary analysis, it can be seen that the above sequences can fully represent the main dominant genotypes of rotavirus currently prevalent in China.

[0110] Example 2 Construction of recombinant prevalent strain VP4 and VP7 gene plasmids

[0111] Homologous recombination primers were designed using SnapGene software. The plasmids pCE2 TA / Blunt-VP7 / Hu01(G1), pCE2 TA / Blunt-VP7 / Hu02(G2), pCE2 TA / Blunt-VP7 / Hu03(G3), pCE2 TA / Blunt-VP7 / Hu04(G4), pCE2 TA / Blunt-VP7 / Hu05(G8), pCE2 TA / Blunt-VP7 / Hu06(G9), pCE2TA / Blunt-VP4 / Hu02(P[4]), and pCE2 TA / Blunt-VP4 / Hu06(P[8]) prepared in Example 1 were used as templates for PCR amplification of the inserted fragments, and the plasmid pT7-VP1 / LLR was used as the template for PCR amplification of the vector fragment. The primer sequences are shown in Table 8.

[0112] Table 8 PCR amplification primers for the infectious clone plasmids of the prevalent strain VP4 and VP7 genes

[0113]

[0114] After amplification, the positive fragment was recovered by gel extraction → homologous recombination → transformation → shaking culture → colony PCR amplification → mini-prep plasmid → sequencing identification → maxi-prep plasmid → supercoiled structure verification. Among them, the steps of positive fragment gel extraction, homologous recombination, transformation, shaking culture, colony PCR amplification, mini-prep plasmid, and sequencing identification were the same as those in Example 1. After colony PCR amplification, the positive bacterial solution with the correct position in the agarose gel electrophoresis was preserved with 50% glycerol and the bacterial solution in a ratio of 1:1 and numbered.

[0115] For the positive plasmid with correct sequencing identification, inoculate 300 mL of Amp+ LB liquid medium with the preserved bacterial solution of the corresponding number above in a ratio of 1:1000, and culture it overnight with shaking at 230 rpm. The next day, use the QIAGEN endotoxin-free plasmid extraction kit for large-scale plasmid extraction. The specific operation steps are as follows:

[0116] Experiment preparation: Add RNaseA and lyseBlue to Buffer P1, invert and mix well, and store at 2 - 8 °C; pre-cool Buffer P3 at 4 °C; prepare endotoxin-free sterile water containing 70% ethanol.

[0117] Pour 300 mL of the overnight cultured bacterial solution into a wide-mouth centrifuge bottle for balancing, centrifuge at 4 °C and 6000 rpm for 30 min to precipitate the bacterial cells to the bottom of the bottle, discard the supernatant, and invert it on the absorbent paper.

[0118] Pipette 8 mL of Buffer P1 into the centrifuge bottle, use a 10 mL pipette to blow and mix the bacterial cell precipitate, and transfer it into a 50 mL centrifuge tube. Then add 2 mL of Buffer P1 to wash the bottle wall and transfer it into the 50 mL centrifuge tube. At this time, the bacterial cells should become viscous.

[0119] Add 10 mL of Buffer P2 to the centrifuge tube, gently invert and mix well. At this time, the bacterial cells should be blue, and let it stand at room temperature for 5 min.

[0120] Add 10 mL of pre-cooled Buffer P3 to the centrifuge tube, gently invert and mix well. At this time, the bacterial cells should be white flocculent. Let it stand at room temperature for 10 min to fully lyse the bacterial cells, and centrifuge at 4 °C and 8000 rpm for 10 min.

[0121] Pour the supernatant into the filtration device and use the piston to pump the supernatant into a new 50 mL centrifuge tube.

[0122] Endotoxin removal: Add 2.5 mL of Buffer ER to the 50 mL centrifuge tube, invert and mix well, and let it stand on ice for 30 min.

[0123] Column equilibration: Add 10 mL of Buffer QBT to the QIAGEN-tip adsorption column to equilibrate the column.

[0124] DNA adsorption: Pour the liquid in step 7 into the balanced QIAGEN-tip adsorption column and let it flow statically.

[0125] Washing: Add 30 mL of Buffer QC to the QIAGEN-tip adsorption column and wash it twice.

[0126] Elution: Transfer the QIAGEN-tip adsorption column into a new 50 mL centrifuge tube, add 15 mL of Buffer QN, and let it flow statically to elute the plasmid DNA.

[0127] DNA precipitation: Add 10.5 mL of isopropanol to the eluted liquid, invert and mix well, centrifuge at 9000 rpm for 45 min at 4°C.

[0128] DNA dissolution: Air-dry the plasmid DNA in a biosafety cabinet, add 400 μL of Buffer TE, and let it stand at room temperature for 2 h to dissolve the plasmid.

[0129] Use NanoDrop to measure the plasmid concentration, adjust the concentration of the extracted plasmid to 1 μg / μL with Buffer TE. At this time, the 260 / 280 absorbance ratio ≈ 1.8. Electrophoresis on a 0.8% agarose gel should mainly show a supercoiled structure. Aliquot the verified plasmid into 20 μL per tube and store it at -20°C for later use.

[0130] Finally, construct the target plasmids pT7-VP7 / Hu01(G1), pT7-VP7 / Hu02(G2), pT7-VP7 / Hu03(G3), pT7-VP7 / Hu04(G4), pT7-VP7 / Hu05(G8), pT7-VP7 / Hu06(G9), pT7-VP4 / Hu02(P[4]), and pT7-VP4 / Hu06(P[8]).

[0131] The sequences of the plasmids are shown as SEQ ID NO:1 to SEQ ID NO:8.

[0132] Example 3 Preparation of human-sheep reassortant strain (rLLR)

[0133] Amplification of the full genome of LLR rotavirus

[0134] For the whole-genome amplification of LLR, first, 5' / 3' RACE was used to confirm the 5' / 3' ends of each genome. Secondly, according to the results of 5' / 3' RACE, LLR-specific primers were designed for full-length genome amplification. For the relatively long fragments of VP1 (3302 bp), VP2 (2687 bp), and VP3 (2592 bp), 4 pairs, 4 pairs, and 3 pairs of primers were used for RT-PCR amplification respectively, and 1 pair of primers was used for RT-PCR amplification of the remaining 8 fragments.

[0135] 1. Extraction of viral RNA

[0136] The LLR virus solution was completely dissolved on ice, centrifuged at 3000 rpm for 10 min at 4°C to remove cell debris, and the genome of LLR was extracted according to the instructions of the viral RNA extraction kit and stored at -20°C.

[0137] 2. Denaturation

[0138] The LLR dsRNA extracted in step 1 was placed in a PCR instrument at 98°C for 5 min. After denaturation, the ssRNA was unstable and needed to be immediately placed on ice.

[0139] 3. Adding Poly(A) tail to the 3' end of ssRNA, the reaction system is as follows:

[0140] Table 9 Reaction system

[0141] Component Dosage (μL) Final Concentration 10×Poly(A) Polymerase 6 1× E.coli Poly(A) Polymerase (5U / μL) 6 0.05 - 0.5U / μL ATP (10mM) 3 0.5mM ssRNA 60 500ng / μL

[0142] Place it in a PCR instrument and react at 37°C for 30 min.

[0143] 4. Isolation of poly(A)+RNA from total RNA by magnetic separation method

[0144] Screen poly(A)+RNA with reference to the instructions of VAHTS mRNA Capture Beads. The specific steps are as follows:

[0145] (1) Add 200 μL of poly(A)-tailed mRNA to an RNase-free centrifuge tube, add 500 μL of Buffer VL, vortex for 15 - 30 sec, and centrifuge the mixture instantaneously to collect it at the bottom of the tube.

[0146] (2) Place the FastPure RNA Columns in 2 mL Collection Tubes, transfer the above mixture to the FastPure RNA Columns, centrifuge at 12,000 rpm for 1 min, and discard the filtrate.

[0147] (3) Add 600 μL of Buffer RW to the FastPure RNA Columns and centrifuge at 12,000 rpm for 30 sec; discard the filtrate.

[0148] (4) Repeat step 3.

[0149] (5) Centrifuge the empty column at 12,000 rpm for 2 min.

[0150] (6) Carefully transfer the FastPure RNA Columns to new 1.5 mL RNase-free Collection Tubes, add 30 μL of RNase-free ddH₂O to the center of the membrane in a suspended manner, let it stand at room temperature for 1 min, and centrifuge at 12,000 rpm for 1 min.

[0151] (7) Discard the FastPure RNA Columns and store the poly(A)+RNA at -20 °C for future use.

[0152] 5.5' / 3' RACE

[0153] Refer to the LLR genomic sequences (accession numbers: JQ013502 - JQ013504, JQ013506, JQ031150, HM800948, JQ031145 - JQ031148, JQ031151) uploaded by Lanzhou Institute of Biological Products to GenBank. Use the Novoprotein 5' / 3' RACE GSP primer online design software Primer design (appbi.vazyme.com:8085) to randomly design 1 - 2 specific primers for the 5' / 3' ends of each gene fragment, named LLR - fragment name - 51(52) / 31(32) respectively. The primer sequences are shown in Table 10 and are synthesized by Tsingke Biological.

[0154] Table 10 Primers for amplifying the LLR 5' / 3' end sequences

[0155]

[0156]

[0157] (1) The pre-denaturation reaction system is as follows: 100 ng of RNA, 2 μL of 5' GSP Primer (5' RACE) and 3' CDS Primer (3' RACE), 2 μL of dNTP Mix, and make up to 13 μL with RNase-free ddH₂O.

[0158] Place it in a PCR instrument, react at 70 °C for 3 min, and immediately place it on ice.

[0159] (2) The reverse transcription reaction system is as shown in Table 11:

[0160] Table 11 Reverse transcription system

[0161] Component 5'RACE (μL) 3'RACE (μL) Pre-denatured Product 13 14 5×FS Buffer 4 4 10×Enzyme Mix 2 2 5’TS Oligo 1 0 Total 20 20

[0162] Place in a PCR instrument, react at 42°C for 90 min, then at 70°C for 15 min, and immediately place on ice.

[0163] (3) The PCR amplification reaction system was as follows: 5'RACE-Ready cDNA 2.5 μL, 5'GSP (10 μM) 1 μL, 10×Universal Primer Mix 5 μL, 2×PCR Mix 25 μL, ddH2O 16.5 μL, Total 50 μL.

[0164] The PCR amplification reaction conditions were as follows: pre-denaturation (98°C, 1 min), denaturation (98°C, 10 s), annealing (68°C, 15 s), extension (72°C, 3 min), 25 cycles, and total extension (72°C, 5 min).

[0165] (4) Nested PCR amplification

[0166] Take 5 μL of the amplified product in step (3) as a template and use the Nested Primer provided in the kit for nested PCR amplification. The reaction system is as follows: 5 μL of the amplified product in step (3), 1 μL of 5' / 3' GSP (10 μM), 1 μL of Nested Primer, 25 μL of 2×PCR Mix, 18 μL of ddH2O, and 50 μL of Total.

[0167] The PCR amplification reaction conditions are the same as step (3).

[0168] (5) Agarose gel electrophoresis and gel recovery of amplified products

[0169] After mixing at a ratio of 5 μL PCR product + 1 μL 6× Loading buffer, spot 50 μL PCR product and 2 μL DNA Marker together on 1.5% agarose gel for electrophoresis at 120 V for 30 min. Observe the results on a gel imager, cut the gel for positive products, and perform gel recovery and purification.

[0170] (6) Ligation reaction

[0171] Connect the above purified product to the pCE2-TA / Blunt-Zero vector at the optimal usage amount of [0.05 × number of base pairs of the fragment] ng, and configure the system as follows: 1 μL of 5×TA / Blunt-Zero Cloning Mix, 1 - 4 μL of the gel-extracted product, and make up to 5 μL with ddH2O.

[0172] Flick the bottom of the tube to mix well, and centrifuge at low speed for a short time to collect all the liquid at the bottom of the 0.2 mL centrifuge tube. Place it in a PCR instrument at 25°C for 5 minutes.

[0173] (7) Cell transformation

[0174] ① Take out the TreliefTM 5α competent cells from the -80°C refrigerator and thaw them on ice.

[0175] ② Add 5 μL of the ligation product from step (6) to the TreliefTM 5α competent cells, place it in ice, and let it stand for 5 minutes.

[0176] ③ After 45 seconds in a 42°C metal bath, quickly place it in an ice bath and let it stand for 2 minutes.

[0177] ④ Add 500 μL of LB liquid medium without antibiotics, mix well to obtain the recovery solution, and spread part of the transformed product on a kan+LB

[0178] culture medium plate. Use an L-shaped cell spreader to spread it evenly. After the liquid dries, invert the culture dish and place it in a 37°C incubator overnight.

[0179] (8) Pick colonies, perform plasmid miniprep, and sequencing

[0180] The next day, pick well-growing colony clones into 1 mL of kan+ liquid LB medium, shake culture at 37°C in a constant-temperature shaker at 180 rpm for 7 hours. Refer to the plasmid miniprep kit instructions to perform plasmid miniprep on the bacterial solution, and send it to Tsingke Biological for sequencing.

[0181] 6. RT-PCR amplification

[0182] According to the results of 5' / 3' RACE amplification, use Snapgene software to design primers for full-length amplification of the LLR genome. The primer sequences are shown in Table 12, synthesized by Tsingke Biological, and use the above-extracted LLR RNA for RT-PCR amplification.

[0183] Table 12 Primers for RT-PCR amplification of the LLR genome

[0184]

[0185]

[0186] (1) The denaturation reaction system is as follows: Forward Primer (10 μM) 0.5 μL, Reverse Primer (10 μM) 0.5 μL, ddH2O 2 μL, RNA template 4 μL, Total 7 μL.

[0187] Place it in a PCR instrument at 98 °C for 5 min, and quickly place it on ice for standby.

[0188] (2) The one-step RT-PCR reaction system is as follows: 5×Buffer 6 μL, 10 μM dNTPS 1 μL, Enzyme Mix 1 μL, denatured product 7 μL, ddH2O 15 μL, Total 30 μL.

