DNA splicing and gene editing method mediated by VirEN protein
The VirEN protein, from the Archaeo-Eukaryotic Primase superfamily, addresses the limitations of existing DNA assembly methods by enabling efficient DNA assembly with shorter homologous sequences, enhancing the efficiency and cost-effectiveness of DNA cloning.
Patent Information
- Application Number
- CN202410009324.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-04
- Publication Date
- 2025-07-15
- Estimated Expiration
- 2044-01-04
AI Technical Summary
Existing DNA polymerases have a single source, high cost and require long homologous ends, limiting the efficiency and cost of DNA assembly and gene editing.
VirEN protein is used for DNA assembly and gene editing, and using its mediated microhomologous end junction (MMEJ) function, DNA splicing is catalyzed in the in vitro DNA assembly system through VirEN protein, reducing the need for homologous sequence length, and gene editing is carried out in combination with the CRISPR-Cas system.
It realizes DNA splicing and gene editing under shorter homologous sequences, reduces the cost of primer synthesis, improves assembly efficiency and accuracy, and is suitable for large-scale applications.
Smart Images

Figure CN117904069B_ABST
Abstract
Description
Technical Field
[0001] The present invention discloses a method for DNA splicing and gene editing mediated by VirEN protein, belonging to the fields of biotechnology and genetic engineering. Background Art
[0002] DNA polymerase is a class of proteins that catalyze the synthesis of daughter DNA molecules using DNA as a template and dNTP as a substrate. DNA polymerase has important application values in the fields of biotechnology and genetic engineering. For example, it catalyzes the synthesis of DNA in PCR reactions and assembles DNA molecules with homologous ends in Gibson assembly. The principle of Gibson assembly is to use T5 exonuclease to degrade dsDNA along the 5'-3' direction to generate 3' overhangs. The homologous parts of the 3' overhangs spontaneously anneal, and DNA polymerase uses the annealed 3' overhangs to catalyze DNA synthesis, and then DNA ligase repairs the nicks. Kits for DNA assembly can be developed using T5 exonuclease (such as the content disclosed in Patent CN108841901A). However, the sources of DNA polymerase that have been applied are relatively single and have many disadvantages, such as high cost and the need for long homologous ends (15-30bp), which to a certain extent limits the development of related biotechnologies. Therefore, there is a need in the art to explore more DNA polymerases with different sources and diverse functions.
[0003] The Archaeo-Eukaryotic Primase (AEP) superfamily contains a class of atypical DNA polymerases that function as primases in archaea and eukaryotes and are also widely present in mobile elements (including plasmids, transposons, viruses, etc.) of archaea and bacteria. Members of the AEP superfamily from mobile elements exhibit functional diversity in DNA metabolism, and their functional and activity studies are relatively lacking. Therefore, the AEP superfamily has the potential to explore novel DNA polymerases.
[0004] DNA double-strand breaks (DSBs) are the most common form of DNA damage. Double-strand breaks at both ends caused by nucleases or radiation can be repaired by several DNA repair systems: non-homologous end joining (NHEJ), homologous recombination (HR), and microhomology-mediated end joining (MMEJ). MMEJ is an end repair method that depends on the annealing of microhomologous sequences (about 3-20 bp). The function of MMEJ depends on polymerase theta (Polθ, encoded by the gene POLQ). In addition, PARP1, FEN1, XRCC1, APE2, and ligase 3 are all closely related to the function of MMEJ. Studies have shown that MMEJ mostly serves as an alternative system to the NHEJ and HR repair systems and only functions when the first two repair systems are dysfunctional. As a form of alternative end joining, MMEJ only requires a very small homologous region for repair, making it easier to construct targeting vectors. MMEJ can also be used to create CRISPR-based gene editing methods (Van Vu T, Thi Hai Doan D, Kim J, et al. CRISPR / Cas-based precision genome editing via microhomology-mediated end joining. Plant Biotechnol J. 2021, 19(2): 230-239.). Summary of the Invention
[0005] To achieve the above object, the present invention adopts the following technical solutions:
[0006] The present invention provides an application of a VirEN protein in DNA assembly or genome editing, characterized in that the protein simultaneously satisfies all of the following characteristics:
[0007] (1) It contains a VirE N-terminal domain;
[0008] In some embodiments, the N-terminus of the above VirE N-terminal domain contains two αβ units, and the C-terminus contains an RNA recognition motif (RRM) fold;
[0009] (2) It contains three conserved motifs: Motif I is hhhDhD / E (h is a hydrophobic residue), Motif II is sxK (s is a small residue, and x can be any residue), and Motif III (hD / E);
[0010] Among them, Motif I and III are involved in binding divalent metal ions, while Motif II is involved in binding nucleotides;
[0011] (3) The amino acid sequence has a consistency greater than 30% with the sequence shown in SEQ ID NO.1.
[0012] In some embodiments, the above-mentioned protein belongs to a prokaryotic Argonaute-associated protein;
[0013] In some embodiments, the coding gene of the above-mentioned protein is located within 20 gene regions upstream or downstream of the Argonaute-associated protein coding gene;
[0014] In some embodiments, the amino acid sequence of the above-mentioned protein is as shown in SEQ ID NOs.1-5.
[0015] The present invention also provides an in vitro DNA assembly reaction system, which is characterized in that the system comprises the following components:
[0016] 1) The VirEN protein described in any one of claims 1-2;
[0017] 2) T5 exonuclease; optionally, the dosage of the T5 exonuclease is 0.02-0.32 U / total reaction system;
[0018] 3) dNTP;
[0019] 4) A buffer containing divalent metal ions.
[0020] In some embodiments, the concentration of the above-mentioned VirEN protein is not less than 0.05 μM;
[0021] In some embodiments, the concentration of the above-mentioned VirEN protein is 0.2 μM.
[0022] In some embodiments, the concentration of the above-mentioned dNTP is 5-500 μM;
[0023] In some embodiments, the concentration of the above-mentioned dNTP is 50 μM.
