A method and application of preparing circular RNA in vitro using chimeric PIE system

Abstract

The present invention belongs to the field of genetic engineering and biomedicine, and specifically relates to a method and application of preparing circular RNA in vitro using a chimeric PIE system. Specifically, the nucleic acid molecule used in the chimeric PIE system includes the following structure: a first matching sequence, a first intron structure, a third matching sequence, a third intron structure, a sequence to be cyclized or a restriction site, a fourth intron structure, a fourth matching sequence, a second intron structure, and a second matching sequence. The use of the chimeric PIE system of the present invention not only significantly improves the cyclization efficiency, but also reduces the introduction of exogenous sequences as much as possible in the final circular RNA, and avoids the introduction of complementary paired sequences, thereby reducing immunogenicity as much as possible.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and biomedicine, and specifically relates to a method and application of preparing circular RNA in vitro using a chimeric PIE system. Background Art

[0002] Circular RNA is a type of single-stranded covalently closed RNA molecule formed by the reverse splicing mechanism during the splicing of mRNA in cells. It does not have a 5' cap and a 3' poly (A) tail structure. Compared with linear RNA, the circular structure is immune to nuclease degradation and has the characteristics of high stability. Studies in cells have shown that circular RNA has functions such as miRNA sponge, protein sponge, protein translation and biomarker. With the use of mRNA vaccines in humans, circular RNA has become another technical platform for the development of RNA vaccines due to its unique advantages. In particular, the successful development of a vaccine against the new coronavirus using circular RNA has provided the possibility of promoting the application and transformation of circular RNA in vaccines.

[0003] At present, the methods for preparing circular RNA in vitro include chemical catalysis, enzyme catalysis and ribozyme technology. The chemical catalysis method has low connection efficiency, and the introduction of other chemical substances during the reaction process can easily lead to safety hazards. The enzyme catalysis method mainly uses T4 DNA ligase, T4 RNA ligase 1 and T4 RNA ligase 2 to achieve RNA cyclization with or without splints. However, this method also faces problems such as low efficiency, inability to connect large RNA molecules and serious intermolecular connections. The ribozyme method mainly uses the exon-intron rearrangement (Permuted intron-exon, PIE) method to design and synthesize linear RNA molecules, and uses its autocatalytic mechanism to achieve RNA cyclization. Because of its high cyclization efficiency, simple reaction conditions and purification process, and the ability to achieve the cyclization of large molecular RNA, it has become the current mainstream in vitro preparation of circular RNA.

[0004] In the process of using ribozymes to prepare circular RNA, improving the circularization efficiency and reducing production costs are the key to promoting downstream applications. Optimizing the PIE sequence derived from type I introns and improving the circularization efficiency of circular RNA are hot research topics. At present, some existing optimization methods will introduce a large number of exogenous sequences, and introduce some internal pairing sequences into the final circular RNA to form a secondary structure, which may cause unnecessary immune responses to circular RNA during downstream in vitro and in vivo applications, thereby causing safety risks. There are also some methods that achieve RNA circularization by hiding the splicing site inside the sequence to avoid the introduction of redundant exogenous sequences. However, this method usually takes into account the nucleotide sequence and secondary structure of the circular RNA, and requires personalized design for different sequences, and is not very versatile. Summary of the invention

[0005] The present invention develops a new circular RNA preparation method by designing a chimeric intron sequence, named CPIE (Chimeric PIE). This method not only significantly improves the cyclization efficiency, but also minimizes the introduction of exogenous sequences in the final circular RNA, avoids the introduction of complementary paired sequences, and minimizes immunogenicity.

[0006] In a first aspect, the present invention provides a nucleic acid molecule, comprising: a first matching sequence, a first intron structure, a third matching sequence, a third intron structure, a sequence to be cyclized or a restriction site, a fourth intron structure, a fourth matching sequence, a second intron structure, and a second matching sequence;

[0007] The first matching sequence and at least 75%, 80%, 85%, 90%, 95% of the second matching sequence are reverse complementary sequences;

[0008] The third matching sequence and at least 75%, 80%, 85%, 90%, 95% of the fourth matching sequence are reverse complementary sequences;

[0009] The first intron structure and the second intron structure constitute a complete type I intron;

[0010] The third intron structure and the fourth intron structure constitute a complete type I intron.