[0189] (3) RT-PCR reaction procedure:

[0190] Table 13 RT-PCR reaction procedure

[0191]

[0192]

[0193] Refer to the above operation steps, perform agarose gel electrophoresis, gel extraction, ligation, transformation, colony picking, shaking culture, and plasmid miniprep on the RT-PCR amplification products, and send them to Tsingke Biological for sequencing. For the positive clone plasmids pCE2 TA / Blunt-VP4 / LLR, pCE2TA / Blunt-VP6 / LLR, pCE2 TA / Blunt-VP7 / LLR, pCE2 TA / Blunt-NSP1 / LLR, pCE2TA / Blunt-NSP2 / LLR, pCE2 TA / Blunt-NSP3 / LLR, pCE2 TA / Blunt-NSP4 / LLR, and pCE2 TA / Blunt-NSP5 / LLR with correct sequencing results, store them at -20 °C.

[0194] (7) Sequence result analysis

[0195] Use the Snapgene software to assemble the 5' / 3' RACE sequencing results and RT-PCR amplification sequencing results of each fragment, and a total of 11 complete LLR genomic sequencing results with accurate 5' / 3' ends are obtained.

[0196] Experimental results: Using the LLR dsRNA genome as a template, the results of 5' / 3' RACE and RT-PCR amplification and cloning sequencing of 11 fragments were assembled. After alignment and analysis with the SnapGene software, it was found that there were 20 nucleotide sites different between the full-genome sequence of LLR obtained in this study and the full-genome sequences of LLR uploaded by Lanzhou Institute of Biological Products to GenBank (accession numbers: JQ013502~JQ013504, JQ013506, JQ031150, HM800948, JQ031145~JQ031148, JQ031151). These different sites were located at the 5'-ends of the fragments VP2, VP3, NSP3 and NSP5 and the 3'-ends of the fragments VP1, VP4, VP7 and NSP1. There were no differences in the ORF region sequences. The sequence information of the specific different sites is shown in Table 14. The full-genome sequence of LLR obtained in this invention has been uploaded to GenBank, and the accession number is: OQ603388 - OQ603398.

[0197] Table 14 Sequences of different nucleotide sites at the 5' / 3'-ends of the LLR strain

[0198]

[0199]

[0200] Construction of 11 infectious clone plasmids of LLR

[0201] To ensure that the infectious clone plasmids of LLR can generate precise 5' and 3' ends during transcription, a T7 promoter was ligated to the 5'-end of each LLR genome, and an HDV ribozyme was ligated to the 3'-end. The schematic diagram of plasmid construction is shown in Figure 4 。

[0202] 1. Primer design

[0203] First, using the pT7-VP1 / SA11 plasmid as the template for PCR amplification of the vector fragment, design the vector amplification primers ZT-pT7-SA11-F / R. Second, for the relatively long inserted fragments VP1 (3302 bp), VP2 (2687 bp), and VP3 (2592 bp), use the plasmid pUC-VP1 / LLR, pUC-VP2 / LLR, and pUC-VP3 / LLR synthesized by Genewiz as the templates. For the remaining 8 fragments, use the plasmids pCE2 TA / Blunt-VP4 / LLR, pCE2 TA / Blunt-VP6 / LLR, pCE2 TA / Blunt-VP7 / LLR, pCE2TA / Blunt-NSP1 / LLR, pCE2 TA / Blunt-NSP2 / LLR, pCE2 TA / Blunt-NSP3 / LLR, pCE2TA / Blunt-NSP4 / LLR, and pCE2 TA / Blunt-NSP5 / LLR prepared above as templates, design the PCR amplification primers for the inserted fragments, named CR-LLR-fragment name-F / R respectively. The primer sequences are shown in Table 15 (the lowercase sequences are the recombinant sequences added at the 5' end), and hand them over to Tsingke Biological for synthesis.

[0204] Table 15 PCR amplification primers for the construction of 11 LLR infectious clone plasmids

[0205]

[0206]

[0207]

[0208] 2. The PCR reaction system is as follows: 2×PhantaMax Master Mixs 25 μL, F (10 μM) 1 μL, R (10 μM) 1 μL, plasmid DNA 1 μL, ddH2O 22 μL, Total 50 μL.

[0209] Amplification conditions: 95°C for 3 min; 95°C for 15 s, 55°C for 15 s, 72°C for 1 min / kb; a total of 35 cycles; 72°C for 5 min. Refer to the above operation steps for agarose gel and gel extraction and purification.

[0210] 3. Homologous recombination

[0211] Configure the reaction system on ice according to the optimal ratio of 0.03 pmol of the linearized vector and 0.06 pmol of the inserted fragment: 0.03 pmol of the linearized vector, 0.06 pmol of the inserted fragment, 4 μL of 5×CE Buffer, 2 μL of ExnaseⅡ, and make up to 20 μL with ddH2O.

[0212] Gently pipette and mix well. To prevent fragment breakage, do not vortex. Place it in a PCR instrument and react at 37°C for 30 min, then immediately cool on ice.

[0213] 4. Transformation, shaking culture, and colony PCR amplification

[0214] Use TreliefTM 5α competent cells to transform the homologous recombination products. Randomly pick 5 colonies from each transformation product for shaking culture, and perform rapid colony PCR amplification using the universal vector primers T7-F and T7ter-R. The reaction system is as follows: 2×Rapid Taq Master Mix 10 μL, T7-F (10 μM) 1 μL, T7ter-R (10 μM) 1 μL, colony solution 1 μL, ddH2O 7 μL.

[0215] 95°C for 3 min, (95°C for 15 sec, 55°C for 30 sec, 72°C for 15 sec / kb) × 35 cycles, 72°C for 5 min; For the positive colony solution with the correct position in agarose gel electrophoresis, preserve the bacteria with 50% glycerol and the colony solution at a ratio of 1:1, and send the remaining colony solution for plasmid miniprep and then to Tsingke Biological for sequencing.

[0216] 5. Plasmid maxiprep

[0217] For the positive plasmids correctly identified by sequencing, inoculate 300 mL of Amp+ LB liquid medium at a ratio of 1:1000 with the corresponding numbered preserved colony solution in step 4, and culture overnight with shaking at 230 rpm. The next day, perform plasmid maxiprep using the QIAGEN endotoxin-free plasmid extraction kit. The specific operation steps are as follows:

[0218] ① Experiment preparation: Add RNaseA and lyseBlue to Buffer P1, invert and mix well, and store at 2 - 8°C; Pre-cool Buffer P3 at 4°C; Prepare endotoxin-free sterile water containing 70% ethanol.

[0219] ② Pour 300 mL of the overnight culture into a wide-mouth centrifuge bottle for balancing, centrifuge at 6000 rpm for 30 min at 4°C to precipitate the bacterial cells to the bottom of the bottle, discard the supernatant, and invert on absorbent paper.

[0220] ③ Pipette 8 mL of Buffer P1 into the centrifuge bottle, use a 10 mL pipette to blow and mix the bacterial cell precipitate, and transfer it into a 50 mL centrifuge tube. Then add 2 mL of Buffer P1 to wash the bottle wall and transfer it into the 50 mL centrifuge tube. At this time, the bacterial cells should become viscous.

[0221] ④ Add 10 mL of Buffer P2 to the centrifuge tube, gently invert and mix well. At this time, the bacterial cells should be blue, and let it stand at room temperature for 5 min.

[0222] ⑤ Add 10 mL of pre-cooled Buffer P3 to the centrifuge tube and gently invert the tube up and down to mix well. At this time, the bacterial cells should be white flocculent. Let it stand at room temperature for 10 min to fully lyse the bacterial cells, then centrifuge at 8000 rpm for 10 min at 4 °C. Pour the supernatant into the filtration device and use the piston to transfer the supernatant into a new 50 mL centrifuge tube.

[0223] ⑥ Remove endotoxin: Add 2.5 mL of Buffer ER to the 50 mL centrifuge tube, invert the tube up and down to mix well, and let it stand on ice for 30 min.

[0224] ⑦ Column equilibration: Add 10 mL of Buffer QBT to the QIAGEN-tip adsorption column to equilibrate the column.

[0225] ⑧ DNA adsorption: Pour the liquid from step 7 into the equilibrated QIAGEN-tip adsorption column and let it flow through by gravity.

[0226] ⑨ Washing: Add 30 mL of Buffer QC to the QIAGEN-tip adsorption column and wash it twice.

[0227] ⑩ Elution: Transfer the QIAGEN-tip adsorption column into a new 50 mL centrifuge tube, add 15 mL of Buffer QN, and let the plasmid DNA elute by gravity.

[0228] DNA precipitation: Add 10.5 mL of isopropanol to the eluted liquid, invert the tube to mix well, then centrifuge at 9000 rpm for 45 min at 4 °C.

[0229] DNA dissolution: Air-dry the plasmid DNA in the biosafety cabinet, add 400 μL of Buffer TE, and let it stand at room temperature for 2 h to dissolve the plasmid.

[0230] Use NanoDrop to measure the plasmid concentration, and adjust the concentration of the extracted plasmid to 1 μg / μL with Buffer TE. At this time, the 260 / 280 absorbance ratio ≈ 1.8. Electrophoresis on a 0.8% agarose gel should mainly show a supercoiled structure. Aliquot the verified correct plasmid into tubes of 20 μL each and store at -20 °C for later use.

[0231] Finally, 11 plasmids, namely pT7-VP1 / LLR, pT7-VP2 / LLR, pT7-VP3 / LLR, pT7-VP4 / LLR, pT7-VP6 / LLR, pT7-VP7 / LLR, pT7-NSP1 / LLR, pT7-NSP2 / LLR, pT7-NSP3 / LLR, pT7-NSP4 / LLR, and pT7-NSP5 / LLR, are prepared.

[0232] Construction of pCMV-868CP Helper Plasmid

[0233] 1. Amplification of T7 RNA Polymerase Gene

[0234] According to the T7 RNAP gene sequence in NCBI GenBank (GenBank accession number: FJ881694), primers for amplifying the coding region of T7 RNAP were designed. The amplified fragment size was 2652 bp, and the primer sequences are shown in Table 17, which was synthesized by Tsingke Biological.

[0235] Table 17 PCR Amplification Primers for the Coding Region of T7 RNAP Gene

[0236]

[0237] Take a tube of E. coli BL21(DE3) competent cells and thaw them on ice. Add 500 μL of LB liquid medium without resistance and culture at 37 °C on a shaker at 180 rpm for 8 h. Centrifuge at 3000 rpm for 1 min to discard the supernatant, add 10 μL of ddH2O to resuspend the cells, place them in a PCR instrument, denature at 98 °C for 5 min, and immediately place on ice. Use the genomic DNA of E. coli BL21(DE3) as a template for PCR amplification. The reaction system is shown in Table 18:

[0238] Table 18 PCR Amplification System

[0239]

[0240]

[0241] Amplification conditions: 95 °C for 3 min; 95 °C for 15 s, 55 °C for 15 s, 72 °C for 2 min 30 s; a total of 35 cycles; 72 °C for 5 min; identify by agarose gel electrophoresis, cut and recover the positive product, and send it to Tsingke Biological for sequencing.

[0242] 2. Seamless Cloning of Plasmid

[0243] The pCMV-868CP plasmid is a plasmid that uses CMV as a promoter, (G4S)4 as a linker peptide, and fuses and expresses the capping enzyme NP868R of African swine fever virus and T7 RNAP (see Figure 5) First, primers were designed using the pCMV / NP868R plasmid as the template for PCR amplification of the vector fragment, named pCMV / NP868R-F / R. Second, the gel recovery product of T7 RNAP was used as the template for PCR amplification of the inserted fragment. Primers were designed to add the (G4S)4 linker peptide sequence at the 5' end through 2 rounds of PCR amplification, named T7 RNAP-F1(2) / R. The primer sequences are shown in Table 19 (the lowercase sequences are the recombinant sequences added at the 5' end), and they were synthesized by Tsingke Biological Technology. The steps of PCR amplification → agarose gel electrophoresis → gel recovery → homologous recombination → small-scale plasmid identification → large-scale plasmid extraction were completed. The steps of PCR amplification, agarose gel electrophoresis, gel recovery, homologous recombination, small-scale plasmid identification, and large-scale plasmid extraction are the same as those described above.

[0244] Table 19 PCR amplification primers for the construction of pCMV-868CP plasmid

[0245]

[0246] MA104 N * Construction of V engineering cell line

[0247] 1. Construction of plvx-BVDV-N-PIV5-V plasmid

[0248] The pUC-BVDV-N-PIV5-V plasmid was synthesized by Suzhou Genewiz Biotechnology Co., Ltd. The plvx-IRES-Puro vector and the pUC-BVDV-N-PIV5-V plasmid were simultaneously double-digested with the restriction endonucleases XhoⅠ and EcoRⅠ at 37°C in a metal bath for 1 h. The digested products were separated by 1% agarose gel electrophoresis, and the relevant fragments were gel recovered. The ligation was carried out using T4 DNA quick ligase in a metal bath at 25°C for 1 h. The ligation product was transformed into Trelief TM 5α competent cells and inoculated into Amp + LB plate medium for overnight culture. Single colonies were picked from the plate medium, cultured overnight on a shaker at 180 rpm, and plasmids were extracted. The plasmids verified correctly by double digestion were sequenced by Beijing Tsingke Biological Technology Co., Ltd. The schematic diagram of the construction of the plvx-BVDV-N-PIV5-V plasmid is as Figure 6 shown.

[0249] 2. Packaging of lentivirus

[0250] ① Take 293T cells, adjust the cell density to 1×106 / mL after digestion, and inoculate them into 35 mm petri dishes;

[0251] ② After about 18 - 24 h, when the cell confluence reaches over 90%, transfection is carried out. The three packaging plasmids, PMD2.G:psPAX2:plvx - BVDV - N - PIV5 - V, are transfected according to the molar ratio of 2:1:1, referring to the operation instructions of Lipofectamine TM 3000 transfection reagent. After transfection, place it in an incubator at 37°C with 5% CO2;

[0252] ③ After 36 h and 60 h, collect the supernatant and centrifuge at 3000 rpm for 10 min to remove cell debris;

[0253] ④ Concentrate the virus using an Amicon Ultra - 0.5 mL 10K ultrafiltration centrifugal tube and store it at -80°C.