[0024] In some embodiments, the above-mentioned divalent metal ion buffer is a PEG8000 buffer;
[0025] In some embodiments, the mass ratio of PEG8000 in the above-mentioned PEG8000 buffer is 0-5%;
[0026] In some embodiments, the above-mentioned PEG8000 buffer components are 100±5 mM Tris-HCL with pH = 7.5, 10±1 mM MgCl2, 10±1 mM DTT, and PEG8000 with a mass ratio of 0 to 5%.
[0027] The present invention also provides an in vitro DNA assembly method, which is characterized in that the above-mentioned system is used, 2 to 4 fragments to be assembled are added, and the reaction is carried out within the range of 30°C to 37°C for 20 min to 40 min.
[0028] The present invention also provides a composition, which is characterized by comprising:
[0029] 1) the above-mentioned VirEN protein; 2) a nuclease system capable of causing double-strand breaks at the target site;
[0030] In some embodiments, the nuclease system in 2) includes the CRISPR-Cas system or the TALEN (Transcription Activator-like Effector Nucleases) system or the Zinc-finger nucleases system.
[0031] The present invention also provides a vector system capable of producing the above-mentioned composition.
[0032] The present invention also provides the application of the above-mentioned composition or the above-mentioned vector system in causing deletion of genomic target site fragments, which is characterized in that microhomologous sequences are contained on both sides of the deleted fragment;
[0033] In some embodiments, the above-mentioned deleted fragment is between 486 bp and 16377 bp.
[0034] The beneficial effects of the present invention are as follows: Compared with the prior art, the present invention creatively discovers the function of VirEN protein mediating MMEJ. Based on this characteristic, the VirEN protein can be used for DNA splicing and gene editing. The present invention develops a VirEN-based DNA splicing method, and the length of the required homologous sequence is significantly less than that of traditional DNA splicing methods. The present invention also proves the technical effect of VirEN in gene editing in vivo. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 Schematic diagrams of the structural patterns of Argonaute (Ago) from different sources and its associated VirEN gene clusters.
[0036] Figure 2 Analysis of VirEN polymerase activity using fluorescence-labeled ssDNA containing different terminal sequences.
[0037] Figure 3 Verify VirEN-mediated DNA splicing using fluorescently labeled dsDNA with 3'-overhangs.
[0038] Figure 4 Schematic diagram of the MEDA principle.
[0039] Figure 5 Effectiveness of the MEDA assembly method with different lengths of homologous sequences.
[0040] Figure 6 Positive clone rate and accuracy of MEDA without selection pressure: A: Number of transformants obtained; B: Colony PCR results of 24 transformants per group; C: Sequencing results of positive clones, with the upper and lower parts of the sequencing result graph showing the upstream and downstream sequencing results of the cloning site, respectively.
[0041] Figure 7 Effect of different VirEN protein concentrations on the MEDA assembly efficiency.
[0042] Figure 8 Effect of different dNTP concentrations on the assembly efficiency.
[0043] Figure 9 Assembly results of the MEDA method for different numbers of fragments and linearized vectors. The insertion fragments of the KanR, SmR, and CmR resistance gene expression cassettes are named fragments A, B, and C, respectively, and the PCR linearized fragment of the pUC19 plasmid is named V.
[0044] Figure 10 MEDA assembly efficiency at different reaction times and reaction temperatures.
[0045] Figure 11 Effect of PEG8000 on the MEDA assembly efficiency.
[0046] Figure 12 Effect of VirEN protein on the dinB deletion mutation rate after generating double-strand breaks in the dinB gene using the CRISPR-Cas9 system. Detailed implementation manners
[0047] To more clearly illustrate the technical solutions and embodiments of the present invention, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings and specific technical methods. The described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments, and do not limit the present invention in any way.
[0048] In the experimental methods of the following embodiments, unless otherwise specified, they are all conventional methods, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, instruments, etc. used in the following embodiments, unless otherwise specified, can all be obtained from commercial channels. In the following embodiments, for quantitative tests, three repeated experiments are set, and the results are averaged.
[0049] Among them, the primers and primer sequences used in the following embodiments are shown below.
[0050]
[0051]
[0052] Example
[0053] Example 1 VirEN has the function of mediating MMEJ
[0054] The Argonaute (Ago) protein is a protein present in archaea, bacteria, and eukaryotes. It provides an anchor site for non-coding small RNAs to achieve the purpose of degrading target genes or inhibiting translation. Research shows that in archaea, Ago activates transmembrane toxic effector proteins after recognizing virus invasion, and kills infected cells by triggering membrane depolarization, thereby inhibiting virus proliferation and providing immune protection for the cell population (Zeng Z. et al. A short prokaryotic Argonaute activates membrane effector to confer antiviral defense. Cell host & microbe, 2022, 30, 930 - 943, e936). The function of pAgo depends on its associated proteins (proteins encoded by genes adjacent to the gene). During the process of mining pAgo-associated proteins, through genomic structure analysis, phylogenetic map analysis, and adjacent gene analysis, the inventors found that a coding gene of the archaeo-eukaryotic primases (AEP) superfamily is conservatively present in the region within 20 genes upstream or downstream of a class of LongB pAgo genes ( Figure 1 ). This class of AEP proteins belongs to the BT4734-like branch and is labeled as VirE N-terminal domain containing protein in databases such as NCBI. The present invention names it VirEN.
[0055] VirEN is widely present in different prokaryotes, such as Seonamhaeicola sp. S2-3 (NCBI accession number: WP_083692401.1, SEQ ID NO.1), Bacteroides timonensis (NCBI accession number: WP_052356213.1, SEQ ID NO.2), Bacteroides oleiciplenus (NCBI accession number: WP_009128905.1, SEQ ID NO.3), Cyclobacterium marinum (NCBI accession number: WP_014022284.1, SEQ ID NO.4), Flavobacteriaceae (NCBI accession number: WP_027879785.1, SEQ ID NO.5), etc.
