Synthetic primase-polymerase and uses thereof

Synthetic PrimPols address the limitations of natural PrimPols by enhancing expression rates and fidelity, enabling efficient nucleic acid amplification in industrial conditions.

JP2025525403APending Publication Date: 2025-08-05TYRIS THERAPEUTICS SL
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2024575761
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-06-29
Filing Date
2023-06-28
Publication Date
2025-08-05

AI Technical Summary

Technical Problem

Existing nucleic acid amplification methods face challenges under industrial conditions due to the limitations of natural PrimPols, such as low efficiency at low pH and high temperature, leading to bias and errors.

Method used

Development of synthetic PrimPols with improved expression rates, higher nucleic acid amplification yields, and sequence fidelity, compatible with processive DNA polymerases for use in industrial settings.

Benefits of technology

The synthetic PrimPols provide high-quality nucleic acid amplification under challenging conditions, maintaining sequence fidelity and compatibility with processive DNA polymerases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025525403000001_ABST
    Figure 2025525403000001_ABST
Patent Text Reader

Abstract

The present invention provides polypeptides comprising a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, or a variant thereof that is at least 90% identical to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3. The present invention also provides antibodies that bind to the polypeptides, nucleic acid molecules that encode the polypeptides, processes for producing the polypeptides, processes for amplifying nucleic acids, processes for producing closed linear DNA, and kits comprising the polypeptides.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of European Patent Application No. EP22382615, filed June 29, 2022.

[0002] The present invention relates to the field of molecular biology. More particularly, the present invention relates to synthetic primase-polymerases (PrimPol) that are particularly useful for priming the amplification of nucleic acid templates. [Background technology]

[0003] The introduction of in vitro nucleic acid amplification techniques has revolutionized the fields of biomedical research, disease diagnostics, and forensic science. More recently, these techniques have also become essential tools for the mass production of therapeutic nucleic acids, such as gene therapy products.

[0004] Unfortunately, in vitro nucleic acid amplification is inherently subject to bias, errors, and residual levels of contaminating nucleic acids. The primary source of potential amplification problems in current methods arises from the use of primers. Primers are short oligonucleotides that provide the starting point required by DNA polymerase for DNA synthesis. However, primers have a strong tendency to generate primer-related artifacts, often resulting in unequal amplification due to different sequence-dependent hybridization kinetics.

[0005] Not surprisingly, the development of amplification systems that do not rely on the use of primers has been the subject of intense research in recent years. To circumvent the problems that arise from the use of oligonucleotide-based priming, several primase-based methods have recently been developed.

[0006] Primase-polymerases (PrimPols) are a group of enzymes that have been used in amplification methods due to their compatibility with highly processive DNA polymerases, such as Phi29 polymerase. Most efforts to date have focused on identifying existing bacterial and archaeal PrimPols that can improve current amplification methods. However, the natural PrimPols identified to date have limited efficiency under industrial conditions, such as low pH or high temperature, strongly hindering their use in industrial environments. [Prior art documents] [Patent documents]

[0007] [Patent Document 1] International Publication No. 2009 / 100309 [Patent Document 1] International Publication No. 2011 / 000997 [Non-patent literature]

[0008] [Non-Patent Document 1] "Basic local alignment search tool", 1990, Journal of Molecular Biology, vol. 215, pp. 403-410. [Non-patent document 2] "Human PrimPol is a highly error-prone polymerase regulated by single-stranded DNA binding proteins", Nucleic Acids Research, January 2015, vol. 43(2), pp. 1056-68. [Non-patent document 3] "Linear closed mini DNA generated by the prokaryotic cleaving-joining enzyme TelN is functional in mammalian cells", Journal of Molecular Medicine, 2002, vol. 80(10), pp. 648-54. Summary of the Invention [Problem to be solved by the invention]

[0009] Therefore, there remains a need in the art for an improved PrimPol that can be used under industrial conditions for efficient amplification of nucleic acids. [Means for solving the problem]

[0010] The present inventors have developed a range of synthetic primase-polymerase enzymes (PrimPols) that are particularly useful in nucleic acid amplification processes.

[0011] As shown in the following examples, the synthetic PrimPols developed by the present inventors surprisingly offer various advantages over natural PrimPols, making them particularly suitable for use in industrial processes. For example, synthetic PrimPols have higher expression rates than natural PrimPols and also provide higher nucleic acid amplification yields under certain conditions (e.g., lower pH and higher temperature) while maintaining very high sequence fidelity. Advantageously, the synthetic PrimPols provided herein are compatible with highly processive strand-displacing DNA polymerases, allowing them to be used in combination to produce very large amounts of high-quality nucleic acids.

[0012] All these unique features make the synthetic PrimPol of the present invention an important molecular tool for any application involving the amplification of nucleic acids, especially in an industrial setting.

[0013] Thus, in a first aspect, the present invention provides a polypeptide comprising a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, or a variant thereof which is at least 80% identical, particularly at least 90% identical to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3.

[0014] In a second aspect, the present invention provides an antibody that specifically binds to a polypeptide comprising or consisting of a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.

[0015] In a third aspect, the present invention provides a nucleic acid sequence encoding a polypeptide as defined in the first aspect, wherein the nucleic acid sequence is particularly optimized for expression in a mammalian expression system, or alternatively for expression in a bacterial expression system.

[0016] In a fourth aspect, the present invention provides a genetic construct comprising a nucleic acid sequence as defined in the third aspect operably linked to an expression promoter.

[0017] In a fifth aspect, the present invention provides an expression vector comprising a genetic construct as defined in the fourth aspect.

[0018] In a sixth aspect, the present invention provides a host cell comprising a nucleic acid sequence defined in the third aspect, a genetic construct defined in the fourth aspect, or an expression vector defined in the fifth aspect.

[0019] In a seventh aspect, the present invention provides a process for producing a polypeptide as defined in the first aspect, the process comprising the steps of a) culturing a host cell as defined in the sixth aspect under conditions suitable for producing the polypeptide, b) recovering the polypeptide, and optionally c) purifying the polypeptide.

[0020] In an eighth aspect, the present invention provides a polypeptide obtainable by the process defined in the seventh aspect.

[0021] In a ninth aspect, the present invention provides a process for amplifying a nucleic acid, comprising contacting the nucleic acid with a polypeptide as defined in the first aspect and, optionally, a DNA polymerase, in particular a strand-displacing DNA polymerase, under conditions suitable for amplifying the nucleic acid.

[0022] In a tenth aspect, the present invention provides the use of a polypeptide as defined in the first aspect for amplifying, detecting or sequencing a nucleic acid.

[0023] In an eleventh aspect, the present invention provides the use of a polypeptide as defined in the first aspect in combination with a DNA polymerase, in particular a strand-displacing DNA polymerase, for amplifying, detecting or sequencing nucleic acids.

[0024] In a twelfth aspect, the present invention provides a process for producing a closed linear DNA comprising the steps of: a) providing a DNA template comprising a DNA sequence of interest; b) amplifying DNA from the DNA template of step (a), wherein the amplification is primed with a polypeptide as defined in the first aspect; c) producing a closed linear DNA using the amplified DNA produced in step (b); and d) optionally purifying the produced closed linear DNA.

[0025] In a thirteenth aspect, the present invention provides the use of a polypeptide as defined in the first aspect for generating closed linear DNA.

[0026] In a fourteenth aspect, the present invention provides a kit comprising a) a polypeptide as defined in the first aspect, b) a DNA polymerase, in particular a strand-displacing DNA polymerase, and c) optionally instructions for its use. [Brief explanation of the drawings]

[0027] [Figure 1]Figure 1 shows the expression rates of synthetic PrimPol and TthPrimPol for Example 2. The y-axis represents the amount of enzyme (mg) produced per liter of bacterial culture, as determined by absorbance measurements at 280 nm. "Tth" refers to TthPrimPol, "1" refers to PrimPol1 of SEQ ID NO: 1, "2" refers to PrimPol2 of SEQ ID NO: 4, "3" refers to PrimPol3 of SEQ ID NO: 3, and "4" refers to PrimPol4 of SEQ ID NO: 2. [Figure 2]