[0254] 3. Lentivirus infection of MA104 cells

[0255] ① Take MA104 cells, adjust the cell density to 4×10 5 / mL after digestion, add 2 mL per well, evenly spread them into a 6 - well plate, and culture at 37°C with 5% CO2;

[0256] ② At 18 - 24 h, when the cell confluence reaches 40% - 50%, carry out infection. Aspirate the medium in the 6 - well plate, replace it with fresh medium, add 100 μL of concentrated lentivirus solution, and add polybrene at a final concentration of 10 μg / mL. Culture at 37°C with 5% CO2 for 12 h;

[0257] ③ Digest the MA104 cells infected with lentivirus (experimental group) and normal MA104 cells (control group) simultaneously and spread them into a new 6 - well plate. After they are completely confluent, change the medium with serum - free medium containing 10 μg / μL puromycin and incubate at 37°C for 48 h;

[0258] ④ During this period, observe the cell growth status. After all the control group cells die, collect the experimental group, inoculate it into a T25 cell culture flask for proliferation, and name it MA104 N * V cells.

[0259] 4. qRT - PCR detection of BVDV - N and PIV5 - V genes

[0260] ① Extract total cellular RNA

[0261] Using normal MA104 cells as a control, respectively take the 5th and 10th generations of MA104 N *Total RNA of V cells was extracted as follows: Discard the cell culture medium in each well, wash the cells twice with PBS, add 500 μL of Buffer GTC (before use, add 20 μL of β-mercaptoethanol to every 1 mL of Buffer GTC and vortex thoroughly), lyse the cells completely, and extract the total RNA of the cells with reference to the instruction manual of OMEGA bio-tek HP Total RNA Kit, and store it at -80 °C for later use.

[0262] ② Detection of RNA transcription of BVDV-N and PIV5-V genes by qRT-PCR

[0263] Design qRT-PCR amplification primers for BVDV-N, PIV5-V and β-actin reference genes using Primer 5.0 software, and send them to Beijing Tsingke Biotechnology Co., Ltd. for synthesis. The primer sequences are shown in Table 20.

[0264] Table 20 qRT-PCR amplification primers for BVDV-Npr, PIV5-Vpr and β-actin reference genes

[0265]

[0266] The reaction system of dye-based qRT-PCR is shown in Table 21:

[0267] Table 21 Reaction system of dye-based qRT-PCR

[0268]

[0269]

[0270] Perform amplification according to the instruction manual of HiScript II One Step qRT-PCR SYBR Green Kit. The reaction conditions are: 50 °C for 15 min, 1 cycle; 95 °C for 30 s, 1 cycle; 95 °C for 10 s, 60 °C for 30 s, 40 cycles.

[0271] Experimental results: As shown in Table 22.

[0272] Table 22 MA104 and MA104 N * qRT-PCR detection results of BVDV-N, PIV5-V and β-actin reference genes in MA104 N V cells

[0273]

[0274] As can be seen from Table 22, taking normal MA104 cells as the control, from passage 5 and passage 10 of MA104 N *Total RNA was extracted from V cells, and qRT-PCR amplification was performed using primers for BVDV-N, PIV5-V, and the β-actin internal reference gene. On the premise that the CT values of the β-actin internal reference gene amplification were consistent, BVDV-N and PIV5-V genes could be detected in both P5 and P10 generations of MA104 N * V cells, but not in normal MA104 cells. The above results indicate that the BVDV-N and PIV5-V genes were successfully introduced into MA104 cells by lentiviral infection and stably integrated into the genome of MA104 cells.

[0275] 5. Detection of the expression of STAT1 and IRF3 proteins by Western blot

[0276] ① One day in advance, normal MA104 cells and MA104 N * V cells in the logarithmic growth phase were seeded in six-well plates and cultured overnight at 37°C with 5% CO2.

[0277] ② When the cell density reached over 90%, the six-well plates were placed in a -20°C refrigerator for freeze-thawing, centrifuged at 1000 rpm for 10 min, and the supernatant was aspirated.

[0278] ③ After washing twice with pre-cooled PBS at 4°C, 100 μL of RIPA cell lysate was added to each tube, pipetted and mixed well, placed on ice for lysis for 1 - 2 min, centrifuged at 13,000 g for 10 min, and the supernatant was taken.

[0279] ④ Sample preparation: After thoroughly mixing 20 μL of protein supernatant with 5 μL of 5×SDS protein loading buffer, it was placed in boiling water at 100°C for 5 - 10 min. Centrifuged at 8000 rpm for 5 min, 10 μL was taken from each for SDS-PAGE electrophoresis, and the remaining protein samples were stored in a -20°C refrigerator.

[0280] ⑤ Membrane transfer: SDS-PAGE electrophoresis was performed using a 10% separating gel. After electrophoresis, the protein gel was carefully cut, the excess part was removed, the appropriately sized PVDF membrane was first activated in methanol solution for 1 - 2 min, and then placed in the equilibration solution. The proteins on the gel were transferred to the PVDF membrane using the wet transfer method.

[0281] ⑥ Blocking: After membrane transfer, it was blocked with freshly prepared 5% skim milk at room temperature for 2 h.

[0282] ⑦ Incubation with primary antibody: The membrane was washed 3 times with 0.1% TBST, 10 min each time. After washing, rabbit anti-monoclonal antibodies against STAT1, IRF3, and GAPDH proteins were incubated at a dilution of 1:1000, placed on a shaker, and incubated overnight at 4°C.

[0283] ⑧ Incubate with secondary antibody: The next day, take out the PVDF membrane, wash it 3 times with 0.1% TBST washing solution for 10 minutes each time. Add HRP-labeled goat anti-rabbit secondary antibody diluted 1:5000, bind with shaking at room temperature for 1 hour, and wash it in the same way with 0.1% TBST to remove the unbound excess antibody.

[0284] ⑨ Development: Prepare Western Lightning Plus-ECL developing solution, evenly add it to the PVDF membrane, expose and image using Tanon 4800 gel imaging system, and observe the bands.

[0285] Experimental results: As Figure 7 shown. Using normal MA104 cells as a control, lyse P10 generation MA104 N * V cells, and detect the inhibition of BVDV-N and PIV5-V proteins in MA104 N * V cells with antibodies against STAT1, IRF3 and the internal reference gene GAPDH respectively. From Figure 7 it can be seen that under the condition of consistent expression level of the internal reference gene GAPDH protein, only trace amounts of STAT1 and IRF3 proteins are expressed in MA104 N * V cells, while a large amount of STAT1 and IRF3 proteins can be seen in normal MA104 cells, indicating that the BVDV-N and PIV5-V genes successfully integrated into the MA104 cell genome by lentivirus infection stably expressed the corresponding proteins, and respectively inhibited the expression of type I interferon-related proteins STAT1 and IRF3 in MA104 cells, which is beneficial to the infection of rotavirus.

[0286] Rescue of human-sheep reassortant virus (rLLR)

[0287] The infectious clone recombinant plasmid group of ovine rotavirus includes: pT7-VP1 / LLRV, pT7-VP2 / LLRV, pT7-VP3 / LLRV, pT7-VP4 / LLRV, pT7-VP6 / LLRV, pT7-VP7 / LLRV, pT7-NSP1 / LLRV, pT7-NSP2 / LLRV, pT7-NSP3 / LLRV, pT7-NSP4 / LLRV and pT7-NSP5 / LLRV;

[0288] Separate replace pT7-VP7 / LLRV in the infectious clone recombinant plasmid group of ovine rotavirus with pT7-VP7 / Hu01 (G1), pT7-VP7 / Hu02 (G2), pT7-VP7 / Hu03 (G3), pT7-VP7 / Hu04 (G4), pT7-VP7 / Hu05 (G8), pT7-VP7 / Hu06 (G9) respectively;

[0289] Replace pT7-VP4 / LLRV with pT7-VP4 / Hu02(P[4]) and pT7-VP4 / Hu06(P[8]) respectively.

[0290] After replacement, an 8-person-sheep rotavirus infectious clone recombinant plasmid group was obtained. Then, the 8-person-sheep rotavirus recombinant plasmid groups were co-transfected into BHK-T7 / 9 cells respectively to obtain 8 reassortant human-sheep rotavirus strains. The specific steps are as follows:

[0291] 1. Plasmid transfection

[0292] (1) One day before transfection, inoculate 7 - 8×10 5 BHK-T7 / 9 cells into a six-well plate and culture for 18 - 24 h until the cell confluence reaches 80% - 90%.

[0293] (2) Rescue the human-sheep reassortant strain (rLLR) using 11 recombinant plasmids. Add the following plasmids to 250 μL Opti-MEM according to the required mass: 11 recombinant plasmids: pT7-VP1 / LLR (0.8 μg), pT7-VP2 / LLR (0.8 μg), pT7-VP3 / LLR (0.8 μg), pT7-VP4 / LLR (or pT7-VP4 / Hu02, pT7-VP4 / Hu06) (0.8 μg), pT7-VP6 / LLR (0.8 μg), pT7-VP7 / LLR (or pT7-VP7 / Hu01, pT7-VP7 / Hu02, pT7-VP7 / Hu03, pT7-VP7 / Hu04, pT7-VP7 / Hu05, pT7-VP7 / Hu06) (0.8 μg), pT7-NSP1 / LLR (0.8 μg), pT7-NSP2 / LLR (2.4 μg), pT7-NSP3 / LLR (0.8 μg), pT7-NSP4 / LLR (0.8 μg), and pT7-NSP5 / LLR (2.4 μg), and the helper plasmid pCMV-868CP (1.6 μg). Add TransIT-LT1 transfection reagent at a ratio of 2 μL / μg. After mixing the plasmid and transfection reagent complex at room temperature and standing for 30 min, add it dropwise to BHK-T7 / 9 cells evenly.

[0294] (3) After 24 h, wash each well 2 times with 3 mL DMEM and add 1.5 mL DMEM incomplete medium (serum-free, containing 10% TPB, 1% NEAA, and 1% L-Gln) to each well. After 48 h, add 1×10 5 MA104 N *V cells were added to the transfected BHK-T7 / 9 cells, and the trypsin concentration in each well was adjusted to 0.5 μg / mL.

[0295] (4) BHK-T7 / 9 and MA104 N * After co-culturing the BHK-T7 / 9 and MA104 N

[0296] V cells for 3 days, the transfected 6-well plate was frozen and thawed 3 times at room temperature and -80 °C. The cells were frozen at -80 °C for at least 4 h and stored at -80 °C, ready for virus inoculation.

[0297] The digested MA104 N * V cells were seeded into a centrifuge tube. After they grew into a confluent monolayer and were ready for virus inoculation, 600 μL of the virus solution that had been frozen and thawed 3 times was taken, and trypsin with a final concentration of 5 μg / mL was added. It was activated in an incubator at 37 °C for 1 h. The medium of MA104 N * V cells in the 6-well plate was discarded, and the cells were washed 3 times with PBS solution. The activated virus solution was inoculated, and the cells were adsorbed in an incubator at 37 °C with 5% CO2 for 2 h, during which they were mixed every 15 min. After 2 h, the adsorption solution in the centrifuge tube was aspirated, and the cells were washed 2 times with PBS solution. Then, DMEM maintenance solution with a final concentration of 2 μg / mL of trypsin (trypsin hydrolyzes VP4 to form VP5 * and VP8 * , which is beneficial for the virus to enter the cells and enhances the infectivity of the virus) was added, and the cells were cultured by slow rotation in a centrifuge tube rack in an incubator at 37 °C with 5% CO2 for 7 - 9 days, or until CPE was observed, as Figure 9 shown.

[0298] Example 4 Identification of the reassortant virus of the human - sheep reassortant strain (rLLR)

[0299] Taking normally cultured MA104 cells as a control, nucleic acid was extracted from the reassortant virus solution of the human - sheep reassortant strain (rLLR) showing CPE (cytopathic effect). First, dsRNA-PAGE silver staining was performed, and the specific operation was as follows:

[0300] The RNA concentration was measured using NanoDrop and adjusted to about 10 ng / μL. The separating gel and stacking gel were prepared in a 50 mL centrifuge tube strictly according to the ratio in Table 24.

[0301] Table 24 Polyacrylamide gel electrophoresis formula (unit: mL)

[0302] Component Stacking Gel (3.5%) Separating Gel (10%) 30% Acrylamide 0.58 1.67 Deionized Water 3.4 2.3 5×TBE 1 1 10% APs 0.035 0.035 TEMED 0.0035 0.0034

[0303] After the glue has solidified, add 1×TBE electrophoresis buffer. Mix 18 μL of viral RNA with 3 μL of 6×Loading buffer and load the sample. Electrophorese at a constant voltage of 80 V for 6 h. After electrophoresis, turn off the power supply, take out the gel, carefully discard the stacking gel, and stain it using a rapid nucleic acid silver staining kit. The specific steps are as follows:

[0304] (1) Rinsing: Place the gel in 100 mL of ultrapure water and wash it twice on a horizontal shaker for 2 min each time.

[0305] (2) Silver staining: Discard the water, add 100 mL of ready-to-use staining solution, and bind it on a horizontal shaker for 5 min.

[0306] The composition of the ready-to-use staining solution is shown in Table 25:

[0307] Table 25 Composition of the staining solution

[0308] Ready-to-use Staining Solution Preparation Volume Volume (mL) Ultra-pure Water 79 Nucleic Acid Silver Staining Sensitizing Solution (10×) 10 Nucleic Acid Silver Staining Accelerating Solution (10×) 10 Nucleic Acid Silver Staining Silver Solution (100×) 1

[0309] (3) Discard the original solution, add 100 mL of ultrapure water, and wash it on a horizontal shaker for 15 s (Note: The washing time with water should not exceed 20 s, otherwise too much silver ion will be washed away, resulting in a decrease in detection sensitivity).

[0310] (4) Development: Discard the water, add 100 mL of silver staining developer solution, and shake it horizontally on a shaker for 3 - 10 min until the desired nucleic acid bands appear. Note: The nucleic acid silver staining acceleration solution has a pungent odor and needs to be operated in a fume hood; the silver staining developer solution should be used within 20 min after preparation.