[0056] The VirEN protein structure has obvious characteristics. Taking SEQ ID NO.1 as an example, the amino acids at positions 121-294 are the VirEN-terminal domain, among which the amino acids at positions 121-182 are two αβ units, and the amino acids at positions 183-294 are the RRM fold; LTIDFD 205-210 is motif I, GLK 241-243 is motif II, VD 274-275 is motif III. Among them, motif I and III are involved in binding divalent metal ions, while motif II is involved in binding nucleotides.
[0057] Therefore, proteins containing the VirE N-terminal domain (with two αβ units at the N-terminus and one RNA recognition motif (RRM) fold at the C-terminus), containing three conserved motifs: motif I is hhhDhD / E (h is a hydrophobic residue), motif II is sxK (s is a small residue, and x can be any residue), and motif III (hD / E), and with an amino acid sequence having a consistency greater than 30% with the sequence shown in SEQ ID NO.1 all belong to the VirEN protein described in the present invention. In addition, the VirEN protein also belongs to the prokaryotic Argonaute-associated protein, so the original VirEN protein-encoding gene is located within 20 gene regions upstream or downstream of the Argonaute-associated protein-encoding gene.
[0058] The inventors selected VirEN from Seonamhaeicola sp. S2-3 for research. In addition to finding that it has typical polymerase activity and primase activity, it was unexpectedly found that when analyzing the polymerase reaction of VirEN with single-stranded DNA as the substrate, VirEN was able to catalyze primer extension reactions on substrates (ssDNA-4) containing terminal complementary sequences, but did not have the above activity on substrates (ssDNA-0) without terminal complementary sequences ( Figure 2 ). These results indicate that VirEN has the function of microhomology-mediated end joining (MMEJ) and may be applied to DNA splicing.
[0059] Example 2 MMEJ-assisted in vitro DNA assembly mediated by VirEN
[0060] In the inventors' study of the terminal transferase activity reaction of single-stranded DNA mediated by VirEN, through non-denaturing gel electrophoresis, for substrates containing complementary 3'-CCGG sequences, VirEN converted ssDNA-4 into a product twice its size, but no product was observed in the non-complementary 3'-CCAA sequence with a 3' overhang, confirming that VirEN can mediate base pairing of single-stranded complementary 3' overhangs and amplify using them as templates respectively ( Figure 2 ).
[0061] The present invention tested whether VirEN can mediate DNA splicing through MMEJ reactions using different dsDNA substrates with 3' overhangs (including microhomology-free ends or 2, 4, and 6 nt microhomology ends), and the results are as Figure 3 shown. In non-denaturing gels, for substrates containing complementary 3'-CCGG sequences, VirEN converted pssDNA-4 into a product twice its size, but no product was observed in the non-complementary 3'-CCAA sequence with a 3' overhang, confirming that the MMEJ reaction mediated by VirEN is mediated by base pairing of complementary 3' overhangs. VirEN also promoted the formation of MMEJ products at 3'-CCCGGG ends, but with lower efficiency in the ligation of pssDNA-7 (3'-GTAC) and pssDNA-9 (3'-TTTAAA). In addition, almost no MMEJ products were observed in pssDNA-8 (3'-TTAA) and pssDNA-2 (3'-GC). These results indicate that VirEN can catalyze MMEJ reactions, and the reaction efficiency is related to the GC content and the length of the complementary sequence. For GC-rich homologous ends, at least 4 nt of complementary sequence is required, while for AT-rich homologous ends, at least 6 nt of complementary sequence is required.
[0062] When the length of the homologous sequence ≥ 4 and the number of hydrogen bonds is greater than 12, the reaction has a high efficiency. When the length of the homologous sequence < 4 and the number of hydrogen bonds is less than 12, the efficiency of the reaction is significantly reduced. For example, substrates with ends of GTAC (the number of hydrogen bonds is 10) and TTAA (the number of hydrogen bonds is 8) have a low reaction efficiency, and at the same time, the ends of GC (the length of the homologous sequence is 2 and the number of hydrogen bonds is 6) hardly have MMEJ products.
[0063] Based on the ability of VirEN to catalyze MMEJ, the present invention designs a DNA splicing method, that is, mediating the annealing of two DNA molecules with homologous 3'-overhang sequences at the ends, and catalyzing DNA synthesis with one 3'-overhang sequence as a template and the other 3'-overhang sequence as a primer, so as to achieve the splicing of DNA molecules. This MMEJ-assisted DNA assembly method is named MEDA assembly ( M M E J-assisted D NA A ssembly), which can be applied to DNA cloning ( Figure 4 ).
[0064] Compared with the traditional Gibson assembly method, the advantages of MEDA are as follows:
[0065] (1) The assembly reaction depends on MMEJ assistance, enabling DNA assembly to be carried out under shorter homologous sequences, reducing the cost of primer synthesis, and reducing the adverse effects of too long homologous sequences on PCR amplification or DNA assembly;
[0066] (2) The products of the assembly reaction can be directly transformed into Escherichia coli without subsequent operations;
[0067] (3) The reaction system is simple, low-cost, convenient and fast to operate, and is suitable for large-scale popularization and use.
[0068] Example 3 Assembly of homologous sequences of different lengths
[0069] The present invention further tests the effectiveness of the MEDA assembly method mediated by VirEN for homologous sequences of different lengths.
[0070] The specific process is as follows:
[0071] 1) The template required for the preparation process of the linearized vector is derived from plasmid pUC19 and is linearly amplified by PCR using primers 19k-F / 19k-R (length 2686 bp). The inserted KanR resistance gene fragment (length 900 bp) is amplified by PCR using primer pairs 4-Kan-F / 4-Kan-R, 6-Kan-F / 6-Kan-R, 8-Kan-F / 8-Kan-R, and 15-Kan-F / 15-Kan-R respectively, and homologous arms of 4 bp - 15 bp are introduced at the ends. Then, agarose gel electrophoresis is performed on the PCR products, the target fragments are recovered by cutting the gel, and quantified.