[0011] Preferably, the first matching sequence and the second matching sequence are reverse complementary sequences to each other.

[0012] Preferably, the third matching sequence and the fourth matching sequence are reverse complementary sequences to each other.

[0013] Preferably, the nucleic acid molecule may also include more matching sequences and introns, and the matching sequences symmetrical with the position of the sequence to be cyclized as the center have at least 75%, 80%, 85%, 90%, 95%, 100% of their bases that can be paired with each other, thereby bringing the intron structures close to each other, thereby further improving the splicing efficiency; the intron structures symmetrical with the position of the sequence to be cyclized as the center constitute a complete type I intron.

[0014] Preferably, the first intron structure and the second intron structure constitute type I introns on the T4 bacteriophage thymidylate synthase (td) gene or the Anabaena tRNA gene.

[0015] More preferably, the first intron structure is the 3' end of the group I intron, and the second intron structure is the 5' end of the group I intron.

[0016] Preferably, the third intron structure and the fourth intron structure constitute type I introns on the T4 bacteriophage thymidylate synthase (td) gene or the Anabaena tRNA gene.

[0017] More preferably, the third intron structure is the 3' end of the group I intron, and the fourth intron structure is the 5' end of the group I intron.

[0018] Preferably, the type I intron composed of the first intron structure and the second intron structure is the same as or different from the type I intron composed of the third intron structure and the fourth intron structure.

[0019] Preferably, the first intron structure, the second intron structure, the third intron structure and the fourth intron structure contain corresponding splicing sites in addition to the intron sequence.

[0020] More preferably, the first intron structure is the DNA shown in SEQ ID NO.1 or RNA transcribed therefrom; the second intron structure is the DNA shown in SEQ ID NO.2 or RNA transcribed therefrom; the third intron structure is the DNA shown in SEQ ID NO.3 or RNA transcribed therefrom; the fourth intron structure is the DNA shown in SEQ ID NO.4 or RNA transcribed therefrom; or,

[0021] The first intron structure is the DNA shown in SEQ ID NO.3 or the RNA produced by its transcription; the second intron structure is the DNA shown in SEQ ID NO.4 or the RNA produced by its transcription; the third intron structure is the DNA shown in SEQ ID NO.1 or the RNA produced by its transcription; the fourth intron structure is the DNA shown in SEQ ID NO.2 or the RNA produced by its transcription.

[0022] Preferably, the first matching sequence, the second matching sequence, the third matching sequence, and the fourth matching sequence are each independently at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,

[0024] 47, 48, 49, 50 or more nt, length can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45,

[0026] 46, 47, 48, 49, 50nt.

[0027] Preferably, the length of the first matching sequence, the second matching sequence, the third matching sequence or the fourth matching sequence is at least 5 nt (including 5 nt).

[0028] Preferably, the length of the first matching sequence, the second matching sequence, the third matching sequence or the fourth matching sequence is 5-50 nt.

[0029] Specifically, the length of the first matching sequence, the second matching sequence, the third matching sequence or the fourth matching sequence may be 20 nt.

[0030] More specifically, the first matching sequence and the second matching sequence are shown as SEQ ID NO.5-6 or as SEQ ID NO.7-8.

[0031] More specifically, the third matching sequence and the fourth matching sequence are shown as SEQ ID NO.5-6 or as SEQ ID NO.7-8.

[0032] Preferably, the first matching sequence avoids having a higher homology with the third matching sequence or the fourth matching sequence; and the second matching sequence avoids having a higher homology with the third matching sequence or the fourth matching sequence.

[0033] More preferably, the first matching sequence and the second matching sequence are as shown in SEQ ID NO.5-6, and the third matching sequence and the fourth matching sequence are as shown in SEQ ID NO.7-8; or, the first matching sequence and the second matching sequence are as shown in SEQ ID NO.7-8, and the third matching sequence and the fourth matching sequence are as shown in SEQ ID NO.5-6.