[0311] The composition of the silver staining developer solution is shown in Table 26:

[0312] Table 26 Silver staining developer solution

[0313]

[0314]

[0315] (5) Termination: Discard the silver staining developer solution, add 100 mL of ultrapure water, and shake it horizontally at room temperature for 3 - 5 min.

[0316] (6) Imaging: Use the Tanon 4800 gel imaging system for white light imaging to observe the bands.

[0317] The silver nitrate staining results are as Figure 10As shown in (A) of the figure, it can be seen from the results of dsRNA-PAGE silver staining that the band positions of the VP7 or VP4 genes of the 8 reassortant viruses are significantly inconsistent with those of the parental strain (LLR). For the VP7 genes of the human-sheep reassortant strains rLLR-VP7Hu01 (G1), rLLR-VP7Hu03 (G3), rLLR-VP7Hu04 (G4), rLLR-VP7Hu05 (G8), and rLLR-VP7Hu06 (G9), and the VP4 gene of the human-sheep reassortant strain rLLR-VP4Hu06 (P[8]), Wa-like band migrations occurred, but their specific positions were not exactly the same; while for the VP7 gene of the human-sheep reassortant strain rLLR-VP7Hu02 (G2) and the VP4 gene of the human-sheep reassortant strain rLLR-VP4Hu02 (P4), DS-1-like band migrations occurred.

[0318] Secondly, RT-PCR amplification was performed using group A rotavirus G genotype or P genotype specific typing primers. The primer sequences are shown in Table 27, and the RT-PCR amplification products were sent to Tsingke Biological for sequencing.

[0319] Table 27-1 Group A rotavirus VP7 or VP4 gene typing primers

[0320]

[0321]

[0322] The RT-PCR amplification results are as Figure 10 shown in (B) of the figure. It can be seen from the results of RT-PCR amplification using the rotavirus G gene typing primers that the human-sheep reassortant strains (rLLR)-VP7Hu01 (G1), (rLLR)-VP7Hu02 (G2), (rLLR)-VP7Hu03 (G3), (rLLR)-VP7Hu04 (G4), (rLLR)-VP7Hu05 (G8), (rLLR)-VP7Hu06 (G9), and the human-sheep reassortant strain (rLLR) showed target bands at around 618 bp, 521 bp, 682 bp, 452 bp, 754 bp, and 179 bp respectively, while the parental strain (LLR) control showed a target band at around 881 bp, and the fragment sizes were all in line with the expected lengths (as Figure 10B), and the sequencing results are exactly the same as the target gene sequence; the RT-PCR amplification of the VP6 gene is consistent with the control of the parental strain (LLR), and the sequencing results show that they are all LLR-VP6 genes. The above research results prove that the VP7 genes of the 6 reassortant viruses are derived from the epidemic strains Hu01, Hu02, Hu03, Hu04, Hu05, and Hu06 respectively, while the VP6 genes are all derived from the parental strain LLR.

[0323] Example 5 Plaque Purification of 8 Human-Sheep Reassortant (rLLR) Virus Strains

[0324] Activate and adsorb the 8 identified reassortant virus solutions. Dilute the activated virus solution by a factor of 10 in equal ratios, with dilution factors of 10 -3 ~10 -7 After adsorption for 2 h, add 2 mL of the first layer of agar overlay to each well of the 6-well plate, prepared as follows: Add an equal volume of 1% agar to 2×MEM culture medium, and add trypsin at a final concentration of 1 μg / mL, dextran at 100 μg / mL, and L-Gln at 2 mmol / L respectively. Add while shaking to mix the adsorption solution and the overlay evenly. After complete solidification, place it in an incubator at 37°C with 5% CO2 and incubate it upside down. After 3 d, lay the second layer of agar overlay. In addition to an equal volume of 2×MEM and 1% agar, add neutral red at a final concentration of 120 μg / mL. After complete solidification, place it in an incubator at 37°C with 5% CO2 and incubate it upside down. Observe the appearance of plaques. After the virus plaques are formed, place the 6-well plate under an inverted fluorescence microscope, mark the areas with cytopathic effects with a marker pen, and pipette the plaque-forming areas into a centrifuge tube containing 1 mL of DMEM medium. Freeze-thaw the virus solution in the centrifuge tube 3 times repeatedly, perform plaque purification again, and repeat the above operations 3 times to obtain the purified reassortant virus, and continuously passage the purified reassortant virus to the P5 generation.

[0325] Example 6 Etiological Characteristic Analysis of Human-Sheep Reassortant Strain (rLLR)

[0326] 1. Determination of the Titer of Reassortant Virus by Indirect Immunofluorescence Assay

[0327] Using the parental strain (LLR) as a control, dilute the P5 generation VP7 gene reassortant virus of the 8 purified human-sheep reassortant strains (rLLR) by a factor of 10 in gradients to a suitable concentration. Add 50 μL of the diluted virus solution to each well (perform 3 replicates for each dilution and take the average value). Infect MA104 cells in a 96-well plate, and determine the titer of the reassortant virus by indirect immunofluorescence assay. The specific steps are as follows:

[0328] (1) Plating: Prepare MA104 cells in the logarithmic growth phase one day in advance to a concentration of 0.5~1×10 5Cell suspension at a density of [quantity] cells / mL was added to a 96-well plate at 100 μL / well and cultured in a 5% CO₂ incubator at 37 °C for 2 days;

[0329] (2) Activation, dilution, and adsorption: 200 μL of the parental strain (LLR) and the human-goat reassortant strain (rLLR) were added to trypsin at a final concentration of 5 μg / mL and activated in a 37 °C incubator for 1 h. Serial 10-fold dilutions were made with trypsin at a final concentration of 0.5 μg / mL to an appropriate concentration. 50 μL of the diluted virus solution was added to each well, and three replicates were set for each dilution. The plate was placed in a 5% CO₂ incubator at 37 °C for adsorption for 2 h;

[0330] (3) Adding maintenance medium: The adsorption solution in the 96-well plate was discarded, and 100 μL of DMEM maintenance medium containing trypsin at a final concentration of 0.5 μg / mL was added to each well. The plate was placed in a 5% CO₂ incubator at 37 °C for culture for 18 - 20 h;

[0331] (4) Fixing cells: The maintenance medium in the 96-well plate was discarded, and the cells were washed once with PBS at 200 μL / well. 150 μL of 4% tissue fixative pre-cooled at 4 °C was added to each well of the 96-well plate and left standing in a 4 °C refrigerator for 10 - 15 min. The 4% tissue fixative was discarded, and the plate was left to air dry at a ventilated place;

[0332] (5) Blocking: Block with 5% bovine serum albumin (BSA) at 37 °C for 1 h at 200 μL / well, and wash three times with PBST;

[0333] (6) Incubating primary antibody: Dilute the VP6 antibody with 1% BSA at a dilution ratio of 1:1500, add 50 μL / well, incubate at 37 °C for 2 h, and wash three times with PBST;

[0334] (7) Incubating secondary antibody: Dilute the FITC-labeled goat anti-rabbit secondary antibody with PBS at a dilution ratio of 1:150, add 50 μL / well, incubate in a 37 °C incubator for 1 h, and store in the dark;

[0335] (8) Microscopic examination: Wash the cells three times with PBST, add PBS solution at 150 μL / well, and place on a fluorescence microscope to select an appropriate excitation light to count the fluorescence numbers of cells with consistent cell morphology and brightness;

[0336] (9) Calculating virus titer: Wells with fluorescence numbers of both replicates at the same dilution within the range of 10 - 100 are the best judgment wells.

[0337] (10) Calculate according to the following formula:

[0338] Virus titer (lgPFU / mL) = lg (average fluorescence number of the best judgment well × dilution factor / virus inoculation volume).

[0339] 2. Plot the replication kinetic curve of the reassortant virus

[0340] Using the parental strain (LLR) as a control, the P5 generation reassortant viruses of 8 purified human - ovine reassortant strains (rLLR) were inoculated into MA104 cells at an MOI of 0.01 PFU / cell. The virus fluids at 24 h, 48 h, 72 h, and 96 h post - infection were collected (3 replicates were made for each time point and the average was taken). After extracting the genomes of the parental strain (LLR) and the human - ovine reassortant strain (rLLR) with reference to the virus RNA extraction kit instructions, the dsRNAs of the parental strain (LLR) and the human - ovine reassortant strain (rLLR) were placed in a PCR instrument at 98 °C for 5 min for denaturation. After denaturation, the ssRNA was unstable and needed to be immediately placed on ice. Then, using the real - time fluorescence quantitative RT - PCR detection method based on the LLR NSP1 gene, the primer sequences are shown in Table 27, and the amplification was carried out according to the HiScript II One Step qRT - PCR Probe Kit instructions. The reaction conditions were: 50 °C for 5 min, 1 cycle; 95 °C for 20 s, 1 cycle; 95 °C for 3 s, 60 °C for 30 s (fluorescence collection), 40 cycles, and indirect immunofluorescence was as Figure 11 shown. Calculate the virus titer according to the fluorescence, and the results are as Figure 12 shown in A of; Calculate the GCEs of the 3 viruses at different time points and plot the replication kinetic curve, as Figure 12 shown in B of.

[0341] Table 28 Primers for LLR Real - Time PCR identification

[0342]

[0343] As can be seen from Figure 12 A of, after adding the fluorescent secondary antibody, the fluorescent focus - forming units of the 8 human - ovine reassortant strains (rLLR) reassortant viruses were observed under the microscope. The results showed that for the 6 VP7 gene reassortant viruses, there were 26, 18, 22, 25, 28, and 32 fluorescent foci on average in the 10 -5 wells on average respectively, and for the 2 VP4 gene reassortant viruses, there were... in the 10 -4The average number of fluorescent foci in the holes was 36 and 44 respectively. Substituting into the formula for calculation, the titers of the human - ovine reassortant strains rLLR - VP7Hu01(G1), rLLR - VP7Hu02(G2), rLLR - VP7Hu03(G3), rLLR - VP7Hu04(G4), rLLR - VP7Hu05(G8), rLLR - VP7Hu06(G9), rLLR - hVP4 / Hu02(P[4]) and rLLR - hVP4 / Hu06(P[8]) were 5.25×10 7 PFU / mL, 3.63×10 7 PFU / mL, 4.37×10 7 PFU / mL, 4.89×10 7 PFU / mL, 5.60×10 7 PFU / mL, 6.46×10 7 PFU / mL, 3.63×10 6 PFU / mL and 7.95×10 6 PFU / mL. The results showed that: the titers of the 6 VP7 gene reassortant viruses had almost no difference from those of the parental strain (LLR) (7.08×10 7 PFU / mL); while the titers of the 2 VP4 gene reassortant viruses were lower than those of the parental strain (LLR) (7.08×10 7 PFU / mL).

[0344] As can be seen from B in Figure 12 , the calculation results of the GCEs of the 8 reassortant viruses and the parental strain (LLR) (MOI 0.01 PFU / cell) at different time points showed that at 48 h post - infection, the replication of all 9 viruses entered the plateau phase: the 6 VP7 gene reassortant viruses all showed replication kinetic curves extremely similar to those of the parental strain (LLR); while the genomic copy numbers of the 2 VP4 gene reassortant viruses at 48 h, 72 h and 96 h post - infection were slightly lower than those of the parental strain (LLR).

[0345] Example 7 Concentration and Purification of the Reassortant Viruses of the Human - Ovine Reassortant Strain (rLLR)

[0346] 1. Six harvested VP7 gene reassortant viruses (human-sheep reassortant rLLR-hVP7 / Hu01, human-sheep reassortant rLLR-hVP7 / Hu02, human-sheep reassortant rLLR-hVP7 / Hu04, and human-sheep reassortant rLLR-hVP7 / Hu06) and two VP4 gene reassortant viruses (human-sheep reassortant rLLR-hVP4 / Hu02 and human-sheep reassortant rLLR-hVP4 / Hu06) were inoculated into MA104 cells in large quantities at a certain ratio for virus amplification. When about 90% of the cells showed CPE, the viruses were harvested, repeatedly frozen and thawed three times between -80°C and room temperature, centrifuged at 4000 rpm for 20 min to remove cell debris, and sodium chloride and PEG8000 were added dropwise to final concentrations of 200 mM and 10% (W / V) respectively, and the viruses were precipitated by stirring overnight at 4°C.

[0347] 2. The next day, centrifuge at 8000 rpm for 30 min, discard the supernatant, resuspend the concentrated virus solution in 8 mL of PBS overnight at 4°C, centrifuge at 8000 rpm for 30 min after dissolving overnight at 4°C to remove insoluble components.

[0348] 3. Pipette 1.8 - 2 mL of 1.4 g / mL CsCl solution and add it along the bottom into the ultracentrifugation tube. Slowly add 1.8 - 2 mL of 1.2 g / mL CsCl close to the liquid surface of 1.4 g / mL CsCl into the ultracentrifugation tube using a 200 μL pipette. An obvious gradient stratification can be seen, and then take 4 mL of virus supernatant and slowly add it along the liquid surface.

[0349] 4. Place the ultracentrifugation tube into the ultracentrifugation rotor, strictly balance according to 1-4, 2-3 (error < 0.01 g, add DMEM to balance, and the empty tube also needs to be balanced), and set the centrifugation parameters: 25000 rpm, centrifuge at 4°C for 2.5 h, acceleration rate 3, deceleration rate 4 mode. After centrifugation, carefully take out the ultracentrifugation tube, and two obvious upper and lower white virus bands can be seen at the bottom. Among them, the upper band is the RV virus with incomplete packaging, and the lower band is the required RV virus with complete packaging.

[0350] 5. Wipe the ultracentrifugation tube with alcohol and place it in the biosafety cabinet. Use a 1 mL syringe to carefully pierce the tube wall below the lower band (rotate the needle and insert it), suck out the virus band, and place it on ice for standby.