[0039] Referring to Example 3, the priming efficiency of a circular ssDNA template by synthetic PrimPol and TthPrimPol under different conditions is shown. The y-axis represents the concentration (ng) of total DNA produced in the priming reaction with the indicated PrimPol. "Tth" refers to TthPrimPol, "1" refers to PrimPol1 of SEQ ID NO: 1, "2" refers to PrimPol2 of SEQ ID NO: 4, "3" refers to PrimPol3 of SEQ ID NO: 3, and "4" refers to PrimPol4 of SEQ ID NO: 2. [Figure 3] Regarding Example 4, a gapped plasmid extension assay based on the psJ4 plasmid is shown. Gapped plasmids with gaps in the 5'-3' strand (Nb) or 3'-5' strand (Nt) were generated. When a gap was present, EcoRI was able to completely cleave the plasmid; when the gap was filled by polymerase, EcoRI regained its ability to completely cleave the plasmid. Reactions were performed using 100 nM of the above-mentioned primase polymerase and 35 ng of gapped plasmid in the presence of Mg2+ and dNTPs at 30°C for 30 minutes. Subsequently, the reaction product and the gapped plasmid substrate were digested with EcoRI for 15 minutes at 37°C as a control and loaded onto a 1% agarose gel. The presence of digested linear plasmid and the absence of gapped plasmid indicates that the primase polymerase can extend the gapped substrate. The up arrow indicates gapped, and the down arrow indicates linear. "C" refers to the control, "Tth" refers to TthPrimPol, "1" refers to PrimPol1 of SEQ ID NO: 1, "2" refers to PrimPol2 of SEQ ID NO: 4, and "4" refers to PrimPol4 of SEQ ID NO: 2. [Figure 4]For Example 5, quantification of amplification of clDNA templates with the indicated PrimPol in combination with Phi29 DNA polymerase at low temperature (30°C) is shown. The y-axis represents the amount of amplified DNA (ng / μl). In the left group (-), reactions were performed in the absence of Phi29, and in the right group (+), reactions were performed in the presence of Phi29. In each group, the first column from the left represents TthPrimPol, the second represents PrimPol1 of SEQ ID NO: 1, the third represents a negative control without PrimPol, and the fourth represents PrimPol4 of SEQ ID NO: 2. [Figure 5]

[0033] Referring to Example 6, quantification of amplification of c1 DNA templates with the indicated PrimPol in combination with Phi29 DNA polymerase at elevated temperature (50°C) is shown. The y-axis represents the amount of amplified DNA (ng / μl). The conditions tested were as follows: "C1", pH 8.5, 50 nM PrimPol, 25 ng / μl Phi29, 0.5 ng / μl DNA template; "C2", pH 7.5, 600 nM PrimPol, 25 ng / μl Phi29, 0.5 ng / μl DNA template; "C3", pH 7.5, 50 nM PrimPol, 8 ng / μl Phi29, 0.1 ng / μl DNA template; and "C4", pH 8, 325 nM PrimPol, 16.5 ng / μl Phi29, 0.3 ng / μl DNA template. Grey bars represent PrimPol1 of SEQ ID NO: 1, black bars represent PrimPol2 of SEQ ID NO: 4, and diagonally striped bars represent TthPrimPol. P values were calculated by pairwise t-test. [Figure 6]

[0023] Referring to Example 7, quantification of amplification products for reactions performed with the indicated PrimPol in combination with Phi29 DNA polymerase at different reaction times (3 and 6 hours) is shown. The y-axis represents the amount of amplified DNA (ng / μl). "Tth" refers to TthPrimPol, "1" refers to PrimPol1 of SEQ ID NO: 1, and "2" refers to PrimPol3 of SEQ ID NO: 3. [Figure 7]For Example 8, an agarose gel loaded with clDNA generated by RCA amplification primed with the indicated PrimPol followed by TelN treatment is shown. Arrows indicate bands corresponding to the clDNA products. "Tth" refers to TthPrimPol, "1" refers to PrimPol1 of SEQ ID NO: 1, "4" refers to PrimPol4 of SEQ ID NO: 2, and "C+" refers to the clDNA template used for amplification. DETAILED DESCRIPTION OF THE INVENTION

[0028] Detailed Description of the Invention All terms used herein in this application shall be understood to have their ordinary meaning as known in the art unless otherwise specified. Other, more specific definitions of certain terms used in this application are set forth below and are intended to apply uniformly throughout the specification and claims, unless a definition expressly set forth otherwise provides a broader definition.

[0029] As used herein, the indefinite articles "a" and "an" are synonymous with "at least one" or "one or more." Unless otherwise indicated, definite articles such as "the" used herein also include the plural of the noun.

[0030] For purposes of the present invention, any given range includes both the lower and upper endpoints of the range. A given range, such as a concentration, should be considered an approximation unless otherwise specified. The term "about" refers to a deviation of ±10%, preferably ±5%.

[0031] As noted above, in a first aspect, the present invention provides a polypeptide comprising a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, or a variant thereof that is at least 80% identical, particularly at least 90% identical, to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3. This aspect therefore refers to a polypeptide comprising SEQ ID NO:1 or a variant thereof that is at least 80% identical, particularly at least 90% identical, to SEQ ID NO:1; a polypeptide comprising SEQ ID NO:2 or a variant thereof that is at least 80% identical, particularly at least 90% identical, to SEQ ID NO:2; and a polypeptide comprising SEQ ID NO:3 or a variant thereof that is at least 80% identical, particularly at least 90% identical, to SEQ ID NO:3. The present invention also provides polypeptides comprising a sequence that is at least 80% identical, particularly at least 90% identical, to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3.

[0032] The sequences of SEQ ID NOs: 1 to 4 are disclosed in Table 1 below. [Table 1]

[0033] Polypeptide sequence variants are well understood to those of skill in the art and can encompass amino acid sequence modifications, which typically fall into one or more of three groups: substitutional, insertional, or deletional variants.

[0034] In the present invention, the term "identical" or "identity" refers to the percentage of residues that are identical in two sequences when the sequences are optimally aligned. In optimal alignment, if a position in a first sequence is occupied by the same amino acid residue as the corresponding position in a second sequence, the sequences are considered to be identical at that position. The percentage of identity determines the number of identical residues across a specified length in a given alignment. Therefore, the level of identity between two sequences or ("percent sequence identity") is measured as the ratio of the number of identical positions shared by the sequences to the number of positions compared (i.e., percent sequence identity = (number of identical positions / total number of positions compared) x 100). Gaps, i.e., positions in the alignment where a residue exists in one sequence but not in the other, are considered as positions with non-identical residues and are counted as positions to be compared.

[0035] By way of example, a polypeptide having an amino acid sequence that is at least, for example, 95% identical to the reference amino acid sequence of SEQ ID NO: 1 is intended to mean that the amino acid sequence of the polypeptide is identical to the reference sequence, except that the polypeptide sequence may contain up to 5 amino acid changes per 100 amino acids of the reference amino acid sequence of SEQ ID NO: 1. In other words, to obtain a polypeptide having an amino acid sequence that is at least 95% identical to the reference amino acid sequence, up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or up to 5% of the total number of amino acids in the reference sequence may be inserted into the reference sequence. These changes in the reference sequence may occur at the amino-terminal or carboxy-terminal position of the reference amino acid sequence, or anywhere between these terminal positions, and may be scattered individually among residues in the reference sequence or in one or more consecutive groups within the reference sequence.

[0036] Many mathematical algorithms are known for quickly obtaining optimal alignment and calculating the identity between two or more sequences, and are incorporated into many available software programs.For the purpose of the present invention, the sequence identity between two amino acid sequences is preferably determined using a global alignment-based algorithm, such as the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, Journal of Molecular Biology, 48, 443-453), implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends in Genetics, 16:276-277), or the BLAST Global Alignment tool (Altschul et al., "Basic local alignment search tool", 1990, Journal of Molecular Biology, 215, 403-410), using default settings.If the sequences to be compared are substantially the same length, local alignment can also be used.

[0037] In certain embodiments of the first aspect, optionally in combination with any of the embodiments provided above or below, the polypeptide has primase activity and polymerase activity (i.e., the polypeptide is a primase-polymerase or PrimPol). In more specific embodiments, the polypeptide has DNA primase activity and DNA polymerase activity. Those skilled in the art would know, using their general knowledge, how to test whether a polypeptide has primase and polymerase activity; for example, the polypeptide can be contacted with a nucleic acid under conditions suitable for amplification, and then the reaction product can be measured by absorbance at a wavelength of 260 nm.

[0038] In certain embodiments of the first aspect, optionally in combination with any of the embodiments provided above or below, the polypeptide has at least one improved property compared to TthPrimPol.

[0039] As used herein, the term "primase-polymerase" is used interchangeably with "PrimPol" and refers to a group of enzymes that have both primase and polymerase activity. The term "TthPrimPol" is well known to those skilled in the art and refers to Thermus thermophilus HB27 primase-polymerase, described, for example, in International Publication No. WO2019101596 (Figure 18, SEQ ID NO: 10). It includes gene ID: NC_005835, protein WP_01 1173100.1 in the NCBI Entrez database, and TthPrimPol is commercially available.

[0040] In certain embodiments of the first aspect, optionally in combination with any of the embodiments provided above or below, the at least one improved property compared to TthPrimPol is selected from higher pH stability, higher thermostability, higher primase activity, higher polymerase activity, higher fidelity, and higher expression rate. In certain embodiments, the polypeptide has higher primase activity than TthPrimPol at pH 7.5. In more specific embodiments, the polypeptide has higher primase activity and / or polymerase activity than TthPrimPol, particularly at a pH of about 7.5. In another specific embodiment, the polypeptide has higher primase activity and / or polymerase activity than TthPrimPol, particularly at a temperature of about 50°C. In even more specific embodiments, the polypeptide has higher primase activity and / or polymerase activity than TthPrimPol, particularly at a pH of about 7.5 and a temperature of about 50°C.