[0072] 2) The linearized pUC19 vector and the Kan fragments with different lengths of homologous arms are assembled in two fragments. The assembly system is that the dosage of VirEN protein is 1 μM, the dosage of T5 exonuclease is 0.04 U / total reaction system, and the reaction buffer system components are 100 mM, pH = 7.5 Tris-HCL, 10 mM MgCl2, 1 mM DTT, 5% (mass ratio) PEG8000, and 100 μM dNTP. The total system is 20 μL. Among them, the dosage of the linearized vector is 100 ng, the molar ratio of the inserted fragment to the vector added is 4:1, and the reaction is carried out at 30 °C for 40 min. The control group uses the TEDA technology (refer to Patent CN108841901A), and the reaction system is the same in other conditions except that VirEN and dNTP are not added. The components of the PEG8000 buffer are 100 ± 5 mM, pH = 7.5 Tris-HCL, 10 ± 1 mM MgCl2, 10 ± 1 mM DTT, and 0 - 5% (mass ratio) PEG8000.
[0073] 3) After the reaction is completed, 10 μL of the assembled product is transformed into DH5α competent cells prepared by the Inoue method. The transformed product is spread on a 50 μg / mL Kan resistance plate to screen for positive clones, and the number of monoclonal colonies is counted after overnight culture.
[0074] The results are as Figure 5 shown. When the homologous sequence is 15 bp, the assembly efficiency of MEDA is the same as that of TEDA, and is also at the same level as the commercial DNA assembly method. When the homologous sequence is 4 - 8 bp, the assembly efficiency of MEDA is much higher than that of TEDA. At the same time, for the MEDA technology, the 8 bp homologous sequence and the 15 bp homologous sequence obtain similar assembly efficiencies. These results indicate that MEDA can use shorter homologous sequences for DNA assembly.
[0075] The positive clone rate and accuracy of MEDA were further verified under the condition of no screening pressure. The DNA assembly of the above pUC19 plasmid PCR product and the 8bp homologous arm Kan fragment was transformed and coated on a plate containing 100 μg / mL Amp resistance. The number of positive clones was verified by colony PCR, the positive clone rate of MEDA was analyzed, and the accuracy of MEDA was further analyzed by sequencing the positive clones. The results are as Figure 6 shown. 24 were all randomly selected single colonies. Under this condition, the positive rate of TEDA was 30%, while the positive rate of MEDA was 75%; 10 positive clones generated by MEDA were randomly selected for sequencing analysis, and the results showed that all the sequences were correct.
[0076] Example 4 Effect of Different Concentrations of VirEN Protein on the Assembly Efficiency of MEDA
[0077] The present invention further tested the effect of different concentrations of VirEN protein on the assembly efficiency of MEDA. The experimental process referred to Example 3. An 8bp homologous arm was introduced into the Kan PCR fragment, and different concentrations of VirEN protein were introduced during the MEDA reaction. The specific process is as follows:
[0078] 1) The template required for the preparation process of the linearized vector was derived from the plasmid pUC19 and linearized by primer 19k-F / 19k-R PCR. The inserted KanR resistance gene expression cassette was amplified by PCR with primer pair 8-Kan-F / 8-Kan-R and an 8bp homologous arm was introduced at the end. Then, the PCR product was subjected to agarose gel electrophoresis, the target fragment was cut out and recovered, and quantified.
[0079] 2) Prepare MEDA reaction systems containing different concentrations of VirEN protein. By introducing different concentrations of VirEN protein into a 20 μL MEDA assembly system, the concentrations were 0, 0.01, 0.05, 0.1, 0.2, 0.5, 0.75, 1, and 2 μM respectively. The dosage of T5 exonuclease was 0.04 U / total reaction system. The reaction buffer system components were 100 mM, pH = 7.5 Tris-HCL, 10 mM MgCl2, 1 mM DTT, 5% (mass ratio) PEG8000, and 100 μM dNTP.
[0080] 3) Perform 2-fragment assembly of the linearized pUC19 vector and the Kan fragment with an 8bp homologous arm. The assembly system used the above-prepared MEDA reaction systems containing different concentrations of VirEN protein. The dosage of the linearized vector was 100 ng, and the molar ratio of the inserted fragment to the vector added was 4:1. The reaction was carried out at 30 °C for 40 min. The control group used an inserted fragment with an 8bp homologous sequence at the end and the linearized pUC19 vector for assembly. The reaction system was the same in other conditions except that VirEN and dNTP were not added.
[0081] 4) After the reaction was completed, 10 μL of the assembled product was transformed into DH5α competent cells prepared by the Inoue method. The transformed product was spread on a 50 μg / mL Kan-resistant plate to screen for positive clones, and the number of monoclonal colonies was counted after overnight culture.
[0082] The experimental results are as Figure 7 shown. When the concentration of VirEN was lower than 0.05 μM, the effect of VirEN on the assembly efficiency was almost negligible. When the concentration of VirEN reached 0.05 μM, the assembly efficiency was greatly improved, and the assembly efficiency increased with the increase in the concentration of VirEN. When the concentration of VirEN was higher than 0.1 μM, the change in the assembly efficiency with the increase in the concentration of VirEN was not obvious.
[0083] Example 5 Effect of dNTP Concentration on the Assembly Efficiency of MEDA
[0084] The present invention further tested the effect of different dNTP concentrations on the assembly efficiency of MEDA. The experimental procedure referred to Example 4, with the amount of VirEN protein being 0.2 μM, and different dNTP concentrations were introduced into the MEDA assembly system. The specific procedure was as follows:
[0085] 1) The template required for the preparation of the linearized vector was derived from plasmid pUC19 and linearized by PCR with primers 19k-F / 19k-R. The inserted KanR resistance gene expression cassette was amplified by PCR with primer pair 8-Kan-F / 8-Kan-R and 8 bp homologous arms were introduced at the ends. Then, the PCR product was subjected to agarose gel electrophoresis, the target fragment was cut out and recovered, and quantified.