[0351] 6. Install the chromatography column, add 6 mL of desalting gel into the column. Wait until the liquid drains completely (observe the column surface to make the final height of the desalting gel about 4 cm). Add sterile PBS and wash 3 times to keep the liquid level of the desalting gel horizontal. After the PBS drains completely, carefully add the collected virus solution along the inner wall of the chromatography column and collect it in 1.5 mL EP tubes. After draining, add 2 - 4 mL of PBS for elution again. Aliquot the collected virus solution at 50 μL per tube and measure the virus titer after concentration and purification by indirect immunofluorescence assay.

[0352] Take 10 μL of the purified parental strain (LLR), human - ovine reassortant strain rLLR - VP7Hu01 (G1), human - ovine reassortant strain rLLR - VP7Hu02 (G2), human - ovine reassortant strain rLLR - VP7Hu03 (G3), human - ovine reassortant strain rLLR - VP7Hu04 (G4), human - ovine reassortant strain rLLR - VP7Hu05 (G8), human - ovine reassortant strain rLLR - VP7Hu06 (G9), human - ovine reassortant strain rLLR - hVP4 / Hu02 (P[4]) and human - ovine reassortant strain rLLR - hVP4 / Hu06 (P[8]) for transmission electron microscopy observation. The results are as Figure 13 shown, and it can be seen from Figure 13 that after purification, uniform - sized and high - purity rotavirus particles can be obtained from the 9 groups of samples, which can be used for subsequent experiments.

[0353] Example 8 Animal Immunization

[0354] 1. Animal Immunization and Specimen Collection

[0355] Randomly divide 60 Balb / c mice into 10 groups: PBS group, LLR group, G1 group (human - ovine reassortant strain rLLR - hVP7 / Hu01), G2 group (human - ovine reassortant strain rLLR - hVP7 / Hu02), G3 group (human - ovine reassortant strain rLLR - hVP7 / Hu03), G4 group (human - ovine reassortant strain rLLR - hVP7 / Hu04), G8 group (human - ovine reassortant strain rLLR - hVP7 / Hu05), G9 group (human - ovine reassortant strain rLLR - hVP7 / Hu06), P[4] group (human - ovine reassortant strain rLLR - hVP4 / Hu02) and P[8] group (human - ovine reassortant strain rLLR - hVP4 / Hu06), with 6 mice in each group. Adjust the virus titer to 5.0×10 7 PFU / mL and immunize the mice via intraperitoneal injection, 100 μL per mouse. Boost with one injection at an interval of 3 weeks. Three weeks after each immunization, collect blood from the cheek of the mice. Immunize continuously for 3 times. Let the collected blood samples stand at room temperature for 2 h, centrifuge at 3000 g for 30 min, take the supernatant (avoid taking blood cells), aliquot and store at - 80 °C, avoiding repeated freezing and thawing, for ELISA detection.

[0356] 2. Detection of mouse IgG antibodies by indirect ELISA

[0357] ELISA plates were coated with the preliminarily purified parental strain (LLR) and 8 reassortant virus solutions as antigens, 100 μL per well, and coated overnight at 4°C. After blocking with 2% BSA at 37°C for 2 h, sera with an initial dilution factor of 1:50 and serially diluted 3-fold were added, and the sera from pre-immunized mice were used as negative controls and diluted proportionally. Incubation was carried out at 37°C for 1 h. HRP-labeled goat anti-mouse IgG was added at a dilution factor of 1:60000 and incubated at 37°C for 1 h. After washing the plates, TMB chromogenic solution was added and allowed to react in the dark at room temperature for 10 min. Finally, 2 mol / L sulfuric acid was added to terminate the reaction, and the absorbance was measured at a wavelength of 450 nm using an enzyme-linked immunosorbent assay reader.

[0358] When the A450 value of the sample well was more than 2.1 times higher than that of the negative control well and greater than 0.1, it was judged as positive. The antibody titers were logarithmically transformed for statistical analysis. All data were statistically analyzed using One-way ANOVA in Graphp Prism 9.0 software. P < 0.05 was considered to have statistical significance, and the results were as Figure 14 shown. The detection results of IgG specific antibodies ( Figure 14 A in) showed that after the primary immunization, mice in each experimental group produced specific IgG antibody titers against the corresponding genotypes, showing a gradually increasing trend with the increase in the number of immunizations. There was no statistical difference among the experimental groups, but there was a significant difference compared with the PBS control group (P < 0.001).

[0359] After 3 immunizations (at the 9th week), the detection results of cross-reactive IgG antibodies in mouse sera ( Figure 14 B in) showed that each experimental group produced high-titer specific and cross-reactive IgG antibodies against the corresponding genotypes and other genotypes, and there was a significant difference compared with the LLR control group (P < 0.001).

[0360] As can be seen from the above examples, the present invention provides 8 human-ovine rotavirus recombinant plasmids. Using the 8 human-ovine rotavirus recombinant plasmids, 8 human-ovine rotavirus reassortant strains were successfully prepared through the ovine rotavirus (LLR) reverse genetics system, filling the blank that the rotavirus vaccine strains in China do not include epidemic strain G genotypes (G1-G4, G8, G9) and P (P[4], P[8]) genotypes.

[0361] >pT7-VP7 / Hu01(G1)(SEQ ID NO:1)

[0362] CGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGT

[0363] CAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCC

[0364] GCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGT

[0365] GTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAG

[0366] ATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTT

[0367] TCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGAC

[0368] GCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAA

[0369] AGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAA

[0370] CTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGC

[0371] CTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGG

[0372] CAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGA

[0373] GGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCC

[0374] GGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACA

[0375] CGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTG

[0376] GTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAG

[0377] GTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCG

[0378] TAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACC

[0379] GCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCG

[0380] CAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACAT

[0381] ACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAG

[0382] ACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACG

[0383] ACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACA

[0384] GGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTA

[0385] TAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGG

[0386] AAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGT

[0387] TATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGA

[0388] GCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATT

[0389] CATTAATGCAGGGGGATATCGATCCCGGGTTAATACGACTCACTATAGGCTTTAAAAGAGAGAATTTCCGTCTGGC

[0390] TAACGGTTAGCTCCTTTTAATGTATGGTATTGAATATACCACAATTCTAATCTTTCTGATATCAATCATTCTACTC

[0391] AACTATATATTAAAATCAGTGACCCGAATAATGGACTACATTATATATAGATTTTTGTTGATTTCTGTAGCATTAT

[0392] TTGCCTTAACTAAAGCTCAGAACTATGGACTTAATATACCAATAACAGGATCAATGGATACTGTATACTCAAACTC

[0393] TACTCAAGAAGAAGTGTTTCTAACATCCACACTATGTTTGTATTATCCAACTGAAGCAAGTACTCAAATCAGTGAT

[0394] GGTGAATGGAAAGAATCATTATCACAAATGTTTCTTACAAAAGGTTGGCCAACAGGCTCAGTCTATTTTAAAGAGT

[0395] ATTCAAATATTGTTGATTTCTCCGTTGATCCACAATTATATTGTGATTATAACTTAGTACTAATGAAGTGTGATCA

[0396] AAATCTTGAATTAGATATGTCAGAACTAGCTGATTTGATATTGAATGAATGGTTATGTAATCCAATGGATATAACA

[0397] TTATATTATTATCAACAATCGGGAGAATCGAATAAATGGATATCAATGGGATCATCATGTACTGTAAAAGTGTGTC

[0398] CACTGAATACACAAACGTTAGGAATAGGTTGTCAAACAACGAATGTAGACTCATTTGAAACAGTTGCTGAGAATGA

[0399] AAAATTAGCTATAGTGGATGTCGTTGATGGAATAAATCATAAAATAAATTTGACAACTACAACATGTACTATTCGA

[0400] AATTGTAAGAAGTTAGGTCCAAGAGAGAATGTGGCTGTAATACAAGTTGGTGGCTCTAATGTGTTAGATATAACAG

[0401] CAGATCCAACAACTAATCCACAAATTGAGAGAATGATGAGAGTGAATTGGAAAAGATGGTGGCAAGTATTCTATAC

[0402] TATAGTAGATTATATTAATCAGATTGTACAGGTAATGTCCAAAAGATCAAGATCATTAAATTCCGCTGCGTTTTAT

[0403] TATAGAGTATAGATATATCTTAGATTAGAATTGTATGATGTGACCGGGTCGGCATGGCATCTCCACCTCCTCGCGG

[0404] TCCGACCTGGGCATCCGAAGGAGGACGTCGTCCACTCGGATGGCTAAGGGAGAGCTCAAAAAAAAGGATCCGGCTG

[0405] CTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTC

[0406] TAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATCGAGATCCTCTAGAGTCGACCTGCAG

[0407] GCATGCAAGCTTGTATTCTATAGTGTCACCTAAATCGTATGTGTATGATACATAAGGTTATGTATTAATTGTAGCC

[0408] GCGTTCTAACGACAATATGTACAAGCCTAATTGTGTAGCATCTGGCTTACTGAAGCAGACCCTATCATCTCTCTCG

[0409] TAAACTGCCGTCAGAGTCGGTTTGGTTGGACGAACCTTCTGAGTTTCTGGTAACGCCGTCCCGCACCCGGAAATGG

[0410] TCAGCGAACCAATCAGCAGGGTCATCGCTAGCCAGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGC

[0411] CACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATG

[0412] AGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCACCATT

[0413] CCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCTTAATGCAGGAGTCGCATAAGGGAGAG

[0414] CGTCGAATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCC

[0415] GCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCA

[0416] TGTGTCAGAGGTTTTCACCGTCATCACCGAAA

[0417] >pT7-VP7 / Hu02(G2)(SEQ ID NO:2)

[0418] CGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGT

[0419] CAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCC

[0420] GCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGT

[0421] GTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAG

[0422] ATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTT

[0423] TCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGAC

[0424] GCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAA

[0425] AGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAA

[0426] CTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGC

[0427] CTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGG

[0428] CAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGA

[0429] GGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCC

[0430] GGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACA

[0431] CGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTG

[0432] GTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAG

[0433] GTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCG

[0434] TAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACC

[0435] GCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCG

[0436] CAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACAT

[0437] ACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAG

[0438] ACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACG

[0439] ACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACA

[0440] GGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTA

[0441] TAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGG

[0442] AAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGT

[0443] TATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGA

[0444] GCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATT

[0445] CATTAATGCAGGGGGATATCGATCCCGGGTTAATACGACTCACTATAGGCTTTAAAAGAGAGAATTTCCGTCTGGC

[0446] TAGCGGTTAGCTCTTTTTAATGTATGGTATTGAATATACCACAATTCTGACCATTTTGATATCTATCATATTATTG

[0447] AATTACATATTAAAAACTATAACTAATACAATGGACTACATAATTTTTAGATTTTTACTACTCATCGCTTTAATGT

[0448] CACCATTCGTGAGAACGCAAAATTACGGCATGTATTTACCAATAACGGGATCACTAGACGCTGTATACACAAATTC

[0449] AACTAGTGGAGAATCATTTCTAACTTCAACGTTATGTTTATATTACCCAACAGAAGCTAAAAATGAGATTTCAGAT

[0450] AATGAATGGGAAAATACTCTGTCACAATTATTTTTAACTAAAGGATGGCCGACTGGGTCAGTTTATTTCAAAGACT

[0451] ACAATGATATTACTACATTTTCTATGAATCCACAACTGTATTGTGATTATAATATAGTATTAATGCGATATGATAA

[0452] TACATCTGAATTGGATGCATCGGAGTTAGCAGATCTTATATTGAACGAATGGCTGTGCAATCCTATGGATATATCA

[0453] CTTTACTATTATCAACAAAATAGCGAATCAAATAAATGGATATCAATGGGAACAGACTGCACGGTAAAAGTTTGTC

[0454] CACTCAATACACAAACTTTAGGGATTGGATGTAAAACTACGGACGTGGATACATTTGAGATTGTTGCGTCGTCTGA

[0455] AAAATTGGTAATTACTGATGTTGTAAATGGTATTAATCATAAAATAAATATTTCAATAAATACGTGCACTATACGT

[0456] AATTGTAATAAACTAGGACCACGAGAGAATGTTGCTATAATTCAAGTTGGTGGACCGAATGCACTAGATATTACTG

[0457] CTGATCCAACAACAGTTCCACAGGTTCAAAGAATTATGCGAGTAAATTGGAAAAAATGGTGGCAAGTGTTTTATAC

[0458] AGTAGTTGACTATATTAACCAAATTATACAAGTTATGTCCAAACGGTCGAGATCATTAGACACGGCTGCTTTCTAT

[0459] TATAGAATTTAGATATAACTTTGGTTAGAATTGTATGATGTGACCGGGTCGGCATGGCATCTCCACCTCCTCGCGG

[0460] TCCGACCTGGGCATCCGAAGGAGGACGTCGTCCACTCGGATGGCTAAGGGAGAGCTCAAAAAAAAGGATCCGGCTG

[0461] CTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTC

[0462] TAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATCGAGATCCTCTAGAGTCGACCTGCAG

[0463] GCATGCAAGCTTGTATTCTATAGTGTCACCTAAATCGTATGTGTATGATACATAAGGTTATGTATTAATTGTAGCC

[0464] GCGTTCTAACGACAATATGTACAAGCCTAATTGTGTAGCATCTGGCTTACTGAAGCAGACCCTATCATCTCTCTCG

[0465] TAAACTGCCGTCAGAGTCGGTTTGGTTGGACGAACCTTCTGAGTTTCTGGTAACGCCGTCCCGCACCCGGAAATGG

[0466] TCAGCGAACCAATCAGCAGGGTCATCGCTAGCCAGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGC

[0467] CACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATG

[0468] AGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCACCATT

[0469] CCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCTTAATGCAGGAGTCGCATAAGGGAGAG

[0470] CGTCGAATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCC

[0471] GCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCA

[0472] TGTGTCAGAGGTTTTCACCGTCATCACCGAAA

[0473] >pT7-VP7 / Hu03(G3)(SEQ ID NO:3)