[0034] Preferably, the sequence to be cyclized includes at least one of a ribosome entry site (IRES), a target gene (target RNA), a first spacer and a second spacer.

[0035] Preferably, the sequence to be cyclized is a ribosome entry site (IRES) connected to the target gene (target RNA).

[0036] Preferably, the sequence to be cyclized is a first spacer, a ribosome entry site (IRES), a target gene (target RNA), and a second spacer connected in sequence.

[0037] Before the sequence to be cyclized is connected, in order to facilitate the connection of the sequence, an enzyme cutting site (restriction endonuclease recognition sequence) may also be set where the sequence to be cyclized is located. Common restriction endonucleases include BamHI, EcoRI, HindIII, NdeI, XhoI, etc.

[0038] Preferably, the first spacer and the second spacer, each independently, may be polyAC, polyA, spacer, 5'UTR, 3'UTR.

[0039] Preferably, the length of the first spacer or the second spacer is 10-80 nt, preferably 20-30 nt.

[0040] Preferably, the first spacer or the second spacer is the DNA shown in SEQ ID NO. 22-23 or the RNA produced by transcription thereof.

[0041] Preferably, the length of the sequence to be cyclized of the present invention is at least 300nt, 400nt, 500nt, 600nt, 700nt, 800nt, 900nt, 1000nt, 1100nt, 1200nt, 1300nt, 1400nt, 1500nt, 2000nt, 2500nt, 3000nt, 3500nt, 4000nt, 4500nt or 5000nt. In some embodiments, the length of the sequence to be cyclized is no more than 3000nt, 3500nt, 4000nt, 4500nt, 5000nt, 6000nt, 7000nt, 8000nt, 9000nt or 10000nt. In some embodiments, the length of the sequence to be cyclized is about 300nt, 400nt, 500nt, 600nt, 700nt, 800nt, 900nt, 1000nt, 1100nt, 1200nt, 1300nt, 1400nt, 1500nt, 2000nt, 2500nt, 3000nt, 3500nt, 4000nt, 4500nt, 5000nt, 6000nt, 7000nt, 8000nt, 9000nt or 10000nt. It can be linear before the cyclization reaction and circular after the cyclization reaction.

[0042] Preferably, the IRES sequence of the present invention includes an IRES sequence from any source, and the IRES sequence may include but is not limited to Taura syndrome virus, blood-sucking assassin bug virus, Theile's encephalomyelitis virus, simian virus type 40, red fire ant virus type 1, cereal aphid virus, reticuloendotheliosis virus, Forman polio virus type 1, soybean looper virus, Kashmir bee virus, human rhinovirus type 2, human immunodeficiency virus type 1, glass leafhopper virus type 1, lice P virus, hepatitis C virus, hepatitis A virus, GB hepatitis virus, foot-and-mouth disease virus, human enterovirus, equine rhinovirus, tea looper-like virus, encephalomyocarditis virus, fruit fly C virus, crucifer tobacco virus, cricket paralysis virus, bovine viral diarrhea virus type 1, black queen cell disease Virus, aphid lethal paralysis virus, avian encephalomyelitis virus, acute bee paralysis virus, hibiscus yellow ringspot virus, swine fever virus, human FGF2, human SFTPA1, human AML1, Drosophila antennae, human AQP4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAPl, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human n.myc, mouse Gtx, human p27kipl, human PDGF2, human p53, human Pim-1, mouse Rbm3, Drosophila reaper, dog Scamper, Drosophila Ubx, human UNR, mouse UtrA, human VEGF-A, human XIAP. Or IRES types disclosed in CN112399860A, CN115867291A, and US11203767B2 patent applications. The wild-type IRES sequence can also be modified or mutated and then applied to the present invention.

[0043] The "target gene (target RNA)" described in the present invention includes any naturally occurring sequence or artificially synthesized sequence, such as any viral antigen, any known sequence of chimeric antigen receptor (CAR) or T cell receptor (TCR), etc. The technical solution to be solved by the present invention is to obtain a circular "sequence to be cyclized" more efficiently, so as to achieve stable and continuous high expression of the target gene (target RNA).