[0041] Primase activity and polymerase activity can be measured by conventional methods well known to those skilled in the art, for example, by the methods disclosed in the following examples. In a specific embodiment, primase activity or polymerase activity is measured by a method selected from the group consisting of absorbance at a wavelength of 260 nm, in situ hybridization, reverse transcriptase polymerase chain reaction, nucleic acid hybridization, electrophoresis, Southern blotting, and mass spectrometry. In a more specific embodiment, primase activity or polymerase activity is measured by absorbance at a wavelength of 260 nm.

[0042] In a more specific embodiment, primase activity is measured by contacting a nucleic acid template with the polypeptide of the present invention and a strand-displacing DNA polymerase, particularly Phi29 polymerase, under conditions suitable for amplifying the nucleic acid template, and measuring the amplified product by measuring the absorbance at a wavelength of 260 nm.The higher the primase activity of the polypeptide, the greater the amount of amplified product produced by the DNA polymerase.Conditions suitable for amplifying a nucleic acid template using a polypeptide and a strand-displacing DNA polymerase are well known to those skilled in the art.These conditions may be, for example, the conditions disclosed in Example 1 below.

[0043] In another specific embodiment, polymerase activity is measured by contacting a polypeptide with a nucleic acid template under conditions suitable for amplifying the nucleic acid template, and measuring the amplification product by absorbance at a wavelength of 260 nm. Suitable conditions for amplifying a nucleic acid template using a polypeptide are well known to those skilled in the art. These conditions may be, for example, the conditions disclosed in the following examples.

[0044] The term "fidelity" refers to the accuracy of template-directed incorporation of a complementary base in a synthesized nucleic acid strand relative to a template strand. Fidelity can be measured based on the frequency of erroneous base incorporation in a newly synthesized nucleic acid strand. The incorporation of an erroneous base can result in a point mutation, insertion, or deletion. Methods for determining fidelity are well known in the art. Increased fidelity can be determined by assaying natural and synthetic PrimPol and comparing their activities using any assay that measures the accuracy of template-directed incorporation of a complementary base, such as next-generation sequencing. Such methods are known to those skilled in the art. Thus, in certain embodiments of the first aspect, fidelity is measured by next-generation sequencing (i.e., analyzing the sequence of a nucleic acid amplified by next-generation sequencing and determining the frequency of erroneous base incorporation).

[0045] In certain embodiments of the first aspect, optionally in combination with any of the embodiments provided above or below, the expression rate is measured by a method selected from the group consisting of absorbance at a wavelength of 280 nm, immunoassay, Western blot, ELISA, and mass spectrometry. More particularly, the expression rate is measured by absorbance at a wavelength of 280 nm.

[0046] In certain embodiments of the first aspect, optionally in combination with any of the embodiments provided above or below, the variant substantially maintains or improves primase and polymerase activity. As used herein, "substantially maintains or improves primase and polymerase activity" means that the variant has at least 90%, more particularly at least 95%, or even more particularly at least 99% of the primase and polymerase activity of the reference polypeptide, as measured by any suitable method known in the art, particularly the methods disclosed above. In another specific embodiment, the variant substantially maintains or improves primase or polymerase activity.

[0047] In certain embodiments of the first aspect, optionally in combination with any of the embodiments provided above or below, the sequence of the polypeptide, when aligned against the sequence of TthPrimPol, has an RMS value of at least 2, at least 3, at least 4, or at least 5, optionally wherein the RMS value is calculated using AlphaFold2, particularly as described in Example 9.

[0048] In certain embodiments of the first aspect, optionally in combination with any of the embodiments provided above or below, the polypeptide is a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, or a sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, at least 101%, at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least 107%, at least 108%, at least 109%, at least 1109%, at least 1111%, at least 112%, at least 113%, at least 114%, at least 115%, at least 116%, at least 117%, at least 118%, at least 119%, at least 120%, at least 121%, at least 122%, at least 123%, at least 124%, at least 125%, at least 126%, at least 127%, at least 128%, at least 129%, at least 130%, at least 131%, at least 132%, at least 133%, at least 134%, at least 135%, at least 136%, at least 137%, at least 138%, at least 139%, at least 140%, at least 141%, at least 142%, at least 14 and in particular, which variants substantially maintain or improve primase and polymerase activity.

[0049] In particular embodiments of the first aspect, optionally in combination with any of the embodiments provided above or below, the polypeptide comprises a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, or a variant thereof that is at least 80% identical to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, and in particular the variant has a length of at least 200 amino acids, at least 250 amino acids, at least 280 amino acids, at least 298 amino acids, or about 298 amino acids.

[0050] In certain embodiments of the first aspect, optionally in combination with any of the embodiments provided above or below, the polypeptide is SEQ ID NO:1, or a polypeptide that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least This includes variants thereof that are 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, or at least 99.9% identical, and in particular, the variants substantially maintain or improve primase and / or polymerase activity.

[0051] In certain embodiments of the first aspect, optionally in combination with any of the embodiments provided above or below, the polypeptide is SEQ ID NO:2, or a polypeptide that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least This includes variants thereof that are 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, or at least 99.9% identical, and in particular, the variants substantially maintain or improve primase and / or polymerase activity.

[0052] In certain embodiments of the first aspect, optionally in combination with any of the embodiments provided above or below, the polypeptide is SEQ ID NO:3, or a polypeptide that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least This includes variants thereof that are 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, or at least 99.9% identical, and in particular, the variants substantially maintain or improve primase and / or polymerase activity.

[0053] In certain embodiments of the first aspect, optionally in combination with any of the embodiments provided above or below, the sequence of the polypeptide is not 100% identical to the sequence of any extant polypeptide. In even more particular embodiments, the sequence of the polypeptide is a synthetic sequence (i.e., a sequence that does not occur in nature). As used herein, the term "existing" refers to a taxon (such as a species, genus, or family) that still exists (is alive). The term extant is contrasted with extinct. As used herein, the term "existing polypeptide" refers to a polypeptide derived from an extant taxon.

[0054] In a particular embodiment of the first aspect, optionally in combination with any of the embodiments provided above or below, the polypeptide consists of a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, or a variant thereof that is at least 80% identical, particularly at least 90% identical to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. This embodiment is therefore meant to encompass a polypeptide consisting of SEQ ID NO: 1 or a variant thereof that is at least 80% identical, particularly at least 90% identical to SEQ ID NO: 1, a polypeptide consisting of SEQ ID NO: 2 or a variant thereof that is at least 80% identical, particularly at least 90% identical to SEQ ID NO: 2, and a polypeptide consisting of SEQ ID NO: 3 or a variant thereof that is at least 80% identical, particularly at least 90% identical to SEQ ID NO: 3.

[0055] In certain embodiments of the first aspect, optionally in combination with any of the embodiments provided above or below, the polypeptide consists of SEQ ID NO:1 or a variant thereof consisting of a sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, or at least 99.9% identical to SEQ ID NO:1.

[0056] In certain embodiments of the first aspect, optionally in combination with any of the embodiments provided above or below, the polypeptide consists of SEQ ID NO:2 or a variant thereof consisting of a sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, or at least 99.9% identical to SEQ ID NO:2.

[0057] In certain embodiments of the first aspect, optionally in combination with any of the embodiments provided above or below, the polypeptide consists of SEQ ID NO:3 or a variant thereof consisting of a sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, or at least 99.9% identical to SEQ ID NO:3.

[0058] In one embodiment, the polypeptide comprises a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, or a variant thereof comprising a sequence having at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, or at least 150 identical contiguous amino acid residues of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3.

[0059] In some embodiments, the polypeptide comprises a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, or a variant thereof comprising up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 21, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acid changes compared to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3.

[0060] In certain embodiments of the first aspect, optionally in combination with any of the embodiments provided above or below, the polypeptide is chemically modified. In more specific embodiments, the chemical modification comprises a covalent modification of amino acids. In another embodiment, the covalent modification is selected from the group consisting of methylation, acetylation, phosphorylation, ubiquitination, sumoylation, citrullination, ADP-ribosylation, and combinations thereof. Methods for chemically modifying polypeptides using conventional methods are within the common knowledge of those skilled in the art.

[0061] In certain embodiments of the first aspect, optionally in combination with any of the embodiments provided above or below, the polypeptide further comprises a tag, in particular a tag located at the N-terminus and / or C-terminus suitable for detection and / or purification.

[0062] As used herein, the term "tag" refers to any amino acid sequence for which a specific binding molecule is available, thus allowing for the detection / purification of any polypeptide bearing the tag. Tags are generally placed at the amino or carboxyl terminus of a polypeptide. The presence of such a tag allows for the detection of an adapter molecule using an antibody against the tag polypeptide. Providing a tag also allows for the adapter polypeptide to be easily purified by affinity purification using an anti-tag antibody or another type of affinity reagent that binds to the epitope tag. It will be appreciated that one of skill in the art will readily identify tags suitable for detection or purification using tags available in the art.

[0063] Those skilled in the art know how to produce the polypeptides of the present invention without using the techniques of the present invention by conventional methods well known in the art, such as chemical synthesis or recombinant expression techniques.