[0474] CGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGT

[0475] CAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCC

[0476] GCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGT

[0477] GTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAG

[0478] ATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTT

[0479] TCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGAC

[0480] GCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAA

[0481] AGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAA

[0482] CTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGC

[0483] CTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGG

[0484] CAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGA

[0485] GGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCC

[0486] GGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACA

[0487] CGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTG

[0488] GTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAG

[0489] GTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCG

[0490] TAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACC

[0491] GCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCG

[0492] CAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACAT

[0493] ACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAG

[0494] ACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACG

[0495] ACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACA

[0496] GGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTA

[0497] TAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGG

[0498] AAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGT

[0499] TATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGA

[0500] GCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATT

[0501] CATTAATGCAGGGGGATATCGATCCCGGGTTAATACGACTCACTATAGGCTTTAAAAGAGAGAATTTCCGTTTGGC

[0502] TATCGGTTAGCTCCTTTTAATGTATGGTATTGAATATACCACAGTTTTAACCTTTTTGATGTCAGTTATATTGTTG

[0503] AATTACGTACTAAAATCCTTAACTAGAATAATGGACTTTATTATTTACAGATTTCTTTTAATTATAGTTATATTAT

[0504] CACCACTCCTTAATGCACAAAATTATGGAATAAATCTTCCGATTACTGGCTCAATGGACACACCATATACGAACTC

[0505] AACGCGAGAGGAAGTATTCCTAACTTCGACTTTATGTTTGTATTACCCAACTGAAGCAGCAACAGAAATAAATGAT

[0506] AATTCATGGAAGGATACACTTTCTCAGCTATTTTTAATCAAAGGATGGCCAACAGGATCTATTTATTTTAAAGATT

[0507] ATACTGATATTGCCTCGTTTTCAGTCGATCCACAACTATATTGTGATTATAATTTGGTATTAATGAAATATGACGC

[0508] TACACTGCAACTAGATATGTCCGAACTAGCAGATTTGTTACTTAATGAGTGGTTATGTAATCCTATGGATATTACG

[0509] TTGTATTATTATCAACAAACTGATGAGGCAAATAAATGGATTTCAATGGGATCATCTTGTACTATAAAGGTATGTC

[0510] CACTTAATACACAAACATTAGGAATTGGGTGCCTAACAACTGATACAAACACGTTTGAAGAAGTTGCAACAGCTGA

[0511] AAAATTAGTGATCACTGACGTTGTAGATGGAGTCAATCATAAATTGAACGTGACAACAAACACTTGTACGATTAGA

[0512] AATTGTAAAAAATTAGGACCAAGGGAAAACGTAGCAGTTATACAGGTAGGTGGCCCAGATGTGCTTGACATAACAG

[0513] CTGATCCAACGACAATGCCACAAACAGAAAGAATGATGCGATTAAATTGGAAGAAATGGTGGCAAGTGTTTTATAC

[0514] AATAGTTGATTACGTGAATCAAATTGTGCAAGCAATGTCCAAAAGATCGAGATCATTAAATTCTGCTGCATTTTAC

[0515] TACAGAGTATAGATATAGCTTAGGTTAGAATTGTATGATGTGACCGGGTCGGCATGGCATCTCCACCTCCTCGCGG

[0516] TCCGACCTGGGCATCCGAAGGAGGACGTCGTCCACTCGGATGGCTAAGGGAGAGCTCAAAAAAAAGGATCCGGCTG

[0517] CTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTC

[0518] TAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATCGAGATCCTCTAGAGTCGACCTGCAG

[0519] GCATGCAAGCTTGTATTCTATAGTGTCACCTAAATCGTATGTGTATGATACATAAGGTTATGTATTAATTGTAGCC

[0520] GCGTTCTAACGACAATATGTACAAGCCTAATTGTGTAGCATCTGGCTTACTGAAGCAGACCCTATCATCTCTCTCG

[0521] TAAACTGCCGTCAGAGTCGGTTTGGTTGGACGAACCTTCTGAGTTTCTGGTAACGCCGTCCCGCACCCGGAAATGG

[0522] TCAGCGAACCAATCAGCAGGGTCATCGCTAGCCAGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGC

[0523] CACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATG

[0524] AGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCACCATT

[0525] CCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCTTAATGCAGGAGTCGCATAAGGGAGAG

[0526] CGTCGAATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCC

[0527] GCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCA

[0528] TGTGTCAGAGGTTTTCACCGTCATCACCGAAA

[0529] >pT7-VP7 / Hu04(G4)(SEQ ID NO:4)

[0530] CGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGT

[0531] CAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCC

[0532] GCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGT

[0533] GTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAG

[0534] ATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTT

[0535] TCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGAC

[0536] GCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAA

[0537] AGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAA

[0538] CTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGC

[0539] CTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGG

[0540] CAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGA

[0541] GGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCC

[0542] GGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACA

[0543] CGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTG

[0544] GTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAG

[0545] GTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCG

[0546] TAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACC

[0547] GCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCG

[0548] CAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACAT

[0549] ACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAG

[0550] ACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACG

[0551] ACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACA

[0552] GGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTA

[0553] TAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGG

[0554] AAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGT

[0555] TATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGA

[0556] GCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATT

[0557] CATTAATGCAGGGGGATATCGATCCCGGGTTAATACGACTCACTATAGGCTTTAAAAGAGAGAATTTCCGTCTGGC

[0558] TAGCGGATAGCTCCTTTTAATGTATGGTATTGAATATACCACAGTTCTATTTTATCTGATATCTTTCGTTCTTGTG

[0559] AGTTATATTCTGAAAACTATAACAAAAATAATGGACTACCTAATTTACAGAATAACATTTGTAATTGTTGTACTGT

[0560] CAGTATTATCTAGTGCACAAAATTATGGAATAAATTTGCCAATTACAGGATCTATGGATACAGCCTATGCTAATTC

[0561] AACGCAGAATGAAAATTTCTTGTCATCAACTCTATGCTTATACTATCCTACAGAAGCTCAAACGCAGATAAGCGAT

[0562] AATGAATGGAAGGACACATTATCTCAATTATTTCTAACTAAAGGATGGCCAACAGGTTCAGTCTATTTTAATGAAT

[0563] ACTCGAATGTTCTAGAATTTTCCGTCGATCCAAAGTTATATTGTGATTACAATATTGTATTAATTAGATTCGCTTC

[0564] AGGAGAAGAGTTAGATATATCTGAATTAGCTGATCTAATACTAAATGAATGGTTATGTAATCCAATGGACATAACG

[0565] TTATATTATTACCAGCAAACAGGAGAGGCAAATAAATGGATATCAATGGGATCATCATGTACTGTTAAAGTGTGTC

[0566] CATTGAATACGCAAACTTTAGGAGTTGGATGTCAAACTACAAATCCAAATACCTTTGAAACAGTGGCCGAAAGTGA

[0567] GAAATTAGCTATAGTTGATGTTGTCGATGGTGTGAATCATAAATTAGATATTACATCTACAACGTGTACGATACGA

[0568] AACTGTAATAAACTGGGACCAAGAGAAAATGTAGCTATAATACAGGTTGGTGGTTCTAATATACTCGATATAACAG

[0569] CTGATCCCACAACTTCTCCACAAACGGAACGAATGATGCGCGTGAATTGGAAAAAATGGTGGCAGGTTTTTTATAC

[0570] AGTAGTTGACTATATTGATCAGATAGTGCAAGTAATGTCCAAAAGATCAAGATCGCTAGACTCATCTTCTTTTTAT

[0571] TATAGAGTATAGATATATCCTAAATTAGAATTGTATGATGTGACCGGGTCGGCATGGCATCTCCACCTCCTCGCGG

[0572] TCCGACCTGGGCATCCGAAGGAGGACGTCGTCCACTCGGATGGCTAAGGGAGAGCTCAAAAAAAAGGATCCGGCTG

[0573] CTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTC

[0574] TAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATCGAGATCCTCTAGAGTCGACCTGCAG

[0575] GCATGCAAGCTTGTATTCTATAGTGTCACCTAAATCGTATGTGTATGATACATAAGGTTATGTATTAATTGTAGCC

[0576] GCGTTCTAACGACAATATGTACAAGCCTAATTGTGTAGCATCTGGCTTACTGAAGCAGACCCTATCATCTCTCTCG

[0577] TAAACTGCCGTCAGAGTCGGTTTGGTTGGACGAACCTTCTGAGTTTCTGGTAACGCCGTCCCGCACCCGGAAATGG

[0578] TCAGCGAACCAATCAGCAGGGTCATCGCTAGCCAGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGC

[0579] CACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATG

[0580] AGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCACCATT

[0581] CCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCTTAATGCAGGAGTCGCATAAGGGAGAG

[0582] CGTCGAATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCC

[0583] GCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCA

[0584] TGTGTCAGAGGTTTTCACCGTCATCACCGAAA

[0585] >pT7-VP7 / Hu05(G8)(SEQ ID NO:5)

[0586] CGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGT

[0587] CAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCC

[0588] GCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGT

[0589] GTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAG

[0590] ATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTT

[0591] TCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGAC

[0592] GCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAA

[0593] AGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAA

[0594] CTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGC

[0595] CTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGG

[0596] CAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGA

[0597] GGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCC

[0598] GGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACA

[0599] CGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTG

[0600] GTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAG

[0601] GTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCG

[0602] TAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACC

[0603] GCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCG

[0604] CAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACAT

[0605] ACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAG

[0606] ACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACG

[0607] ACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACA

[0608] GGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTA

[0609] TAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGG

[0610] AAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGT

[0611] TATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGA

[0612] GCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATT

[0613] CATTAATGCAGGGGGATATCGATCCCGGGTTAATACGACTCACTATAGGCTTTAAAGAGAGAATTTCCGTTTGGCT

[0614] AACGGTTAGCTCCTTTTAATGTATGGTATTGAATATACCACAACTCTAATCTTCTTGATATTGCTTGTATTATTAA

[0615] ATTATATACTAAAATCAATAACTCGAATTATGGACTATATACTCTACAGATTTTTGTTGTTTATTGTAATTATTAC

[0616] GCCATTTGTAAATTCACAGAACTATGGCATAAATTTACCAATTACTGGATCTATGGACGCAAACTACCAGAACGTA

[0617] TCGACTTCAGAACCATTTCTAACATCAACATTATGTCTTTATTATCCAACAGAGGCTGAAACAGAGATTGCTGACA

[0618] GTTCATGGAAAGATACGCTATCACAGTTATTTTTAACAAAAGGGTGGCCAACTGGTTCTGTTTATCTTAGAAGCTA

[0619] CACCGATATTTCAACTTTTTCAATAAATCCTCAGTTGTATTGCGATTACAACATAGTTCTAATGAAATATAACGCC

[0620] GATTCGGAACTAGATATGTCAGAGTTAGCAGACTTGATACTCAATGAATGGCTATGTAATCCAATGGATATAACGT

[0621] TGTACTATTATCAGCAGACGGATGAAGCAAATAAATGGATATCAATGGGAGATTCGTGTACTATTAAAGTGTGTCC

[0622] ATTAAATACGCAGACATTAGGCATTGGATGTCTCACCACTGACACTACGACTTTTGAAGAAGTTGCGACAGCAGAA

[0623] AAATTAGCAATAACGGATGTTGTTGATGGGGTGAACTACAAAATAAATGTTACTACTACTACATGTACAATTAGAA

[0624] ACTGTAAAAAACTGGGACCTAGAGAGAATGTTGCAGTCATCCAAGTAGGTGGTTCAAACATTTTAGATATTACAGC

[0625] AGATCCTACGGCAGCACCACAAACTGAAAGAATGATGAGAGTTAATTGGAAAAAATGGTGGCAAGTTTTCTATACT

[0626] GTTGTTGATTATGTAAATCAAATAATTCAAGCAATGTCCAAAAGATCGCGATCGTTAGATTCGGCAGCATTTTATT

[0627] ATAGAATTTAAATATCACTGAGATTAGAATTGTATGATGTGACCGGGTCGGCATGGCATCTCCACCTCCTCGCGGT

[0628] CCGACCTGGGCATCCGAAGGAGGACGTCGTCCACTCGGATGGCTAAGGGAGAGCTCAAAAAAAAGGATCCGGCTGC

[0629] TAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCT

[0630] AAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATCGAGATCCTCTAGAGTCGACCTGCAGG

[0631] CATGCAAGCTTGTATTCTATAGTGTCACCTAAATCGTATGTGTATGATACATAAGGTTATGTATTAATTGTAGCCG

[0632] CGTTCTAACGACAATATGTACAAGCCTAATTGTGTAGCATCTGGCTTACTGAAGCAGACCCTATCATCTCTCTCGT

[0633] AAACTGCCGTCAGAGTCGGTTTGGTTGGACGAACCTTCTGAGTTTCTGGTAACGCCGTCCCGCACCCGGAAATGGT

[0634] CAGCGAACCAATCAGCAGGGTCATCGCTAGCCAGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCC

[0635] ACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGA

[0636] GCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCACCATTC

[0637] CTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCTTAATGCAGGAGTCGCATAAGGGAGAGC

[0638] GTCGAATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCG

[0639] CTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCAT

[0640] GTGTCAGAGGTTTTCACCGTCATCACCGAAA

[0641] >pT7-VP7 / Hu06(G9)(SEQ ID NO:6)