[0044] In a specific embodiment, the Coxsackie B3 virus (CVB3) ribosome entry site was selected, and EGFP, IL-12+IgG-Fc (a gene fragment fused with mouse cytokine IL-12 and human IgG Fc), and PDCoV-S1 (S1 sequence of porcine delta coronavirus PDCoV) were used as target genes for verification.

[0045] In a specific embodiment, the nucleic acid molecule has a structure of CPIE upstream-sequence to be cyclized or restriction site-CPIE downstream, the CPIE upstream has the DNA shown in SEQ ID NO.9 or the RNA produced by SEQ ID NO.9, and the CPIE downstream has the DNA shown in SEQ ID NO.10 or the RNA produced by SEQ ID NO.10.

[0046] More preferably, the nucleic acid molecule has the DNA shown in SEQ ID NO.11 or the RNA produced by SEQ ID NO.11.

[0047] In a specific embodiment, the nucleic acid molecule has a structure of CPIE upstream-sequence to be cyclized or restriction site-CPIE downstream, the CPIE upstream has the sequence shown in SEQ ID NO.12 or is produced by SEQ ID NO.12, and the CPIE downstream has the sequence shown in SEQ ID NO.13 or is produced by SEQ ID NO.13.

[0048] More preferably, the nucleic acid molecule has the sequence shown in SEQ ID NO.14 or is produced by SEQ ID NO.14.

[0049] The terms "nucleic acid molecule" and "nucleic acid" include ribonucleotides, deoxyribonucleotides, modified forms thereof, or analogs thereof. Nucleotides include substances including purines (e.g., adenine, hypoxanthine, guanine, and derivatives and analogs thereof) and pyrimidines (e.g., cytosine, uracil, thymine, and derivatives and analogs thereof). Nucleotide analogs include nucleotides with modifications in the chemical structure of bases, sugars, and / or phosphates, including but not limited to, 5'-position pyrimidine modifications, 8'-position purine modifications, modifications at the cytosine exocyclic amine, and substitutions of 5-bromo-uracil; and 2'-position sugar modifications, including but not limited to sugar-modified ribonucleotides, wherein 2'-OH is substituted by groups such as H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, wherein R is an alkyl moiety as defined herein. Nucleotide analogs are also intended to include nucleotides having bases such as inosine, xanthine; sugars such as 2'-methylribose; non-natural phosphodiester linkages such as methylphosphonate, phosphorothioate and peptide linkages. Nucleotide analogs include 5-methoxyuridine, 1-methylpseudouridine and 6-methyladenosine. The nucleic acid includes the resulting circularized RNA.

[0050] In another aspect, the present invention provides a vector, wherein the vector contains the above-mentioned nucleic acid molecule, or the vector encodes the above-mentioned nucleic acid molecule.

[0051] In another aspect, the present invention provides a cell, wherein the cell contains the above nucleic acid molecule or the above vector.

[0052] In another aspect, the present invention provides a composition comprising the above product.

[0053] Preferably, the composition further comprises an agent that promotes gene transfection.

[0054] Specifically, the gene transfection includes allowing the aforementioned product of the present invention to enter cells.

[0055] Preferably, the reagents include lipids and liposomes (DOTMA, DOGS, DOPE, etc.), calcium phosphate, polyethylene glycol (PEG), cationic polymers (such as polyethyleneimine (PEI), DEAE-dextran, nanoparticles, or lipo series commercial transfection reagents.

[0056] Preferably, the composition is a pharmaceutical composition, which further contains a pharmaceutically acceptable carrier.

[0057] The "pharmaceutically acceptable carrier" used herein should be compatible with the aforementioned nucleic acid molecules, vectors, and host cells of the present invention, that is, it can be mixed therewith without significantly reducing the effect of the pharmaceutical composition under normal circumstances.

[0058] Preferably, the pharmaceutical composition can be formulated for various ways of parenteral or non-parenteral administration. It can be provided, for example, as a sterile liquid preparation, such as an isotonic aqueous solution, emulsion, suspension, dispersion or viscous composition, which can be buffered to a desired pH.