[0064] In a second aspect, the present invention provides an antibody that specifically binds to a polypeptide comprising or consisting of a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3. Examples of antibodies include, but are not limited to, monoclonal antibodies, polyclonal antibodies, antibody fragments, antibody derivatives, Fab fragments, Fab' fragments, F(ab)2 fragments, Fd fragments, Fv fragments, single-chain Fv fragments (scFv), diabodies, tribodies, tetrabodies, dimers, trimers, and minibodies. In certain embodiments of the second aspect, the antibody is a monoclonal antibody. The antibody can be produced by any method known in the art for producing antibodies, particularly by chemical synthesis or recombinant expression techniques. Monoclonal antibodies can be prepared using a wide range of techniques known in the art, including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof. For example, monoclonal antibodies can be produced using hybridoma techniques known in the art, including those taught in, for example, WO2009100309.

[0065] As noted above, in a third aspect, the present invention provides a nucleic acid encoding a polypeptide as defined in the first aspect. In particular embodiments of the third aspect, the nucleic acid is DNA or RNA.

[0066] As described above, in the fourth and fifth aspects, the present invention provides gene constructs and expression vectors. Examples of suitable expression promoters and expression vectors include those conventionally used in molecular biology and known to those skilled in the art. In the sixth aspect, the present invention also provides host cells. Examples of suitable host cells and culture conditions include those conventionally used in cell biology and known to those skilled in the art.

[0067] As disclosed above, in a seventh aspect, the present invention also provides a process for producing the polypeptide of the present invention. Of course, the specific conditions for cell culture, polypeptide recovery and purification, as well as other such assay conditions, may vary depending on various factors, including the host cell type. Those skilled in the art will be able to determine the operational and optimal assay conditions for producing the polypeptide by using routine experimentation.

[0068] In a ninth aspect, the present invention also provides a method for amplifying nucleic acid, comprising contacting nucleic acid with the polypeptide of the present invention and optionally with a DNA polymerase, particularly a strand-displacing polymerase, under conditions suitable for amplifying nucleic acid.It should be understood that those skilled in the art can easily identify the conditions suitable for amplifying nucleic acid by using any of the well-established techniques known in the art.This information is generally available and forms part of the general knowledge of those skilled in the art.

[0069] In particular, the polypeptides of the present invention can be used only to prime amplification or for the entire amplification process (i.e., priming and chain extension). When used for priming only, the polypeptides are used in combination with a DNA polymerase, such as Phi29 polymerase. As used herein, the term "priming" refers to the generation of an oligonucleotide primer on a nucleic acid template by the polypeptides of the present invention.

[0070] As used herein, the term "nucleic acid" refers to a deoxyribonucleotide or ribonucleotide polymer in either single-stranded or double-stranded form, and includes, unless otherwise limited, natural nucleotides and analogs of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally occurring nucleotides. The term "nucleotide" includes, but is not limited to, a monomer containing a base (pyrimidine, purine, or a synthetic analog thereof) linked to a sugar (ribose, deoxyribose, or a synthetic analog thereof), or a base linked to an amino acid, as in peptide nucleic acid (PNA). A nucleotide is one monomer in an oligonucleotide or polynucleotide. A "nucleotide sequence" or "nucleic acid sequence" refers to the sequence of bases in an oligonucleotide or polynucleotide.

[0071] In certain embodiments of the ninth aspect, optionally in combination with any of the embodiments provided above or below, the amplification process comprises contacting the nucleic acid with a polypeptide of the invention and Phi29 DNA polymerase under conditions suitable for amplifying the nucleic acid.

[0072] The term "strand-displacing DNA polymerase" refers to a DNA polymerase that performs a 3'-end extension reaction while removing the double-stranded portion of the template DNA. Strand-displacing DNA polymerases that can be used in the present invention are not particularly limited, as long as they have strand-displacing activity, such as Phi29 DNA polymerase, and are compatible with the polypeptides of the present invention. Depending on the type of polymerase selected, those skilled in the art will know that the reaction conditions for the 3'-end extension reaction can be appropriately set. As used herein, "Phi29 polymerase" or "Phi29 DNA polymerase" refers to a highly processive strand-displacing DNA polymerase derived from bacteriophage Phi29 (i.e., φ29). Phi29 polymerase is commercially available (e.g., EP0091 from Thermo Fisher Scientific) and is readily available to those skilled in the art. The term "Phi29 polymerase" is also meant to encompass improved variants of Phi29 polymerase, such as the chimeric Phi29 polymerase disclosed in WO2011000997.

[0073] As used herein, the term " amplification " refers to one of many methods that can copy or multiply nucleic acid, particularly DNA molecules.Non-limiting examples of amplification methods include PCR (polymerase chain reaction), LAMP (loop-mediated isothermal amplification), RDC (chimeric displacement reaction), NASBA (nucleic acid sequence-based amplification), or isothermal amplification, such as rolling circle amplification (RCA) or whole genome amplification (WGA).

[0074] Thus, in particular embodiments of the ninth aspect, optionally in combination with any of the embodiments provided above or below, the amplification is selected from PCR (polymerase chain reaction), LAMP (loop-mediated isothermal amplification), RDC (chimeric displacement reaction), NASBA (nucleic acid sequence-based amplification), rolling circle amplification (RCA), whole genome amplification (WGA), multiple displacement amplification (MDA), strand displacement amplification (SDA), and combinations thereof. In more particular embodiments, the amplification is a combination of rolling circle amplification (RCA) and multiple displacement amplification (MDA).

[0075] In certain embodiments of the ninth aspect, optionally in combination with any of the embodiments provided above or below, the nucleic acid is DNA, RNA, or a mixture thereof.

[0076] In particular embodiments of the ninth aspect, optionally in combination with any of the embodiments provided above or below, the process comprises contacting the polypeptide of the invention and the DNA polymerase with the nucleic acid simultaneously or sequentially (i.e., first the polypeptide of the invention, then the strand-displacing DNA polymerase).

[0077] In certain embodiments of the ninth aspect, optionally in combination with any of the embodiments provided above or below, the process further comprises contacting the nucleic acid with a buffer, magnesium chloride, and nucleoside triphosphates. In more particular embodiments, the nucleoside triphosphates are dCTP, dGTP, dTTP, and dATP.

[0078] In particular embodiments of the ninth aspect, optionally in combination with any of the embodiments provided above or below, the amplification is carried out at a constant temperature of 25°C to 60°C, particularly 30°C to 50°C, more particularly about 50°C.

[0079] In certain embodiments of the ninth aspect, optionally in combination with any of the embodiments provided above or below, the process further comprises at least one of detecting the amplified nucleic acid, quantifying the amplified nucleic acid, sequencing the amplified nucleic acid, and processing the amplified nucleic acid; in particular, the processing comprises digesting the amplified nucleic acid with at least one restriction enzyme. In more specific embodiments, the process further comprises digesting the amplified nucleic acid with at least one restriction enzyme. In more specific embodiments, the process further comprises digesting the amplified nucleic acid with at least one restriction enzyme and attaching single-stranded hairpin adapters to both ends of the digested nucleic acid, thereby forming a closed linear DNA. In more specific embodiments, the process further comprises contacting the amplified nucleic acid with protelomerase, thereby forming a closed linear DNA. In more specific embodiments, the process further comprises sequencing the amplified nucleic acid and detecting one or more genetic variants in the sequenced amplified nucleic acid. Methods for detecting, quantifying, sequencing, or processing nucleic acids are known to those skilled in the art and form part of general knowledge.

[0080] In certain embodiments of the ninth aspect, optionally in combination with any of the embodiments provided above or below, the sequencing comprises fragmenting the amplified nucleic acid and attaching a sequencing platform-specific adapter to the fragmented nucleic acid. Those skilled in the art can routinely optimize the fragmentation conditions and will know which adapters to use depending on the sequencing platform used.

[0081] In certain embodiments of the ninth aspect, optionally in combination with any of the embodiments provided above or below, sequencing is performed on selected sequences, exomes, transcriptomes or whole genomes.

[0082] As explained above, in a twelfth aspect, the present invention also provides a process for producing closed linear DNA using the polypeptide of the present invention.

[0083] As used herein, the terms "closed linear DNA" or "clDNA" or "linear closed DNA" or "lcDNA" refer to single-stranded covalently closed DNA molecules that form a "dumbbell" or "doggie-bone" shaped structure under conditions that allow nucleotide hybridization. Thus, clDNA is formed by closed single-stranded DNA molecules, whereas the formation of a "dumbbell" structure by hybridization of two complementary sequences within the same molecule generates a structure consisting of a double-stranded central segment flanked by two single-stranded loops. Those skilled in the art are aware of methods for generating clDNA from open or closed double-stranded DNA, such as the amplified DNA generated in step (b), using conventional molecular biology techniques. For example, those skilled in the art are aware that clDNA can be generated by attaching single-stranded hairpin adapters to both ends of open double-stranded DNA, e.g., by the action of a ligase. Another method known to those skilled in the art for generating closed linear DNA is by the action of protelomerase on double-stranded DNA containing at least two protelomerase target sequences.

[0084] In certain embodiments of the twelfth aspect, optionally in combination with any of the embodiments provided above or below, the nucleic acid is closed linear DNA.