[0642] CGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGT

[0643] CAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCC

[0644] GCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGT

[0645] GTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAG

[0646] ATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTT

[0647] TCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGAC

[0648] GCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAA

[0649] AGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAA

[0650] CTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGC

[0651] CTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGG

[0652] CAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGA

[0653] GGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCC

[0654] GGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACA

[0655] CGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTG

[0656] GTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAG

[0657] GTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCG

[0658] TAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACC

[0659] GCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCG

[0660] CAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACAT

[0661] ACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAG

[0662] ACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACG

[0663] ACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACA

[0664] GGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTA

[0665] TAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGG

[0666] AAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGT

[0667] TATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGA

[0668] GCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATT

[0669] CATTAATGCAGGGGGATATCGATCCCGGGTTAATACGACTCACTATAGGCTTTAAAAGAGAGAATTTCCGTTTGGC

[0670] TAGCGGTTAGCTCCTTTTAATGTATGGTATTGAATATACCACAGTTCTAACCTTTCTGATATCAATAGTTTTATTG

[0671] AACTACATATTAAAATCACTAACTAGTGCGATGGACTTTATAATTTATAGATTTCTTTTACTTATTGTTATTTTGT

[0672] CGCCATTTGTCAAAACACAAAATTATGGGATAAATTTACCAATTACTGGCTCCATGGACACAGCATATGCAAATTC

[0673] ATCACAGCAAGAAACATTCTTAACTTCAACGCTATGTTTATATTATCCTACTGAAGCATCAACTCAAATTGGAGAT

[0674] ACTGAATGGAAGAATACTCTATCTCAATTATTCTTGACTAAGGGGTGGCCAACTGGATCAGTCTATTTTAAAGAAT

[0675] ATACAGATATCGCTTCTTTCTCAATTGATCCACAACTTTATTGTGATTATAATGTTGTGCTAATGAAGCATGATTC

[0676] AACGTTAGAGCTAGATATGTCTGAATTAGCTGATTTGATTCTAAATGAATGGTTATGCAATCCAATGGATATAACA

[0677] TTATATTATTATCAGCAAACAGATGAATCGAATAAATGGATATCGATGGGGCAATCTTGTACCATAAAAGTGTGCC

[0678] CATTAAATACACAAACTTTAGGAATAGGTTGTACTACTACAAATACAGCGACATTTGAAGAAGTAGCTACTAGTGA

[0679] GAAATTAGTGATAACTGATGTTGTTGATGGCGTGAATCATAAACTTGATGTAACTACAAATACCTGTACAATTAGA

[0680] AATTGTAAGAAGTTAGGACCGAGAGAAAATGTAGCAATTATACAAGTCGGTGGCTCAGAAGTGTTAGATATTACAG

[0681] CGGATCCAACTACCACACCACAAACTGAGCGTATGATGCGAGTAAATTGGAAGAAATGGTGGCAAGTTTTCTATAC

[0682] AGTAGTAGATTACATTAATCAGATTGTGCAAGTTATGTCCAAAAGATCACGGTCATTAAATTCAGCAGCTTTTTAT

[0683] TATAGAGTCTGATATATCTTAGGTTAGAATTGTATGATGTGACCGGGTCGGCATGGCATCTCCACCTCCTCGCGGT

[0684] CCGACCTGGGCATCCGAAGGAGGACGTCGTCCACTCGGATGGCTAAGGGAGAGCTCAAAAAAAAGGATCCGGCTGC

[0685] TAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCT

[0686] AAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATCGAGATCCTCTAGAGTCGACCTGCAGG

[0687] CATGCAAGCTTGTATTCTATAGTGTCACCTAAATCGTATGTGTATGATACATAAGGTTATGTATTAATTGTAGCCG

[0688] CGTTCTAACGACAATATGTACAAGCCTAATTGTGTAGCATCTGGCTTACTGAAGCAGACCCTATCATCTCTCTCGT

[0689] AAACTGCCGTCAGAGTCGGTTTGGTTGGACGAACCTTCTGAGTTTCTGGTAACGCCGTCCCGCACCCGGAAATGGT

[0690] CAGCGAACCAATCAGCAGGGTCATCGCTAGCCAGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCC

[0691] ACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGA

[0692] GCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCACCATTC

[0693] CTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCTTAATGCAGGAGTCGCATAAGGGAGAGC

[0694] GTCGAATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCG

[0695] CTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCAT

[0696] GTGTCAGAGGTTTTCACCGTCATCACCGAAA

[0697] >pT7-VP4 / Hu02(P[4])(SEQ ID NO:7)

[0698] CGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGT

[0699] CAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCC

[0700] GCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGT

[0701] GTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAG

[0702] ATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTT

[0703] TCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGAC

[0704] GCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAA

[0705] AGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAA

[0706] CTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGC

[0707] CTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGG

[0708] CAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGA

[0709] GGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCC

[0710] GGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACA

[0711] CGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTG

[0712] GTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAG

[0713] GTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCG

[0714] TAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACC

[0715] GCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCG

[0716] CAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACAT

[0717] ACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAG

[0718] ACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACG

[0719] ACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACA

[0720] GGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTA

[0721] TAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGG

[0722] AAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGT

[0723] TATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGA

[0724] GCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATT

[0725] CATTAATGCAGGGGGATATCGATCCCGGGTTAATACGACTCACTATAGGCTATAAAATGGCTTCGCTCATTTATAG

[0726] ACAACTTCTCACTAATTCATATTCGGTAGACTTGCATGACGAAATAGAAcAGATTGGATCGGAGAAAACTCAAAAT

[0727] GTGACGGTAAATCCAGGCCCATTTGCACAGACTAGATATGCTCCAGTCAATTGGGGACACGGAGAGATTAATGATT

[0728] CAACTACGGTGGAACCAGTTTTAGATGGTCCTTATCAACCAACTACATTTAAACCACCCAATGATTATTGGCTGCT

[0729] TATTAGTTCAAGTACAGATGGAGTAGTCTATGAGAGTACAAATAATAGTGACTTTTGGACAGCAGTTATCGCTGTC

[0730] GAACCACATGTCAGTCAAACAAATAGGCAATATGTTTTATTTGGTGAGAATAAGCAGTTTAACATAGAAAATAGTT

[0731] CAGATAAATGGAAATTTTTCGAAATGTTTAAAGGTAgTAGTcAGAGTGATTTTTCTAATAGACGGACTTTAACCTC

[0732] TAATAATAGACTTGTAGGAATGTTAAAATATGGTGGAAGAGTATGGACGTTTCATGGTGAAACACCAAGAGCTACT

[0733] ACTGATAGTTCGAGTACTGCAGATTTAAATAATATATCAATTATAATTCATTCAGAGTTTTATATTATTCCAAGAT

[0734] CCCAAGAATCTAAATGTAATGAATATATCAATAATGGTTTACCGCCAATTCAAAATACTAGAAATGTAGTTCCATT

[0735] ATCTCTATCATCCAGGTCTATTCAATATAGAAGAGCACAAGTTAATGAAGATATTACAATTTCAAAAACTTCATTA

[0736] TGGAAGGAGATGCAATATAATAGAGATATTATAATAAGATTTAAATTTGGTAATAGTGTCATAAAATTAGGAGGAT

[0737] TGGGATATAAATGGTCTGAAATATCATACAAAGCAGCGAATTATCAATATAGCTATACGCGTGATGGTGAACAAGT

[0738] TACTGCACATACCACTTGTTCAGTAAATGGAGTAAATAATTTTAGCTATAATGGAGGTTCATTACCTACTGATTTC

[0739] AGTATTTCGAGATATGAGGTTATTAAAGAAAATTCTTATGTATATATAGATTACTGGGACGATTCAAAAGCATTTA

[0740] GAAATATGGTATATGTTAGATCATTAGCAGCTAATTTAAATTCAGTGAAATGTGTAGGTGGTAGTTATGATTTTAG

[0741] GTTACCTGTAGGTGAATGGCCTATTATGAATGGCGGTGCTGTATCATTACATTTTGCTAGAGTTACATTATCTACA

[0742] CAGTTCACTGATTTTGTATCATTGAATTCGCTACGATTTAGATTCAGTTTAACAGTAGATGAACCATCTTTCTCAA

[0743] TAATACGAACACGTACAATGAACTTATATGGATTACCAGCAGCTAATCCAAACAATGGAAATGAATACTATGAAAT

[0744] ATCAGGAAGGTTCTCACTTATTTCTTTAGTTCCAACTAATGATGATTATCAAACTCCAATTATGAATTCAGTAACA

[0745] GTAAGGCAAGATTTAGAACGCCAGCTTAATGATTTACGAGAGGAGTTTAATTCATTGTCACAAGAAATAGCTATGT

[0746] CACAATTGATTGATTTAGCATTATTACCTTTAGATATGTTTTCTATGTTTTCAGGGATAAAAAGTACTATTGATTT

[0747] GACCAAGTCAATGGCAACTAGTGTAATGAAAAAATTTAGAAAATCAAAATTAGCTACATCAATTTCAGAAATGACT

[0748] AATTCATTGTCAGATGCGGCTTCGTCAGCATCAAGAAGTGCTTCTATTAGATCAAATTTATCGACAATTTCAAATT

[0749] GGTCTGATGTCTCAAAAAGTGTATTAGATGTAACTGACTCAGTAAATGACGTTTCAACACAAACATCTACAATTAG

[0750] TAAGAAACTTAGATTAAAAGAGATGATTACTCAAACTGAAGGAATTAGTTTTGACGATATTTCAGCAGCAGTATTG

[0751] AAAACGAAAATAGATATGTCCACACAAATTGGAAAAAATACCTTACCTGATATAGTTACTGAAGCATCTGAAAAGT

[0752] TTATTCCAAAACGATCATATCGAGTATTAAAAGATGATGAAGTGATGGAAGTTAATACTGAAGGAAAGTTTTTTGC

[0753] TTATAAAGTGGATACACTTAATGAGATCCCATTTGACATAAATAAATTCGCTGAACTTGTGACGGATTCTCCAGTT

[0754] ATATCAGCAATAATAGATTTTAAAACGCTAAAAAATTTAAACGATAATTATGGAATTACCCGCATAGAAGCGCTTA

[0755] ATTTAATAAAATCGAATCCAAATGTACTGCGTAGTTTTATTAATCAATATAATCCAATTATAAGAAATAGGATTGA

[0756] GCAGTTAATTCTACAATGTAAATTGTGAGAACGCTATTGAGGATGTGACCGGGTCGGCATGGCATCTCCACCTCCT

[0757] CGCGGTCCGACCTGGGCATCCGAAGGAGGACGTCGTCCACTCGGATGGCTAAGGGAGAGCTCAAAAAAAAGGATCC

[0758] GGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGG

[0759] GCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATCGAGATCCTCTAGAGTCGACC

[0760] TGCAGGCATGCAAGCTTGTATTCTATAGTGTCACCTAAATCGTATGTGTATGATACATAAGGTTATGTATTAATTG

[0761] TAGCCGCGTTCTAACGACAATATGTACAAGCCTAATTGTGTAGCATCTGGCTTACTGAAGCAGACCCTATCATCTC

[0762] TCTCGTAAACTGCCGTCAGAGTCGGTTTGGTTGGACGAACCTTCTGAGTTTCTGGTAACGCCGTCCCGCACCCGGA

[0763] AATGGTCAGCGAACCAATCAGCAGGGTCATCGCTAGCCAGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACC

[0764] GGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGC

[0765] TCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCA

[0766] CCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCTTAATGCAGGAGTCGCATAAGG

[0767] GAGAGCGTCGAATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAA

[0768] CACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAG

[0769] CTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAA

[0770] >pT7-VP4 / Hu06(P[8])(SEQ ID NO:8)