[0086] 2) Prepare MEDA reaction systems containing different dNTP concentrations. By introducing different dNTP concentrations into a 20 μL MEDA assembly system, the concentrations were 0, 5, 20, 50, 100, 200, and 500 μM, respectively. The amount of VirEN protein was 0.2 μM, the amount of T5 exonuclease was 0.04 U / total reaction system, and the reaction buffer system components were 100 mM, pH = 7.5 Tris-HCL, 10 mM MgCl2, 1 mM DTT, and 5% (mass ratio) PEG8000.
[0087] 3) The linearized pUC19 vector and the Kan fragment with an 8-bp homologous arm were assembled in a two-fragment assembly. The assembly system used the MEDA reaction system containing different dNTP concentrations configured as above. The amount of the linearized vector used was 100 ng, and the molar ratio of the inserted fragment to the vector added was 4:1. The reaction was carried out at 30 °C for 40 min. In the control group, the inserted fragment with an 8-bp homologous sequence at the end was assembled with the linearized pUC19 vector. The reaction system was the same in other conditions except that VirEN and dNTP were not added.
[0088] 4) After the reaction was completed, 10 μL of the assembly product was transformed into DH5α competent cells prepared by the Inoue method. The transformed product was spread on a 50 μg / mL Kan-resistant plate to screen for positive clones, and the number of monoclonal colonies was counted after overnight culture.
[0089] The experimental results are as Figure 8 shown. MEDA assembly requires the presence of dNTP, and dNTP plays an important role in the assembly system established in the present invention. Good assembly effects are achieved between 5 - 500 μM. When it is lower than 0.5 μM, MEDA assembly cannot occur, and the efficiency is the highest at 50 μM. To ensure the assembly efficiency, we determined that the addition amount of dNTP in the reaction system is 50 μM. After VirEN and dNTP are added to the assembly system, the VirEN protein catalyzes the annealing of the homologous 3'-overhanging sequences at the ends. In the presence of dNTP, DNA synthesis is catalyzed with one 3'-overhanging sequence as the template and the other 3'-overhanging sequence as the primer to repair and fill the single-strand gap, thereby achieving the splicing of DNA molecules.
[0090] Example 6 The MEDA assembly method can assemble multiple fragments
[0091] The present invention further tested the assembly results of the MEDA method for different numbers (1 - 3) of fragments and linearized vectors. The specific process is as follows:
[0092] 1) The template required for the preparation process of the linearized vector is derived from the plasmid pUC19 and linearized by primer 19k-F / 19k-R PCR. The inserted fragments are derived from the KanR, SmR, and CmR resistance gene expression cassettes. The 8-Kan, 10-Kan, and 15-Kan fragments are amplified using 8-Kan-F / 8-Kan-R, 10-Kan-F / 10-Kan-R, and 15-Kan-F / 15-Kan-R respectively; the 8-Kan-2, 10-Kan-2, and 15-Kan-2 are amplified using 8-Kan-F / 8-Kan-SPC-R, 10-Kan-F / 10-Kan-SPC-R, and 15-Kan-F / 15-Kan-SPC-R respectively; the 8-SPC-2, 10-SPC-2, and 15-SPC-2 are amplified using SPC-F / 8-SPC-19K-R, SPC-F / 10-SPC-19K-R, and SPC-F / 15-SPC-19K-R respectively; the 8-SPC-3, 10-SPC-2, and 15-SPC-2 are amplified using SPC-F / 8-SPC-CHL-R, SPC-F / 10-SPC-CHL-R, and SPC-F / 15-SPC-CHL-R respectively; the 8-Chl-3, 10-Chl-3, and 15-Chl-3 are amplified using CHL-F / 8-CHL-19K-R, CHL-F / 10-CHL-19K-R, and CHL-F / 15-CHL-19K-R respectively. When performing the above PCR amplifications, 8bp or 10bp or 15bp homologous arms are introduced.
[0093] 2) The linearized pUC19 vector and the Kan fragments with 8bp, 10bp, and 15bp homologous sequences respectively are assembled in 2 fragments; the linearized pUC19 vector and the Kan-2 and SPC-2 with 8bp, 10bp, and 15bp homologous sequences respectively are assembled in 3 fragments; the linearized pUC19 vector and the Kan-2, SPC-3, and Chl-3 with 8bp, 10bp, and 15bp homologous sequences respectively are assembled in 4 fragments. The components of the assembly system are as follows: the dosage of VirEN protein is 0.2 μM, the dosage of T5 exonuclease is 0.04 U / total reaction system, and the reaction buffer system components are 100 mM Tris-HCL with pH = 7.5, 10 mM MgCl2, 1 mM DTT, 5% (mass ratio) PEG8000, and 50 μM dNTP. The dosage of the linearized vector is 100 ng, the molar ratio of the inserted fragment to the vector added is 2:1, and the reaction is carried out at 30 °C for 40 min.
[0094] 3) After the assembly reaction was completed, 10 μL of the assembled product was transformed into DH5α competent cells prepared by the Inoue method. The transformed products were respectively spread on resistance plates of 50 μg / mL Kan, 50 μg / mL Kan + 50 μg / mL Str, and 50 μg / mL Kan + 50 μg / mL Str + 25 μg / mL CHl to screen for positive clones. After overnight culture, the number of monoclonal colonies was counted.
[0095] The experimental results are as Figure 9 shown. The assembly method of MEDA can achieve the assembly of multiple fragments of 2 fragments, 3 fragments, and 4 fragments. Compared with the 2-fragment assembly, the assembly efficiency of 3 fragments and 4 fragments is slightly lower, but sufficient clones can still be obtained, and the assembly efficiency of the 10-bp homologous arm is similar to that of the 15-bp homologous arm. When the length of the homologous sequence is 10 bp, the assembly efficiency of MEDA for multiple fragments is higher than that of TEDA.