[0085] In certain embodiments of the twelfth aspect, optionally in combination with any of the embodiments provided above or below, the amplification performed in step (b) is rolling circle amplification (RCA).

[0086] The term "rolling circle amplification" or "RCA" refers to a nucleic acid amplification reaction involving the amplification of covalently closed DNA molecules, such as clDNA or double-stranded circular DNA, in which a polymerase extends a primer around the closed DNA molecule. The polymerase displaces hybridized copies and continues polynucleotide extension around the template, producing concatemeric DNA containing tandem units of amplified DNA.

[0087] In particular embodiments of the twelfth aspect, optionally in combination with any of the embodiments provided above or below, the amplification in step (b) is carried out using a strand-displacing DNA polymerase, in particular Phi29 polymerase.

[0088] In certain embodiments of the twelfth aspect, optionally in combination with any of the embodiments provided above or below, the DNA template is selected from a closed linear DNA template or a circular double-stranded DNA template.

[0089] In certain embodiments of the twelfth aspect, optionally in combination with any of the embodiments provided above or below, the amplified DNA resulting from step (b) is concatemeric DNA comprising repeats of the DNA sequence of interest, wherein each repeat is flanked by restriction sites and / or protelomerase target sequences.

[0090] In certain embodiments of the twelfth aspect, optionally in combination with any of the embodiments provided above or below, the concatemeric DNA comprises repeats of the DNA sequence of interest flanked by at least restriction sites, and then step (c) is carried out by (c.1) contacting the concatemeric DNA with at least one restriction enzyme, thereby generating a plurality of open double-stranded DNA fragments, each containing the DNA sequence of interest, and (c.2) ligating single-stranded DNA adapters to both ends of the open double-stranded DNA fragments.

[0091] In certain embodiments of the twelfth aspect, optionally in combination with any of the embodiments provided above or below, when the concatemeric DNA comprises repeats of the DNA sequence of interest flanking at least the protelomerase target sequence, then step (c) is carried out by contacting the concatemeric DNA with a protelomerase, in particular TelN.

[0092] As used herein, a "protelomerase" refers to any polypeptide capable of cleaving and religating a template containing a protelomerase target site to generate a covalently closed linear DNA molecule. Thus, protelomerases have DNA cleavage and ligation functions. Enzymes with protelomerase-type activity have also been described as telomere resol bases (e.g., Borrelia burgdorferi). A typical substrate for protelomerase is circular double-stranded DNA. If this DNA contains a protelomerase target site, the enzyme can cleave the DNA at this site and ligate the ends to generate a linear, double-stranded, covalently closed DNA molecule. The ability of a given polypeptide to catalyze the generation of closed linear DNA from a template containing a protelomerase target site can be determined using any suitable assay described in the art.

[0093] Examples of protelomerases suitable for use in the process of the present invention include those derived from bacteriophages such as phiHAP-1 from Halomonas aquamarina, PY54 from Yersinia enterolytica, phiKO2 from Klebsiella oxytoca, and VP882 from Vibrio sp., and N15 (TelN protelomerase) from Escherichia coli, or variants of any of these. Protelomerases, particularly TelN, can be commercially available or produced by conventional methods.

[0094] In a further aspect, the present invention provides a polypeptide comprising SEQ ID NO: 4 or a variant thereof which is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, or at least 99.9% identical to SEQ ID NO: 4. All embodiments and aspects above provided in relation to the polypeptide of the first aspect are meant to apply to the polypeptide of this further aspect as well.

[0095] In one embodiment, the polypeptide comprises SEQ ID NO:4 or a variant thereof comprising an amino acid sequence having at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, or at least 150 identical contiguous amino acid residues of SEQ ID NO:4. In some embodiments, the polypeptide comprises SEQ ID NO:4 or a variant thereof comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 21, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 or more amino acid changes compared to SEQ ID NO:4.

[0096] In particular, the present invention also provides antibodies that specifically bind to a polypeptide comprising or consisting of SEQ ID NO: 4, a nucleic acid sequence encoding a polypeptide comprising SEQ ID NO: 4 or a variant thereof that is at least 80% identical, in particular at least 90% identical to SEQ ID NO: 4, in particular a nucleic acid sequence that is optimized for expression in a mammalian expression system or alternatively a bacterial expression system, a genetic construct comprising the nucleic acid sequence operably linked to an expression promoter, an expression vector comprising the genetic construct, a host cell comprising the nucleic acid sequence, the genetic construct or the expression vector, a process for producing the polypeptide, the process comprising a) culturing the host cell under conditions suitable for producing the polypeptide, b) recovering the polypeptide, and optionally c) purifying the polypeptide, and the polypeptide produced by the process.

[0097] The present invention also relates to a process for amplifying a nucleic acid, the process comprising contacting a nucleic acid with a polypeptide comprising SEQ ID NO: 4 or a variant thereof that is at least 80% identical, particularly at least 90% identical to SEQ ID NO: 4, and optionally with a DNA polymerase, particularly a strand-displacing DNA polymerase, under conditions suitable for amplifying the nucleic acid; use of the polypeptide to amplify, detect or sequence the nucleic acid; use of the polypeptide in combination with a strand-displacing DNA polymerase to amplify, detect or sequence the nucleic acid; and a) amplifying a DNA sequence of interest. a) providing a DNA template comprising the polypeptide; b) amplifying DNA from the DNA template of step (a), wherein amplification is primed with the polypeptide; c) generating a closed linear DNA from the amplified DNA generated in step (b); and d) optionally purifying the generated closed linear DNA; use of the polypeptide for generating a closed linear DNA; and a kit comprising (a) the polypeptide, (b) a strand-displacing DNA polymerase, particularly Phi29 polymerase, and (c) optionally instructions for use thereof.

[0098] In particular embodiments of this further aspect, optionally in combination with any of the embodiments provided above or below, the polypeptide consists of SEQ ID NO:4, or a variant thereof that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, or at least 99.9% identical to SEQ ID NO:4.

[0099] In certain embodiments of this further aspect, optionally in combination with any of the embodiments provided above or below, the variant substantially maintains or improves primase and polymerase activity.

[0100] In particular embodiments of this further aspect, optionally in combination with any of the embodiments provided above or below, the polypeptide has primase activity and polymerase activity, and optionally, the sequence of the polypeptide is not 100% identical to the sequence of any existing polypeptide.

[0101] Throughout the specification and claims, the word "comprise" and variations of this word are not intended to exclude other technical features, additives, ingredients, or steps. Furthermore, the word "comprise" encompasses the term "consisting of." Additional objects, advantages, and features of the present invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the present invention. The following examples and drawings are provided by way of illustration and are not intended to limit the invention. Reference signs placed within parentheses in connection with the drawings and in the claims are intended only to enhance the understanding of the claims and should not be construed as limiting the scope of the claims. Furthermore, the present invention covers all possible combinations of the specific preferred embodiments described herein.

[0102] The present invention includes the following embodiments.

[0103] 1. A polypeptide comprising a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, or a variant thereof that is at least 80% identical, particularly at least 90% identical to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3.

[0104] 2. A polypeptide comprising a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4, or a variant thereof that is at least 80% identical, particularly at least 90% identical, to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.

[0105] 3. A polypeptide according to any one of embodiments 1 to 2, which has primase activity and polymerase activity.

[0106] 4. A polypeptide according to any one of embodiments 1 to 3, having at least one improved property compared to TthPrimPol.

[0107] 5. The polypeptide of embodiment 4, wherein the at least one improved property compared to TthPrimPol is selected from higher pH stability, higher thermostability, higher primase activity, higher polymerase activity, higher fidelity, and higher expression rate.

[0108] 6. Higher primase activity than TthPrimPol at pH 7.5-8.5, especially at a pH of about 7.5;

[0109] Higher polymerase activity than TthPrimPol at a pH of 7.5-8.5, especially about 7.5;

[0110] a primase activity greater than that of TthPrimPol at a temperature of about 50°C, or

[0111] 6. The polypeptide of any one of embodiments 1 to 5, comprising at least one of the following: a polymerase activity greater than that of TthPrimPol at a temperature of about 50°C.

[0112] 7. The polypeptide according to any one of embodiments 5 to 6, wherein the primase activity or polymerase activity is measured by absorbance at a wavelength of 260 nm.

[0113] 8. The polypeptide of any of embodiments 5-6, wherein the primase activity is measured by contacting the polypeptide and a strand-displacing DNA polymerase, in particular Phi29 polymerase, with a nucleic acid template under conditions suitable for amplifying the nucleic acid template, and measuring the amplification product by absorbance at a wavelength of 260 nm.

[0114] 9. The polypeptide of any of embodiments 5-6, wherein the polymerase activity is measured by contacting the polypeptide with a nucleic acid template under conditions suitable for amplifying the nucleic acid template and measuring the amplification product by absorbance at a wavelength of 260 nm.

[0115] 10. The polypeptide of any one of embodiments 5 to 9, wherein the fidelity is measured by next generation sequencing.

[0116] 11. The polypeptide according to any one of embodiments 5 to 10, wherein the expression rate is measured by absorbance at a wavelength of 280 nm.