[0059] On the other hand, the present invention provides the use of the above product in preparing target circularized RNA and increasing the content or expression of target RNA in cells.

[0060] In another aspect, the present invention provides a method for preparing circular RNA, the method comprising the steps of incubating the aforementioned nucleic acid molecule in a buffer containing GTP and / or magnesium ions,

[0061] Alternatively, the aforementioned step of incubating the nucleic acid molecule may be performed in a buffer containing excess GMP and / or magnesium ions.

[0062] Preferably, the incubation is in the following buffer containing GTP: 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.5 and GTP.

[0063] More preferably, the final concentration of GTP is 2 mM.

[0064] Preferably, the incubation step comprises alternating high temperature and low temperature treatments for 1-5 times.

[0065] More specifically, the high temperature is 55-70° C., and the high temperature treatment lasts for 1-10 min.

[0066] More specifically, the low temperature is 37-55° C., and the low temperature treatment lasts for 5-30 min.

[0067] Most preferably, the incubation step is incubating at 70°C for 5 min, then incubating at 55°C for 10 min, repeated a total of 3 times.

[0068] In some embodiments, the circular RNA is purified. The circular RNA can be purified by any known method commonly used in the art, such as column chromatography, gel filtration chromatography, and size exclusion chromatography.

[0069] On the other hand, the present invention provides a method for preparing a cell that highly expresses a target gene, the method comprising preparing circular RNA according to the above method for preparing circular RNA, and delivering the circular RNA into the target cell.

[0070] Any method known in the art can be considered to deliver circular RNA into target cells. Non-limiting examples include viral transduction, electroporation transfection, liposome delivery, polymer carriers, chemical carriers, lipid complexes, polymer complexes, dendrimers, nanoparticles, emulsions, natural endocytosis or phagocytosis pathways, cell penetrating peptides, microinjection, microneedle delivery, particle bombardment, etc.

[0071] Chemical carriers may include liposomes, polymer carriers, lipid complexes, polymer complexes, dendrimers, nanoparticles, emulsions, polyethylenimine (PEI), calcium phosphate, and the like. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] Figure 1 , CPIE system structure diagram.

[0073] Figure 2 , CPIE cyclization efficiency diagram.

[0074] Figure 3 The cyclization products of the CPIE system were effectively separated by HPLC.

[0075] Figure 4 , HPLC analysis of circular RNA purity.

[0076] Figure 5 , DNA sequencing verified the splicing sites of the CPIE system.

[0077] Figure 6Circular RNA prepared by CPIE1 and CPIE2 systems can effectively express green fluorescent protein.

[0078] Figure 7 The circular RNA prepared by the CPIE2 system can effectively express IL-12+IgG Fc.

[0079] Figure 8 The circular RNA prepared by the CPIE2 system can effectively express PDCoV S1. DETAILED DESCRIPTION

[0080] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes based on the technical solution and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

[0081] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0082] Design of CPIE system

[0083] according to Figure 1 The structure shown in A is used to construct the CPIE1 and CPIE2 systems. Specifically, the intron of the T4 phage td gene and the intron of the Anabaena (abbreviated as Ana) tRNA gene are divided into two halves, and then Figure 1 The combined sequences shown in B form two chimeric CPIE systems, in which

[0084] The sequence of CPIE1 (SEQ ID NO. 11) is first matching sequence--3' intron of Ana--3' matching sequence--3' intron of T4--spacer1--restriction enzyme cleavage site--spacer2--5' intron of T4--4th matching sequence--5' intron of Ana--2nd matching sequence;

[0085] The sequence of CPIE2 (SEQ ID NO. 14) is first matching sequence—3' intron of T4—third matching sequence—3' intron of Ana—spacer1—restriction enzyme cleavage site—spacer2—5' intron of Ana—fourth matching sequence—5' intron of Ana—second matching sequence;

[0086] The above intron structures all contain corresponding splicing sites, and restriction enzyme sites can be embedded in any sequence.