[0096] Example 7 Effects of Assembly at Different Reaction Times and Different Reaction Temperatures on the Assembly Efficiency of MEDA
[0097] The reaction temperature of the MEDA assembly method is 30 °C instead of 50 °C of Gibson assembly because the decrease in temperature may allow some short single-stranded DNAs to anneal. However, due to the above research on the molecular mechanism of VirEN, the biochemical reaction temperature is 37 °C. Therefore, the present invention further tested the effects of different reaction conditions on the assembly efficiency of MEDA. The experimental procedure referred to Example 3, and an 8-bp homologous arm was introduced into the Kan PCR fragment. Different reaction temperatures and reaction times were used during the MEDA reaction. The specific procedure is as follows:
[0098] 1) The template required for the preparation of the linearized vector was derived from plasmid pUC19 and linearized by primer 19k-F / 19k-R PCR. The inserted KanR resistance gene expression cassette was amplified by primer pair 8-Kan-F / 8-Kan-R PCR and an 8-bp homologous arm was introduced at the end. Then, the PCR product was subjected to agarose gel electrophoresis, and the target fragment was cut out and recovered, and quantified.
[0099] 2) The linearized pUC19 vector and the Kan fragment with an 8-bp homologous arm were assembled in a two-fragment system. The usage amount of VirEN protein was 1 μM, the usage amount of T5 exonuclease was 0.04 U / total reaction system, and the reaction buffer system components were 100 mM, pH = 7.5 Tris-HCL, 10 mM MgCl2, 1 mM DTT, 5% (mass ratio) PEG8000, and 100 μM dNTP. The total system was 20 μL. Among them, the usage amount of the linearized vector was 100 ng, and the molar ratio of the inserted fragment to the vector added was 4:1. The experimental groups were set with reaction temperatures and reaction times of 30°C for 20 min, 30°C for 40 min, 33°C for 20 min, 33°C for 40 min, 37°C for 20 min, and 37°C for 40 min. The control group used TEDA technology (refer to Patent CN108841901A). Except for not adding VirEN and dNTP, other conditions of the reaction system were the same. The reaction temperature was 30°C and the reaction time was 40 min.
[0100] 3) After the reaction was completed, 10 μL of the assembled product was transformed into DH5α competent cells prepared by the Inoue method. The transformed product was spread on a 50 μg / mL Kan-resistant plate to screen for positive clones, and the number of monoclonal colonies was counted after overnight culture.
[0101] The experimental results are as Figure 10 shown. The MEDA assembly efficiency is optimal at 30°C for 20 - 40 min. As the reaction time increases, the single-stranded DNA generated by T5 exonuclease digesting the 5'-ends of the linearized vector and the inserted fragment becomes longer. In this test, at a reaction temperature of 37°C, the number of positive clones after 40 min of reaction is more than that after 20 min of reaction.
[0102] Example 8 Effect of PEG8000 on DNA Assembly
[0103] PEG8000 molecules in the buffer system can further enhance the annealing effect and also have a protective effect on the annealing of DNA molecules. VirEN can also promote the annealing of short single-stranded DNA. Therefore, this invention explored the effect of PEG8000 on MEDA assembly. The experimental process referred to Example 3. An 8-bp homologous arm was introduced into the Kan PCR fragment, and a buffer without or with PEG8000 was configured for DNA assembly testing. The specific process is as follows:
[0104] 1) The template required for the preparation process of the linearized vector was derived from plasmid pUC19 and was linearized by PCR with primers 19k-F / 19k-R. The inserted KanR resistance gene expression cassette was amplified by PCR with primer pairs 8-Kan-F / 8-Kan-R and an 8-bp homologous arm was introduced at the ends. Then, the PCR products were subjected to agarose gel electrophoresis, and the target fragments were excised and recovered, and quantified.
[0105] 2) Configure the MEDA reaction system with or without PEG8000. In a 20-μL MEDA assembly system, do not introduce or introduce 5% (by mass) of PEG8000 (brand: biofroxx). The dosage of VirEN protein is 0.2 μM, and the dosage of T5 exonuclease is 0.04 U / total reaction system. The reaction buffer system components are 100 mM, pH = 7.5 Tris-HCL, 10 mM MgCl2, and 1 mM DTT.
[0106] 3) Assemble the linearized pUC19 vector and the Kan fragment with an 8-bp homologous arm in a 2-fragment assembly. The MEDA reaction system configured above with or without 5% PEG8000 is used for the assembly system. The dosage of the linearized vector is 100 ng, and the molar ratio of the inserted fragment to the vector added is 4:1. React at 30 °C for 40 min. The control group uses an inserted fragment with an 8-bp homologous sequence at the end and the linearized pUC19 vector for assembly. The reaction system is the same in other conditions except that VirEN and dNTP are not added.
[0107] 4) After the reaction is completed, take 10 μL of the assembly product and transform it into DH5α competent cells prepared by the Inoue method. The transformed product is spread on a 50-μg / mL Kan-resistant plate to screen for positive clones, and the number of monoclonal colonies is counted after overnight culture.
[0108] The experimental results are as Figure 11 shown. When the homologous arm is 8 bp, the number of positive clones formed by the group without PEG8000 after MEDA assembly is significantly lower than the number of clones formed by the group with PEG8000. When the homologous arm is 15 bp, VirEN can replace the role of the PEG8000 molecule. Therefore, PEG8000 with a mass ratio of 0 - 5% can complete MEDA assembly.
[0109] Based on the above test results, this example provides a typical reaction system. This reaction system consists of VirEN protein, T5 exonuclease, and a buffer containing dNTP and PEG8000; calculated based on a total reaction volume of 20 μL, the dosage of VirEN protein is 0.2 μM, the dosage of T5 exonuclease is 0.04 U / total reaction system, the reaction buffer system components are 100 mM, pH = 7.5 Tris-HCL, 10 mM MgCl2, 10 mM DTT, 5% (by mass) of PEG8000, and 50 μM of dNTP.