[0117] 12. The polypeptide of any of embodiments 1 to 11, wherein the variant substantially maintains or improves primase and polymerase activity.

[0118] 13. A polypeptide according to any of Examples 1 to 12, wherein the sequence of the polypeptide, when aligned against the sequence of TthPrimPol, has an RMS value of at least 2, at least 3, at least 4, or at least 5, optionally wherein the RMS value is calculated using AlphaFold2, particularly as described in Example 9.

[0119] 14. The polypeptide of any of embodiments 1-13, wherein the sequence of the polypeptide is not 100% identical to the sequence of any existing polypeptide.

[0120] 15. The polypeptide according to any of embodiments 1 to 14, consisting of a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, or a variant thereof that is at least 80% identical, in particular at least 90% identical to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

[0121] 16. The polypeptide of any of embodiments 1-15, wherein the variant is at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 88.5%, at least 89%, at least 89.5%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, or at least 99.9% identical to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3.

[0122] 17. The polypeptide of any one of embodiments 1 to 16, wherein the polypeptide is chemically modified, in particular by a covalent modification of an amino acid selected from the group consisting of methylation, acetylation, phosphorylation, ubiquitination, sumoylation, citrullination, ADP-ribosylation, and combinations thereof.

[0123] 18. The polypeptide according to any of embodiments 1 to 17, further comprising a tag, in particular a tag located at the N-terminus or C-terminus suitable for detection and / or purification.

[0124] 19. An antibody that specifically binds to a polypeptide comprising or consisting of a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.

[0125] 20. A nucleic acid sequence encoding a polypeptide as defined in any of embodiments 1 to 18, which is optimized for expression in a mammalian expression system, or alternatively for expression in a bacterial expression system.

[0126] 21. A genetic construct comprising the nucleic acid sequence defined in embodiment 20 operably linked to an expression promoter.

[0127] 22. An expression vector comprising the genetic construct defined in embodiment 21.

[0128] 23. A host cell comprising a nucleic acid sequence as defined in embodiment 20, a gene construct as defined in embodiment 21, or an expression vector as defined in embodiment 22.

[0129] 24. A process for producing a polypeptide as defined in any one of embodiments 1 to 18, the process comprising: a) culturing a host cell as defined in embodiment 23 under conditions suitable for the production of the polypeptide; b) recovering the polypeptide, and c) optionally, purifying the polypeptide.

[0130] 25. A polypeptide obtainable by the process defined in embodiment 24.

[0131] 26. A process for amplifying a nucleic acid, comprising contacting the nucleic acid with a polypeptide as defined in any of embodiments 1 to 18, and optionally with a DNA polymerase, in particular a strand-displacing DNA polymerase, under conditions suitable for amplifying the nucleic acid.

[0132] 27. A process for amplifying, detecting or sequencing a nucleic acid, comprising contacting the nucleic acid with a polypeptide as defined in any of embodiments 1 to 18, and optionally with a DNA polymerase, in particular a strand-displacing DNA polymerase, under conditions suitable for amplifying the nucleic acid.

[0133] 28. The process according to any of embodiments 26-27, wherein the nucleic acid is DNA, RNA, or a mixture thereof.

[0134] 29. The process according to any of embodiments 26 to 28, wherein the nucleic acid is a closed linear DNA.

[0135] 30. The process according to any of embodiments 26 to 29, wherein the polypeptide as defined in any of embodiments 1 to 18 and the DNA polymerase are contacted with the nucleic acid simultaneously or sequentially.

[0136] 31. The process according to any of embodiments 26 to 30, wherein the amplification is selected from PCR (polymerase chain reaction), LAMP (loop-mediated isothermal amplification), RDC (chimeric displacement reaction), NASBA (nucleic acid sequence-based amplification), rolling circle amplification (RCA), whole genome amplification (WGA), multiple displacement amplification (MDA), strand displacement amplification (SDA), and combinations thereof, in particular a combination of rolling circle amplification (RCA) and multiple displacement amplification (MDA).

[0137] 32. Detecting the amplified nucleic acid; Quantifying the amplified nucleic acid; sequencing the amplified nucleic acid; and further comprising at least one step of treating the amplified nucleic acid; In particular, the process according to any of embodiments 26 to 31, wherein this treatment step comprises digesting the amplified nucleic acid with at least one restriction enzyme.

[0138] 33. The process of embodiment 32, wherein sequencing comprises fragmenting the amplified nucleic acids and attaching sequencing platform-specific adapters to the fragmented nucleic acids.

[0139] 34. Use of a polypeptide as defined in any of embodiments 1 to 18 for amplifying, detecting or sequencing a nucleic acid, in particular where the nucleic acid is closed linear DNA.

[0140] 35. Use of a polypeptide as defined in any of embodiments 1 to 18 in combination with a DNA polymerase, in particular a strand-displacing DNA polymerase, for amplifying, detecting or sequencing a nucleic acid.

[0141] 36. The use according to claim 35, wherein the strand-displacing DNA polymerase is Phi29 DNA polymerase.

[0142] 37. a) providing a DNA template containing a DNA sequence of interest; b) amplifying DNA from the DNA template of step (a), wherein the amplification is primed with a polypeptide as defined in any of embodiments 1 to 18; c) generating closed linear DNA using the amplified DNA generated in step (b); and d) optionally purifying the produced closed linear DNA.

[0143] 38. The process of embodiment 37, wherein the amplification carried out in step (b) is rolling circle amplification.

[0144] 39. The process according to any of embodiments 37-38, wherein the amplification in step (b) is carried out using a strand-displacing DNA polymerase, in particular phi29 polymerase.

[0145] 40. The process of any of embodiments 37-39, wherein the DNA template is selected from a closed linear DNA template or a circular double-stranded DNA template.

[0146] 41. The process of any of embodiments 37-40, wherein the amplified DNA resulting from step (b) is concatemeric DNA containing repeats of the DNA sequence of interest, wherein each repeat is flanked by restriction sites and / or protelomerase target sequences.

[0147] 42. The process of embodiment 41, wherein if the concatemeric DNA contains repeats of the DNA sequence of interest flanked by at least restriction sites, then step (c) is carried out by: (c.1) contacting the concatemeric DNA with at least one restriction enzyme, thereby generating a plurality of open double-stranded DNA fragments, each containing the DNA sequence of interest, and (c.2) ligating single-stranded DNA adapters to both ends of the open double-stranded DNA fragments.

[0148] 43. The process of embodiment 41, wherein if the concatemeric DNA contains repeats of the DNA sequence of interest flanking at least the protelomerase target sequence, then step (c) is carried out by contacting the concatemeric DNA with a protelomerase, in particular TelN.

[0149] 44. Use of a polypeptide as defined in any of embodiments 1 to 18 for generating closed linear DNA.

[0150] 45. (a) a polypeptide as defined in any one of embodiments 1 to 18; (b) a DNA polymerase, in particular a strand-displacing DNA polymerase, and (c) optionally, instructions for its use.

[0151] 46. The kit of embodiment 45, further comprising one or more deoxyribonucleoside triphosphates.

[0152] 47. The use according to any one of claims 45 to 46, wherein the strand-displacing DNA polymerase is Phi29 DNA polymerase. [Example]

[0153] Example 1: Materials and Methods

[0154] Production and purification of the synthetic PrimPol of the present invention Synthetic PrimPols of SEQ ID NOs: 1, 2, 3, and 4 were codon-optimized for expression in E. coli, synthesized in the pET28 expression vector (Merck), and transformed into E. coli BL21(DE3) (Life Technologies) strain for protein expression according to standard procedures. Briefly, cells were incubated in LB medium (Thermo Fisher Scientific) at 37°C until the OD reached 0.6 (Abs600nm) and induced with 1 mM IPTG. After induction, cells were incubated overnight at 18°C and centrifuged at 4000 rpm for 15 minutes. The pellet was resuspended in extraction buffer (50 mM Tris-HCl, pH 7.5, 5% glycerol, 0.5 mM EDTA, and 1 mM dithiothreitol (DTT)) and 1 M NaCl, 0.25% Tween-20, and 30 mM imidazole. One vial of protease inhibitor cocktail and 100 mg / ml lysozyme were added to the resuspended pellet and incubated at 4°C for 15 minutes. The pellet was then sonicated for three 10-minute cycles at 30% amplitude. Cell debris was separated by ultracentrifugation at 33,000 G for 1 hour. The supernatant was filtered and mixed with a His GraviTrap affinity column (GE Healthcare) prewashed with extraction buffer according to the manufacturer's instructions. Protein was eluted using extraction buffer containing 500 mM imidazole and 1 M NaCl. Appropriate fractions were collected, diluted with extraction buffer lacking NaCl, and loaded onto a HiTrap Heparin HP column (5 ml, GE Healthcare). The column was eluted with a linear gradient of extraction buffer containing 0.1–1 M NaCl. Protein purification was verified by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) on 12% acrylamide according to standard procedures. Protein concentrations were calculated by measuring absorbance at 280 nm in a Nanodrop 2000C according to the manufacturer's instructions.