[0771] CGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGT

[0772] CAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCC

[0773] GCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGT

[0774] GTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAG

[0775] ATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTT

[0776] TCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGAC

[0777] GCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAA

[0778] AGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAA

[0779] CTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGC

[0780] CTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGG

[0781] CAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGA

[0782] GGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCC

[0783] GGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACA

[0784] CGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTG

[0785] GTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAG

[0786] GTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCG

[0787] TAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACC

[0788] GCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCG

[0789] CAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACAT

[0790] ACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAG

[0791] ACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACG

[0792] ACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACA

[0793] GGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTA

[0794] TAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGG

[0795] AAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGT

[0796] TATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGA

[0797] GCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATT

[0798] CATTAATGCAGGGGGATATCGATCCCGGGTTAATACGACTCACTATAGGCTATAAAATGGCTTCGCTCATTTATAG

[0799] ACAGCTTCTCACTAATTCATATTCAGTAGATTTATATGATGAAATAGAGCAAATTGGATCAGAAAAAACTCAAAAT

[0800] GTAACTATAAACCCAGGTCCATTTGCTCAAACAAGATATGCTCCAGTCAATTGGGGTCATGGAGAAATAAATGATT

[0801] CAACTACAGTGGAACCAATTTTAGATGGTCCTTATCAACCTACTACATTTACACCACCTACTGATTACTGGATACT

[0802] TATTAACTCAAATACAAATGGAGTAGTATACGAGAGTACAAATAATAGTGACTTTTGGACTGCAGTCATTGCTGTT

[0803] GAACCGCACGTCGATCCAGTAGATAGACAATATAATGTATTTGGTGAAAATAAACAATTTAATGTAAGGAATGATT

[0804] CAGATAAATGGAAGTTTTTAGAAATGTTTAGAGGCAGTAGTCAAAGTGACTTTTATAATAGACGTACACTAACTTC

[0805] TGATACTAAACTCGTAGGAATATTAAAATATGGTGGAAGAATATGGACATTTCATGGTGAAACACCAAGGGCTACT

[0806] ACCGATAGCTCAAACACTGCAAATTTGAACGGTATATCAATTGCAATTCATTCAGAATTTTATATTATTCCAAGAT

[0807] CCCAAGAGTCTAAGTGTAATGAATATATTAATAACGGTCTACCACCAATTCAAAATACTAGAAATGTAGTACCATT

[0808] ATCATTATCATCTAGATCTATACAGTATACGAGAGCACAAGTTAATGAAGACATTACAATTTCAAAGACTTCATTA

[0809] TGGAAAGAAATGCGTTATAACAGAGATATTATAATTAGGTTTAAATTTGGCAATAGTATTATTAAATTAGGGGGAT

[0810] TGGGTTATAAATGGTCTGAAATATCATATAAAGCAGCGAACTATCAATATAATTATTTACGTGATGGTGAACAAGT

[0811] AACTGCACATACTACCTGTTCAGTAAACGGAGTAAATAATTTTAGCTACAACGGAGGATCTTTGCCCACTGATTTT

[0812] AGTATTTCAAGATATGAAGTTATTAAAGAAAATTCCCATGTATACGTAGATTATTGGGACGATTCAAAAGCATTTC

[0813] GAAATATGGTGTATGTTAGATCATTAGCAGCTAATTTAAACTCAGTGAAATGTACAGGTGGAAGTTACAATTTTAG

[0814] TATACCTGTGGGTGCATGGCCAGTTATGAATGGAGGTGCCGTTTCGTTGCATTTCGCTGGTGTTACATTATCTACG

[0815] CAATTCACAGATTTCGTATCATTAAATTCATTACGGTTTAGATTTAGTTTGACAGTAGATGAACCATCTTTTTCAA

[0816] TATTGAGAACACGTACGGTAAATTTATATGGATTACCAGCTGCTAATCCAAATAATGGAAATGAATATTACGAAAT

[0817] ATCAGGAAGGTTTTCGCTTATTTCTTTAGTTTCAACCAACGATGATTATCAGACTCCAATTATGAATTCAGTAACA

[0818] GTAAGACAAGATTTAGAACGTCAACTAACTGATTTACGAGAGGAATTCAATTCATTATCACAAGAAATAGCTATGT

[0819] CACAATTAATTGATTTAGCGTTATTACCTTTAGACATGTTTTCTATGTTTTCAGGGATTAAAAGCACAATTGATCT

[0820] AACAAAATCAATGGCGACTAGCGTAATGAAAAAATTTAGAAAATCAAAGTTAGCTACATCAGTTTCAGAAATGACT

[0821] AACTCATTGTCAGACGCAGCATCATCAGCATCAAGAAGCGTTTCTGTTAGATCGAATATATCCGCATTTTCAAACT

[0822] GGACTAATGTTTCAAATGATGTATCAGATGTGACTAATTCAGTAAATGATATTTCAACGCAAACATCTACGATCAG

[0823] TAAAAACCTTAGATTAAGAGAAATGATCACTCAAACTGAAGGAATGAGTTTTGATGATATTTCAGCAGCAGTACTA

[0824] AAAACGAAAATAGATATGTCTACTCAAATTGGGAAAAATACTTTACCTGACATAGTCACAGAGGCATCTGAGAAAT

[0825] TTATTCCAAAACGCTCGTATCGAATACTAAAAGATGATGAAGTAATGGAAATTAATACTGAAGGAAAATTCTTTGC

[0826] ATATAAAATTGATACACTTAATGAAGTGCCATTTGATGTAAATAAATTTGCTGAACTTGTAACAAATTCCCCAGTT

[0827] ATATCAGCAATAATCGATTTTAAAACGTTGAAGAATTTGAATGATAATTATGGAATTACCCGAACTGAAGCGTTAA

[0828] ATTTAATTAAATCAAATCCAAATGTATTACGTAATTTTATTAACCAGAATAATCCAATTATAAGGAATAGAATTGA

[0829] ACAGTTAATTCTACAATGTAAGTTGTGAGAACGCTATTGAGGATGTGACCGGGTCGGCATGGCATCTCCACCTCCT

[0830] CGCGGTCCGACCTGGGCATCCGAAGGAGGACGTCGTCCACTCGGATGGCTAAGGGAGAGCTCAAAAAAAAGGATCC

[0831] GGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGG

[0832] GCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATCGAGATCCTCTAGAGTCGACC

[0833] TGCAGGCATGCAAGCTTGTATTCTATAGTGTCACCTAAATCGTATGTGTATGATACATAAGGTTATGTATTAATTG

[0834] TAGCCGCGTTCTAACGACAATATGTACAAGCCTAATTGTGTAGCATCTGGCTTACTGAAGCAGACCCTATCATCTC

[0835] TCTCGTAAACTGCCGTCAGAGTCGGTTTGGTTGGACGAACCTTCTGAGTTTCTGGTAACGCCGTCCCGCACCCGGA

[0836] AATGGTCAGCGAACCAATCAGCAGGGTCATCGCTAGCCAGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACC

[0837] GGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGC

[0838] TCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCA

[0839] CCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCTTAATGCAGGAGTCGCATAAGG

[0840] GAGAGCGTCGAATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAA

[0841] CACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAG

[0842] CTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAA.

Claims

1. A human-ovine rotavirus infectious clone plasmid group, characterized in that, Replace the corresponding ovine rotavirus infectious clone plasmid in the ovine rotavirus infectious clone plasmid group with the human rotavirus infectious clone plasmid alone; The human rotavirus infectious clone plasmids are: pT7-VP7 / Hu01 is of G1 genotype; pT7-VP7 / Hu02 is of G2 genotype; pT7-VP7 / Hu03 is of G3 genotype; pT7-VP7 / Hu04 is of G4 genotype; pT7-VP7 / Hu05 is of G8 genotype; pT7-VP7 / Hu06 is of G9 genotype; pT7-VP4 / Hu02 is of P[4] genotype; pT7-VP4 / Hu06 is of P[8] genotype; The sequence of the said pT7-VP7 / Hu01 is as shown in SEQ ID NO:1; The sequence of the said pT7-VP7 / Hu02 is as shown in SEQ ID NO:2; The sequence of the said pT7-VP7 / Hu03 is as shown in SEQ ID NO:3; The sequence of the said pT7-VP7 / Hu04 is as shown in SEQ ID NO:4; The sequence of the said pT7-VP7 / Hu05 is as shown in SEQ ID NO:5; The sequence of the said pT7-VP7 / Hu06 is as shown in SEQ ID NO:6; The sequence of the said pT7-VP4 / Hu02 is as shown in SEQ ID NO:7; The sequence of the said pT7-VP4 / Hu06 is as shown in SEQ ID NO:8; The ovine rotavirus infectious clone plasmid group includes pT7-VP1 / LLRV, pT7-VP2 / LLRV, pT7-VP3 / LLRV, pT7-VP4 / LLRV, pT7-VP6 / LLRV, pT7-VP7 / LLRV, pT7-NSP1 / LLRV, pT7-NSP2 / LLRV, pT7-NSP3 / LLRV, pT7-NSP4 / LLRV and pT7-NSP5 / LLRV; The construction method of the 11 plasmids in the ovine rotavirus infectious clone plasmid group is: performing homologous recombination on the 11 target fragments and the linear plasmid vector; The fragments of the 11 items are LLR VP1, LLR VP2, LLR VP3, LLR VP4, LLR VP6, LLR VP7, LLR NSP1, LLR NSP2, LLR NSP3, LLR NSP4, and LLR NSP5; among them, the GenBank accession number of LLR VP1 is OQ603388, the GenBank accession number of LLR VP2 is OQ603389, the GenBank accession number of LLR VP3 is OQ603390, the GenBank accession number of LLR VP4 is OQ603391, the GenBank accession number of LLR VP6 is OQ603393, the GenBank accession number of LLR VP7 is OQ603396, the GenBank accession number of LLR NSP1 is OQ603392, the GenBank accession number of LLR NSP2 is OQ603395, the GenBank accession number of LLR NSP3 is OQ603394, the GenBank accession number of LLR NSP4 is OQ603397, and the GenBank accession number of LLR NSP5 is OQ603398; The linear plasmid vector was amplified using the sequences shown in SEQ ID NO:118 and SEQ ID NO:119 as primers and the pT7-VP1 / SA11 plasmid as a template to obtain the linear plasmid vector; The replacement is as follows: pT7-VP7 / Hu01, pT7-VP7 / Hu02, pT7-VP7 / Hu03, pT7-VP7 / Hu04, pT7-VP7 / Hu05, and pT7-VP7 / Hu06 were used to replace pT7-VP7 / LLRV in the ovine rotavirus infectious clone plasmid group; the resulting human-ovine rotavirus infectious clone plasmid groups are respectively: (1) The human-ovine rotavirus infectious clone plasmid group obtained by replacing pT7-VP7 / LLRV in the ovine rotavirus infectious clone plasmid group with pT7-VP7 / Hu01 is: pT7-VP1 / LLR, pT7-VP2 / LLR, pT7-VP3 / LLR, pT7-VP4 / LLR, pT7-VP6 / LLR, pT7-VP7 / Hu01, pT7-NSP1 / LLR, pT7-NSP2 / LLR, pT7-NSP3 / LLR, pT7-NSP4 / LLR, pT7-NSP5 / LLR; (2) The human-ovine rotavirus infectious clone plasmid group obtained by replacing pT7-VP7 / LLRV in the ovine rotavirus infectious clone plasmid group with pT7-VP7 / Hu02 is: pT7-VP1 / LLR, pT7-VP2 / LLR, pT7-VP3 / LLR, pT7-VP4 / LLR, pT7-VP6 / LLR, pT7-VP7 / Hu02, pT7-NSP1 / LLR, pT7-NSP2 / LLR, pT7-NSP3 / LLR, pT7-NSP4 / LLR, pT7-NSP5 / LLR; (3) The human-ovine rotavirus infectious clone plasmid group obtained by replacing pT7-VP7 / LLRV in the ovine rotavirus infectious clone plasmid group with pT7-VP7 / Hu03 is: pT7-VP1 / LLR, pT7-VP2 / LLR, pT7-VP3 / LLR, pT7-VP4 / LLR, pT7-VP6 / LLR, pT7-VP7 / Hu03, pT7-NSP1 / LLR, pT7-NSP2 / LLR, pT7-NSP3 / LLR, pT7-NSP4 / LLR, pT7-NSP5 / LLR; (4) The human-ovine rotavirus infectious clone plasmid group obtained by replacing pT7-VP7 / LLRV in the ovine rotavirus infectious clone plasmid group with pT7-VP7 / Hu04 is: pT7-VP1 / LLR, pT7-VP2 / LLR, pT7-VP3 / LLR, pT7-VP4 / LLR, pT7-VP6 / LLR, pT7-VP7 / Hu04, pT7-NSP1 / LLR, pT7-NSP2 / LLR, pT7-NSP3 / LLR, pT7-NSP4 / LLR, pT7-NSP5 / LLR; (5) The human-ovine rotavirus infectious clone plasmid group obtained by replacing pT7-VP7 / LLRV in the ovine rotavirus infectious clone plasmid group with pT7-VP7 / Hu05 is: pT7-VP1 / LLR, pT7-VP2 / LLR, pT7-VP3 / LLR, pT7-VP4 / LLR, pT7-VP6 / LLR, pT7-VP7 / Hu05, pT7-NSP1 / LLR, pT7-NSP2 / LLR, pT7-NSP3 / LLR, pT7-NSP4 / LLR, pT7-NSP5 / LLR; (6)The human-ovine rotavirus infectious clone plasmid group obtained by replacing pT7-VP7 / LLRV in the ovine rotavirus infectious clone plasmid group with pT7-VP7 / Hu06 is: pT7-VP1 / LLR, pT7-VP2 / LLR, pT7-VP3 / LLR, pT7-VP4 / LLR, pT7-VP6 / LLR, pT7-VP7 / Hu06, pT7-NSP1 / LLR, pT7-NSP2 / LLR, pT7-NSP3 / LLR, pT7-NSP4 / LLR, pT7-NSP5 / LLR; Or replace pT7-VP4 / LLRV with pT7-VP4 / Hu02 and pT7-VP4 / Hu06 respectively; the human-ovine rotavirus infectious clone plasmid groups obtained after replacement are respectively: (7)The human-ovine rotavirus infectious clone plasmid group obtained by replacing pT7-VP4 / LLRV in the ovine rotavirus infectious clone plasmid group with pT7-VP4 / Hu02 is: pT7-VP1 / LLR, pT7-VP2 / LLR, pT7-VP3 / LLR, pT7-VP4 / Hu02, pT7-VP6 / LLR, pT7-VP7 / LLR, pT7-NSP1 / LLR, pT7-NSP2 / LLR, pT7-NSP3 / LLR, pT7-NSP4 / LLR, pT7-NSP5 / LLR; (8)The human-ovine rotavirus infectious clone plasmid group obtained by replacing pT7-VP4 / LLRV in the ovine rotavirus infectious clone plasmid group with pT7-VP4 / Hu06 is: pT7-VP1 / LLR, pT7-VP2 / LLR, pT7-VP3 / LLR, pT7-VP4 / Hu06, pT7-VP6 / LLR, pT7-VP7 / LLR, pT7-NSP1 / LLR, pT7-NSP2 / LLR, pT7-NSP3 / LLR, pT7-NSP4 / LLR, pT7-NSP5 / LLR.

2. A reverse genetic virus rescue system for human-ovine rotavirus, characterized in that, Including the human-ovine rotavirus infectious clone plasmid group described in claim 1, the helper plasmid pCMV-868CP, the MA104 or MA104 N*V engineered cell line, and the BHK-T7 / 9 cells; Integrate the N protein of BVDV and the V protein of PIV5 into the genome of MA104 cells to construct the MA104 N*V engineered cell line.

3. The reverse genetic virus rescue system of human-ovine rotavirus according to claim 2, characterized in that, The helper plasmid pCMV-868CP uses CMV as the promoter, (G4 S)4 as the linker peptide, and fuses and expresses the African swine fever virus capping enzyme NP868R and T7 RNAP.

4. A method for rescuing a human - ovine rotavirus reassortant virus strain, characterized in that, Mix the human-ovine rotavirus infectious clone plasmid group, the helper plasmid pCMV-868CP and Opti-MEM described in claim 1, then mix with TransIT-LT1 transfection reagent, let it stand and then transfect into BHK-T7 / 9 cells; after culturing and changing the medium, mix the MA104 N*V engineered cell line with the transfected BHK-T7 / 9 cells for co-culture, and rescue the human-ovine rotavirus reassortant virus strain; Integrate the N protein of BVDV and the V protein of PIV5 into the genome of MA104 cells to construct the MA104 N*V engineered cell line.

5. The rescue method according to claim 4, characterized in that, The time of the said culture is 42 to 54 h; the time of the said co-culture is 2 to 5 days.

6. The human-ovine rotavirus reassortant virus strain prepared by the rescue method according to claim 4.

7. Use of the human-ovine rotavirus reassortant virus strain according to claim 6 in the preparation of human rotavirus vaccine.

Citation Information

Patent Citations

  • Production method of recombinant rotavirus structural proteins and vaccine composition

    US20030175303A1

  • Recombinant rotavirus expression system and recombinant rotaviruses

    WO2020014654A1