[0110] Among them, VirEN and T5 exonuclease in the reaction system are premixed and pre-configured at a 2× concentration, reserving for the addition of DNA later. The 2× premixed reaction system can be stored at -80°C and repeatedly frozen and thawed without affecting the assembly reaction effect.
[0111] 5×MEDA reaction buffer
[0112]
[0113] 2×MEDAassembly mixture
[0114]
[0115] In some embodiments, the dosage of T5 exonuclease can be 0.04 U - 0.08 U / total reaction system, and the buffer components of PEG8000 can be 110 ± 5 mM Tris-HCl with pH = 7.5, 10 ± 1 mM MgCl2, 10 ± 1 mM DTT, and 5 ± 1% PEG8000 by mass ratio.
[0116] Example 9 VirEN-Mediated In Vivo Gene Editing
[0117] In addition to mediating in vitro DNA assembly, MMEJ can also be used for template-independent gene knockout or large-fragment DNA deletion in vivo. After introducing DNA breaks in the genome using the CRISPR technology (or other technologies that can cause DNA breaks, such as TALEN), they can be repaired by the homologous recombination (HR) pathway and the non-homologous end joining (NHEJ) pathway that rely on repair templates, while MMEJ is the third repair pathway, which is characterized by being independent of repair templates and can generate longer DNA deletions. Therefore, it can conveniently and quickly verify gene functions or delete large fragments. Especially, most microorganisms do not have the NHEJ pathway, which further shows the application value of the MMEJ pathway.
[0118] The present invention tested the effect of VirEN-mediated MMEJ in gene editing in prokaryotic organisms.
[0119] In Escherichia coli MG1655 strain, double-stranded DNA breaks (DSBs) were introduced into the dinB gene using CRISPR-Cas9. Subsequently, VirEN-mediated MMEJ randomly repaired the DSBs using the microhomologous sequences on both sides of the dinB gene, resulting in gene knockout or large fragment deletion, and this process was independent of repair templates. The specific technical solutions adopted in the present invention are as follows:
[0120] 1) Construct the editing plasmid pCas9-VirEN, where Cas9 is from Streptococcus pyogenes and is induced to express by the arabinose promoter (P BAD ), and VirEN is fusion-expressed with the MBP domain and expressed by the T5-lac promoter. At the same time, construct a plasmid (pCas9-MBP) that does not express VirEN as a control.
[0121] 2) Before constructing the sgRNA editing plasmid, it is necessary to first select appropriate target sites. In this example, we selected dinB. The CHOPCHOP website can be used to assist in the design and selection of target sites. According to the principle of high efficiency and low off-target rate, the selected target site sequence is 5'-ggtaaggtttgtaaaaatgccgg-3', which consists of a protospacer (20bp) and a PAM (3bp). The spacer sequence is ggtaaggtttgtaaaaatgc, and the PAM is cgg. Using the pTargetF plasmid stored in the laboratory as a template, a DNA fragment containing the spacer sequence was obtained by PCR with dinB-sgRNA-F / dinB-sgRNA-R primers. Subsequently, the template was digested with DpnI (Thermo Fisher FastDigest Dpn1) at 37°C for 1 h, and after cleaning and recovery, 10 μL of the recovered product was directly transformed into DH5α competent cells and cultured overnight at 37°C. Single colonies were picked for verification and sequencing. The obtained plasmid pTargetF-sgRNA dinB uses the spectinomycin resistance gene as a selection marker, and the sgRNA is controlled by the P BAD promoter for expression.
[0122] 3) When performing gene editing, first transfer the above pCas9-VirEN plasmid and pTargetF-sgRNA dinB plasmids into Escherichia coli K-12 MG1655 to be gene-edited as the experimental group, and the pCas9-MBP plasmid and pTargetF-sgRNA dinBThe plasmid was transferred into Escherichia coli K-12 MG1655 to be gene-edited as a control group. Then, transformants were picked and inoculated for culture (containing kanamycin, spectinomycin, and glucose with a final concentration of 2 mg / ml). An overnight culture was taken and transferred 1:100 into 10 ml of LB medium (containing kanamycin and spectinomycin). When the OD600 reached 0.6 - 0.7 at 37°C, IPTG with a final concentration of 0.4 mM was added to induce the expression of VirEN protein. After culturing at 18°C for 2 - 3 hours, L-arabinose with a final concentration of 3 g / L was added to induce the expression of Cas9 and sgRNA. After continuing to culture at 37°C for 2 - 3 hours, the bacterial liquid was taken and spread on LB induction plates (containing kanamycin, spectinomycin, L-arabinose, and IPTG) at different dilution ratios, and cultured overnight at 37°C.
[0123] 4) 96 single colonies were randomly picked from the plates of the control group and the experimental group, and colony PCR was performed using dinB-F / dinB-R primers to analyze the mutation rate, that is, the proportion of colonies with successful dinB gene knockout. If the editing was not successful, an agarose electrophoresis band of 1056 bp in size would be obtained; if the deleted fragment was smaller, a band smaller than 1056 bp could be obtained; and if a deletion of the dinB gene and its surrounding sequences occurred, no band could be obtained by agarose electrophoresis. After statistics, the dinB gene mutation rate was as Figure 12 shown. The probability of VirEN obtaining a dinB gene deletion was approximately 40%, which was 4 times higher than that of the control group.
[0124] 5) To further analyze whether the gene deletion was completed by the MMEJ pathway, 9 clones from the experimental group were randomly picked, and the PCR products obtained by dinB-F / dinB-R were sequenced and analyzed. The sequencing results are statistically shown in Table 1. The characteristic of the MMEJ pathway is that there is a pair of microhomologous sequences at both ends of the DSB before repair, and only one end of the microhomologous sequence is retained after repair. The sequencing results showed that VirEN-mediated MMEJ led to deletions of 486 bp - 16377 bp, including the region targeted by sgRNA, and all deletion mutants had a microhomologous sequence at one end, which mapped to short (6 - 11 nucleotides) sequence repeats in the genome. These results indicated that VirEN could repair double-strand breaks through the MMEJ pathway to complete gene editing.