[0155] Primase activity assay Primase activity assays were performed in 12.5 μL reactions containing 30 mM Tris-HCl, 30 mM KCl, 7.5 mM MgCl, 2 mM DTT, 0.5 mM dNTPs, 400 nM primase-polymerase, and 100 ng of single-stranded DNA template (M13mp18) (New England BioLabs). Reactions were incubated at 30 or 50°C at pH 7 and 8 for the indicated reaction times. Reactions were terminated by incubation at 65°C for 15 minutes. Samples were then loaded onto a 2% agarose gel for electrophoretic analysis and measured using a Nanodrop 2000C according to the manufacturer's instructions.

[0156] Polymerase activity assay For polymerase activity assays, gapped plasmids were elongated. The psJ4 plasmid was obtained by introducing Nb.Bpu10I and Nt.Bpu10I nickase enzyme restriction sites upstream and 64 bp downstream of the transcription start site of the lacZa gene using the pUC19 plasmid (Thermo Fisher Scientific) as a base. The plasmid was assembled by Gibson assembly in the following manner: A 566-bp DNA string containing the lacZa gene with the desired mutation was purchased from GeneArt (Thermo Fisher Scientific). pUC19 was amplified by PCR using primer 1 with the sequence CAGCTCACTCAAAGGCGGTA (SEQ ID NO: 5) and primer 2 with the sequence TCTGCTCTGATGCCGCATAG (SEQ ID NO: 6). Both fragments were assembled by Gibson assembly using the Gibson Assembly HiFi Kit (GeneArt), transformed into the provided competent cells, and plated on LB agar plates containing x-gal, IPTG, and carbenicillin. Colonies containing the correct psJ4 plasmid were confirmed by double-stranded digestion with both Nb.Bpu10I and Nt.Bpu10I restriction enzymes. Gapped plasmids were obtained by digestion with either Nb.Bpu10I or Nt.Bpu10I restriction enzymes and incubation with a 64-bp single-stranded competitor during three heating / cooling cycles: 95°C for 1 minute, 60°C for 10 minutes, and 37°C for 20 minutes. The gapped plasmids were further purified using an Amicon Ultrafilter (Millipore) with a 100 kDa cutoff.

[0157] Gapped plasmid extension assays were performed in reactions containing 30 mM Tris-HCl, 30 mM KCl, 7.5 mM MgCl, 5 mM (NH)SO, 2 mM DTT, 0.5 mM dNTPs, 100 nM primase-polymerase, and 35 ng of gapped plasmid per 12.5 μL reaction volume. Reactions were incubated at 30°C for 30 minutes and loaded onto a 1% agarose gel for electrophoretic analysis.

[0158] Fidelity assay For fidelity assays, we used a modified version of the pUC18 plasmid, designated pSJ4. pSJ4 contains two endonuclease nicking sites (Nb.Bpu10I and Nt.Bpu10I) at positions -6 and +58 of the lacza gene. Gapped plasmids were generated and fidelity assays were performed as described (Guilliam TA et al., "Human PrimPol is a highly error-prone polymerase regulated by single-stranded DNA binding proteins," Nucleic Acids Research, January 2015, Vol. 43(2), pp. 1056-68).

[0159] Closed linear DNA template generation Closed linear DNA (clDNA) was generated by treating plasmid DNA with TelN as described in Heinrich J et al., "Linear closed miniDNA generated by the prokaryotic cleaving-joining enzyme TelN is functional in mammalian cells," Journal of Molecular Medicine, 2002, Vol. 80(10), pp. 648-54. The treated plasmid contained the gene of interest cleaved by the TelN recognition site. The digested lDNA was purified from an agarose gel and used as a template for the RCA reaction.

[0160] Rolling circle amplification reaction Rolling circle amplification (RCA) reactions were performed by denaturing template DNA (1.25 μl) with 1.25 μl of 0.1 M NaOH for 3 minutes. Denaturation was neutralized by adding 1.25 μl of reaction buffer (10× Buffer A: 500 mM TrisHCl, 500 mM KCl, 100 mM MgCl, 10 mM DTT, 1 mg / mL BSA, 5 mM dNTPs; or 10× Buffer B: 300 mM Tris-HCl, 300 mM KCl, 75 mM MgCl, 5 mM (NH)SO, 20 mM DTT, 5 mM dNTPs, buffer adjusted to the specified pH). Primase-polymerase and Phi29 DNA polymerase were added at the indicated concentrations. Reactions were incubated at 30°C for 3 hours unless otherwise indicated.

[0161] Next-generation sequencing of RCA Concatemers derived from RCA synthesized by each primase-polymerase with Phi29 DNA polymerase were analyzed by next-generation sequencing. cDNA containing luciferase gene was used as a template. RCA concatemers were sonicated and fragmented, and the fragments were sequenced by Illumina according to standard procedures. All reads containing the correct sequence were mapped to the reference template. Reads were counted, and the percentage of mapped reads was calculated. DNA amplified by PCR with Phusion High Fidelity Polymerase (New England Biolabs) was used as a control.

[0162] TelN digestion TelN digestion of the RCA product was performed on 100 ng of RCA product as described by Heinrich, supra. Briefly, 1 μl of TelN enzyme (New England Biolabs), 2 μl of ThermoPol reaction buffer (10X), and up to 20 μl of nuclease-free water were added. The mixture was incubated at 30°C for 30 minutes and loaded onto a 1% agarose gel for DNA electrophoresis analysis.

[0163] Example 2: Synthetic PrimPol has higher expression and purification yields

[0164] Synthetic PrimPol1 (SEQ ID NO: 1), PrimPol2 (SEQ ID NO: 4), PrimPol3 (SEQ ID NO: 3), and PrimPol4 (SEQ ID NO: 4), as well as TthPrimPol, were expressed in pET-28a plasmids in E. coli BL21DE3 cells (Thermo Fisher Scientific) according to standard procedures. Induction with IPTG (1 mM) at an OD of 0.6 was performed overnight at 18°C.

[0165] Briefly, pelleted cells frozen at -20°C were thawed and sonicated in 50 mM Tris-HCl, pH 7.5, 5% glycerol, 0.5 mM EDTA, 1 mM DTT, 2 M NaCl, 0.25% Tween-20, and 30 mM imidazole. After centrifugation at 40,000 g, the supernatant was added to HisTrap nickel resin (Ni-NTA) and incubated for 1 h. The resin was washed three times with the above buffer and eluted with the same buffer, except that 1 mL fractions contained 500 mM tetrahydrofuran. Fractions were collected and passed through a HiTrap Heparing HP column according to the manufacturer's instructions. The sample was eluted with a salt-concentrated buffer (50 mM Tris-HCl, pH 7.5, 5% glycerol, 0.5 mM EDTA, 1 mM DTT, 1 M NaCl). The sample contained purified primase-polymerase enzyme.

[0166] Expression tests of synthetic primase-polymerase and TthPrimPol are shown in Figure 1. As shown in this figure, synthetic PrimPols 1 to 4 of the present invention exhibit higher expression rates than TthPrimPol. This was particularly evident for PrimPol 4 (SEQ ID NO: 2), which achieved a production yield up to 50% higher than that of TthPrimPol.

[0167] Example 3: Synthetic PrimPol provides higher priming activity under some conditions Mg as a cofactor 2+Primase-polymerase activity in the presence of Mn is a key feature of PrimPol. For RCA applications, most known primases require Mn 2+ Instead of Mg as a cofactor 2+ The presence of Mg is important for maintaining the high fidelity of the Phi29 DNA polymerase used in subsequent DNA synthesis. 2+ To test whether they retained primase-polymerase activity in the presence of Mg, their priming activity was assayed with M13mp18 ssDNA. As shown in Figure 2, all synthetic PrimPols reacted with M13mp18 ssDNA template, dNTPs, and Mg. 2+ Primers could be generated in the presence of dNTPs, but not in the absence of dNTPs. Reactions were incubated at 30°C or 50°C and pH 7.5 or 8.5 for 6 hours. Assays were performed using M13mp18 ssDNA as substrate and 200 nM of each enzyme. All enzymes showed higher activity at 50°C.

[0168] In the case of pH activity, TthPrimPol showed higher primase activity at pH 8.5 only at 50°C, in contrast to PrimPol1 and PrimPol4, which had higher activity at 50°C and pH 7.5. PrimPol2 and PrimPol3 showed similar priming activity at both pH values. Reactions were incubated under different conditions for 6 hours and stopped at 65°C.

[0169] In summary, these results demonstrate that synthetic PrimPol1 and PrimPol4 have higher primase activity than TthPrimPol at lower pH and higher temperatures. Synthetic PrimPol3 provides similar priming efficiency to TthPrimPol under most conditions.

[0170] Example 4: Synthetic PrimPol provides high sequence fidelity

[0171] To evaluate the polymerase activity of the synthetic primase polymerase, we first tested whether it could complete the polymerization of a gapped plasmid as described above in Example 1. As shown in Figure 3, the synthetic PrimPol was able to extend the 64 bp gapped plasmid, which allowed for complete digestion with EcoRI, confirming the DNA polymerization activity of the synthetic PrimPol of the present invention.

[0172] Additionally, RCA reactions were performed as described in Example 1 above, and the amplified products were then sequenced by NGS. Concatemers generated by all PrimPol polymerases combined with Phi29 polymerase were fragmented by sonication and sequenced to confirm the fidelity of amplification using luciferase gene-bearing template DNA. PCR products of the plasmid substrate were used as a control for sequencing errors. All reads obtained after the experiment were mapped using the substrate reference sequence, and similar percentages of mapped reads were obtained for all enzyme combinations. The sequencing results are shown in Table 2 below.

[0173] [Table 2]

[0174] These results indicate that PrimPol1 (SEQ ID NO: 1) and PrimPol3 (SEQ ID NO: 3) provide even higher amplification fidelity than TthPrimPol.

[0175] Example 5: Synthetic PrimPol has priming activity at 30°C

[0176] The ability of the synthetic PrimPol to synthesize primers that could subsequently be extended by Phi29 DNA polymerase to generate long concatemers in high yield was measured (RCA amplification) as described above in Example 1. Reactions contained 250 ng of PrimPol, 210 ng of Phi29 DNA polymerase, 0.5 mM dNTPs, and 10 mM MgCl in a 12.5 ul reaction. Reactions were carried out at 30°C for 3 hours and inactivated at 65°C for 10 minutes.

[0177] As shown in Figure 4, both PrimPol1 and PrimPol4 exhibited comparable abilities to TthPrimPol to synthesize primers that were subsequently extended by Phi29 DNA pol at low temperatures (i.e., 30°C).

[0178] Example 6: Synthetic PrimPol has improved priming activity at 50°C

[0179] To apply PrimPol to an industrial-scale environment, a desirable feature of these enzymes is their ability to tolerate and produce high DNA yields under the variability of reaction conditions expected in industrial processes. The ability of synthetic PrimPol to synthesize primers at higher temperatures was measured as disclosed above.

[0180] As shown in Figure 5, synthetic PrimPol1 (SEQ ID NO: 1) and PrimPol4 (SEQ ID NO: 2) were able to produce higher amplification yields than TthPrimPol under various conditions, even when compared to the optimal operating conditions of TthPrimPol (i.e., pH 8.5).

[0181] These results clearly demonstrate that the synthetic PrimPol of the present invention provides more efficient priming than TthPrimPol under a variety of conditions, making it highly suitable for use in an industrial setting.

[0182] Example 7: Synthetic PrimPol is faster than known PrimPol

[0183] The priming rates of synthetic PrimPol1 (SEQ ID NO: 1) and PrimPol3 (SEQ ID NO: 3) were compared to that of TthPrimPol.

[0184] PrimPol was incubated under the same conditions to test rolling circle amplification activity in combination with Phi29 polymerase. Double-stranded cDNA containing 0.5 ng / µL of luciferase gene was incubated with 200 nM PrimPol and 20 nM Phi29 DNA polymerase at pH 7.5 and 30°C for 3 and 6 hours. The reaction was stopped at 65°C for 15 minutes. DNA concentration was measured by fluorescence using picoGreen reagent.

[0185] As shown in Figure 6, under these conditions, synthetic PrimPol1 and TthPrimPol generated DNA at similar rates when combined with Phi29. However, PrimPol3 generated higher concentrations of amplified DNA more quickly (3 h) than TthPrimPol. Each experiment was repeated twice.

[0186] Example 8: Generation of clDNA using synthetic PrimPol

[0187] Yield is a critical factor when generating clDNA by RCA amplification. However, high quality of the amplified DNA is an essential requirement of the process. As described in Example 1, we tested the ability of synthetic PrimPol1 and PrimPol4 to generate high-quality clDNA.

[0188] Figure 7 shows that synthetic PrimPol1 (SEQ ID NO: 1) and 4 (SEQ ID NO: 2) were able to prime clDNA to synthesize concatemers that could then be treated with TelN, thereby generating clDNA equivalent to the original template.

[0189] Example 9: Protein structure prediction using Alphafold2

[0190] AlphaFold2 models were calculated using the AlphaFold2 online platform (https: / / colab.research.google.com / github / sokrypton / ColabFold / blob / main / AlphaFold2.ipynb). Five models were estimated using default parameters. The best model was visualized using PyMol (PyMOL Molecular Graphics System, version 2.0, Schrödinger). Four structures were predicted: TthPrimPol, PrimPol1 (SEQ ID NO: 1), PrimPol3 (SEQ ID NO: 3), and PrimPol4 (SEQ ID NO: 2). Three synthases (PrimPol1, 3, and 4) were aligned to TthPrimPol, and root-mean-square (RMS) values were estimated.

[0191] Alignment of TthPrimPol to PrimPol4 (SEQ ID NO: 2) resulted in an RMS value of 5.6. Any value of about 2 indicates significant structural deviation.

[0192] The structure was divided into two subdomains, with the most significant substitutions occurring in the C-terminal subdomain. The N-terminal subdomain contains the catalytic residues and the metal-binding core, making it the catalytic domain. The most significant substitutions were in the C-terminal subdomain, which is responsible for binding and initiating the 5' NTP across the PriCT-1 motif. This binding domain is crucial for the enzyme's primase function.

[0193] Structural alignment of TthPrimPol vs. PrimPol1 (SEQ ID NO: 1) resulted in an RMS value of 7.6. Finally, structural alignment of TthPrimPol vs. PrimPol3 (SEQ ID NO: 3) resulted in an RMS value of 5.8. Overall, these results suggest that synthetic PrimPol1, 3 and 4 maintain catalytic activity throughout a highly similar catalytic subdomain at the N-terminus, but have a significantly substituted binding subdomain at the C-terminus compared with TthPrimPol.

[0194] Prior art documents WO2009100309 WO2011000997 Altschul et al., "Basic local alignment search tool," 1990, Journal of Molecular Biology, vol. 215, pp. 403-410. Guilliam TA et al., "Human PrimPol is a highly error-prone polymerase regulated by single-stranded DNA binding proteins," Nucleic Acids Research, January 2015, Vol. 43(2), pp. 1056-68. Heinrich J et al., "Linear closed mini DNA generated by the prokaryotic cleaving-joining enzyme TelN is functional in mammalian cells," Journal of Molecular Medicine, 2002, vol. 80(10), pp. 648-54.

Claims

1. A polypeptide comprising a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, or a variant thereof that is at least 90% identical to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:

3.

2. The polypeptide of claim 1 , wherein the polypeptide has primase activity and polymerase activity.

3. The polypeptide of any one of claims 1 to 2, wherein the polypeptide has at least one improved property compared to TthPrimPol selected from higher primase activity, higher polymerase activity, higher fidelity, higher pH stability, higher thermostability, and higher expression rate.

4. 4. The polypeptide of any one of claims 1 to 3, comprising a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, or a variant thereof that is at least 90% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO:

3.

5. 5. The polypeptide of any one of claims 1 to 4, wherein the variant is at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, or at least 99.9% identical to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, and / or substantially maintains or improves primase and polymerase activity.

6. The polypeptide of any one of claims 1 to 5, further comprising a tag located at the N-terminus and / or C-terminus of the polypeptide, in particular a tag suitable for detection and / or purification.

7. An antibody that specifically binds to a polypeptide comprising or consisting of a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:

3.

8. 7. A nucleic acid sequence encoding a polypeptide as defined in any one of claims 1 to 6, which is optimized in particular for expression in a mammalian expression system, or alternatively for expression in a bacterial expression system.

9. A method for producing a polypeptide as defined in any one of claims 1 to 6, said method comprising the steps of: a) culturing a host cell containing a nucleic acid sequence as defined in claim 8 under conditions suitable for the production of the polypeptide; b) recovering the polypeptide; and c) optionally purifying the polypeptide; A method comprising:

10. 10. A process for amplifying a nucleic acid, comprising contacting said nucleic acid with a polypeptide as defined in any one of claims 1 to 6, and optionally with a DNA polymerase, in particular a strand-displacing DNA polymerase, under conditions suitable for amplifying said nucleic acid.

11. detecting the amplified nucleic acid; quantitating the amplified nucleic acid; sequencing the amplified nucleic acid; and at least one step selected from the group consisting of: treating the amplified nucleic acid; 11. The method of claim 10, further comprising:

12. Use of a polypeptide as defined in any one of claims 1 to 6 for amplifying, detecting or sequencing a nucleic acid.

13. The process according to any one of claims 10 to 11 or the use according to claim 12, wherein the nucleic acid is a closed linear DNA.

14. a) providing a DNA template containing a DNA sequence of interest; b) amplifying DNA from the DNA template of step (a), said amplification being primed with a polypeptide as defined in any one of claims 1 to 6; c) generating a closed linear DNA using the amplified DNA generated in step (b); and d) optionally purifying the closed linear DNA produced; 1. A method for producing a closed linear DNA comprising:

15. (a) a polypeptide as defined in any one of claims 1 to 6; (b) a DNA polymerase, in particular a strand-displacing DNA polymerase, and (c) optionally, instructions for its use.

Citation Information

Patent Citations

  • Anti-ifnar1 antibodies with reduced FC ligand affinity

    WO2009100309A2

  • Phage f 29 DNA polymerase chimera

    WO2011000997A1