[0125] Table 1 Sequencing results of MMEJ-mediated dinB mutations
[0126]
[0127]
[0128] The microhomologous sequences on both sides of the deleted fragment are marked in bold
[0129] The present invention also uses the type I-C CRISPR-Cas system to knockout the lacZ gene of Escherichia coli MG1655.
[0130] Using the reported Pseudomonas aeruginosa as a template, four cas genes (cas5, cas7, cas8, and cas3) of the type I-C CRISPR-Cas system Cascade-Cas3 were amplified, and these cas genes and virEN were cloned into an expression vector in the above order as editing plasmid 1. By cloning the linear dsDNA template obtained by annealing the repeat sequence of the I-C CRISPR-Cas system on another expression vector, which is located on both sides of two BsaI restriction enzyme recognition sites, the expression vector of crRNA was obtained. To verify the gene editing effect of VirEN-mediated MMEJ in prokaryotes, taking the knockout of the lacZ gene of Escherichia coli K-12 MG1655 strain as an example, first select a suitable target sequence, and the CHOPCHOP website tool can be used to assist in the design. After annealing the oligonucleotide primers encoding the spacer sequence targeting the lacz gene and phosphorylating them with T4 PNK (NEB), they were cloned into the crRNA expression vector using the BasI site to construct pcrRNA-LacZ as editing plasmid 2.
[0131] The Cascade-Cas3 and crRNA expression elements are expressed by the inducible promoter P BAD The inducible promoter of the VirEN protein is the T5-lac promoter. Editing plasmid 1 and editing plasmid 2 use different resistance genes as screening markers, and editing plasmid 2 has the sacB gene sensitive to sucrose.
[0132] When performing gene editing, first transfer the above plasmids 1 and 2 into Escherichia coli K-12 MG1655 to be gene-edited, and then pick the transformants and inoculate them for culture (containing antibiotics and glucose). Take the overnight culture and transfer it 1:100 to 10 ml of LB medium (containing antibiotics), and culture at 37 °C until OD600 = 0.6 - 0.7, then add IPTG with a final concentration of 0.4 mM to induce the expression of the VirEN protein. After culturing at 18 °C for 2 - 3 hours, add L-arabinose with a final concentration of 3 g / L to induce the expression of Cascade-Cas3 and crRNA, and continue to culture at 37 °C for 2 - 3 hours. Then take the bacterial solution and spread it on the LB induction plate containing X-Gal (containing antibiotics, L-arabinose, and IPTG) at different dilution degrees. After overnight culture, the successfully edited cells were screened by blue-white screening, the white colonies were positive, and the blue colonies were negative, and it was verified by picking single colonies for colony PCR and sequencing.
[0133] To achieve large - fragment deletion of the genome, two target sites can be used to simultaneously generate DNA double - strand breaks. In the design, first, a pair of micro - homologous sequences need to be found on both sides of the target deletion fragment. Then, when designing the editing plasmid 2, the sites of the designed target sequences need to be inside the target deletion fragment and as close as possible to the two micro - homologous sequences respectively. In this way, after the double - strand breaks occur at the target cleavage, the two micro - homologous sequences at the break sites can anneal under the action of MMEJ, resulting in large - fragment deletion at the target position.
[0134] Although the present invention has been described in detail with general descriptions and specific embodiments above, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of the present invention claimed.
Claims
1. Use of a VirEN protein in DNA assembly or genome editing, characterized in that, The amino acid sequence of the protein is as shown in SEQ ID NO.1, and the DNA assembly or genome editing is achieved based on microhomology-mediated end joining.
2. An in vitro DNA assembly reaction system, characterized in that, The system comprises the following components: 1) 0.05 - 2 μM of the VirEN protein described in claim 1; 2) T5 exonuclease, and the dosage of the T5 exonuclease is 0.02 - 0.32 U / total reaction system; 3) 5 - 500 μM of dNTP; 4) Reaction buffer, and the buffer components are 100 ± 5 mM, pH = 7.5 Tris-HCL, 10 ± 1 mM MgCl2, 10 ± 1 mM DTT, and 0 - 5% (mass ratio) of PEG8000; The in vitro DNA assembly is achieved based on microhomology-mediated end joining.
3. The system according to claim 2, wherein The concentration of the VirEN protein is 0.2 μM.
4. The system according to claim 2, characterized in that, The concentration of the dNTP is 50 μM.
5. The system according to claim 2, characterized in that, The mass ratio of PEG8000 in the reaction buffer is 5%.
6. An in vitro DNA assembly method, characterized in that, Using the system described in any one of claims 2 - 5, adding 2 - 4 fragments to be assembled, and reacting at 30°C - 37°C for 20 min - 40 min; The in vitro DNA assembly is achieved based on microhomology-mediated end joining.
7. A composition, characterized in that, Comprises: 1) The VirEN protein described in claim 1; 2) A nuclease system capable of causing double-strand breaks at the target site, and the nuclease system repairs the double-strand breaks based on the microhomology-mediated end joining pathway.
8. The composition according to claim 7, wherein 2) The nuclease system includes a CRISPR-Cas system or a TALEN (Transcription Activator-like Effector Nucleases) system or a zinc-finger nucleases system.
9. A vector system capable of producing the composition described in any one of claims 7 - 8.
10. Use of the composition according to any one of claims 7-8 or the carrier system according to claim 9 in causing deletion of a fragment at a genomic target position, characterized in that, Both sides of the target position fragment contain microhomologous sequences, and the microhomologous sequences achieve fragment deletion through the microhomology-mediated end joining (MMEJ) pathway.
11. The application according to claim 10, wherein The target position fragment is between 486 bp and 16377 bp.
Citation Information
Patent Citations
Kit for completing DNA assembly by depending on T5 exonuclease and PEG8000 and application thereof
CN108841901A
Methods for amplification and sequencing using thermostable TthPrimPol
CN105283558A
Composition and method for inhibiting amyloid beta accumulation and / or aggregation
CN114025777A