[0087] Example 1: Analysis of RNA circularization efficiency of the CPIE system

[0088] The designed sequence can be directly synthesized by the company. During the synthesis, a T7 phage promoter needs to be added before the designed CPIE sequence, and the precursor RNA can be synthesized using an in vitro transcription kit. In order to verify the effectiveness of the CPIE system, SEQ ID NO.22, CVB3IRES (SEQ ID NO.15), kozak (SEQ ID NO.16), EGFP (SEQ ID NO.17), and SEQ ID NO.23 sequences are sequentially connected at the restriction enzyme cutting site, and RNA is synthesized in vitro. The specific steps are as follows:

[0089] 1. For plasmid extraction, refer to the instructions of Tiangen Plasmid Extraction Kit.

[0090] 2. Plasmid linearization can be performed using a single restriction site reserved in the plasmid DNA. Please refer to the instructions for Takara restriction endonuclease.

[0091] 3. Linearized plasmid purification:

[0092] 1) Add water to 500 μL of the digested product, add an equal volume of organic solvent (phenol / chloroform / isoamyl alcohol 25:24:1), mix well, and centrifuge at 4°C, 12,000 rpm for 15 min.

[0093] 2) After centrifugation, transfer the DNA in the upper aqueous phase to a new EP tube, aspirate about 400 μL. Add an equal volume of chloroform, a total of 800 μL, vortex to mix. Centrifuge at 4°C, 12,000 rpm for 15 minutes.

[0094] 3) Take 300 μL of the supernatant and put it into a new centrifuge tube, add 30 μL of 3M sodium acetate, and then add twice the volume (660 μL) of pre-cooled anhydrous ethanol. Mix well and precipitate at -20℃ for at least 30 minutes.

[0095] 4) Centrifuge at 14000 rpm for 15 min at 4°C to collect the DNA precipitate.

[0096] 5) After removing the supernatant, slowly add 750 μL of ice-cold 70% ethanol to the EP tube, shake gently, and centrifuge at 4°C, 14,000 rpm for 5 minutes to collect the DNA precipitate.

[0097] 6) Repeat step 5);

[0098] 7) Discard the supernatant, invert the centrifuge tube, and air dry. Add 20 μL of RNase-free water to dissolve.

[0099] 8) In vitro transcription, as follows: Prepare the following system in an EP tube using an in vitro transcription kit from NEB:

[0100] Element Quantity (μL) 10X Reaction water 2 ATP 2 GTP 2 UTP 2 CTP 2 T7 RNA polymerase Mix 2 Template DNA (1 μg / μL) 1 RNase-free water 7 Total 20

[0101] 9) Gently flick to mix and centrifuge to the bottom of the tube. Place the reactants in a PCR instrument and incubate at 37°C for 2 hours.

[0102] 10) Add DNase I (Takara) to degrade the DNA template, prepare the reaction system according to the table below, mix well, and place in a 37°C metal bath for 20-30 minutes.

[0103] Element Quantity (μL) Total RNA 20 10X DNase I Buffer 10 Nuclease free water 60 Recombinant DNAse I 8 RNase inhibitor 2 Total Rection Volume 100

[0104] 11) After the incubation, add 2.5 μL of 0.5 M EDTA to the reaction mixture, mix well and centrifuge, place in an 80°C water bath for 2 min to inactivate DNase I, and then perform RNA column purification to obtain the precursor RNA.

[0105] 12) Circularization reaction, as follows: First, prepare 100 μL of cyclization system, add cyclization buffer (final concentration of 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.5) and GTP (final concentration of 2 mM) to 50-100 μg of precursor RNA. Make up the shortfall with RNase-free water. Incubate at 70°C for 5 min, then incubate at 55°C for 10 min, repeat for a total of 3 times. Finally, perform RNA column purification to obtain a reaction product containing circular RNA.

[0106] Through grayscale calculation analysis, it can be seen that the cyclization efficiency of the CPIE1 system can reach about 80%, and the cyclization efficiency of the CPIE2 system can reach about 90%.

[0107] Example 2: Verification of cyclization effect

[0108] The cyclization product was separated and purified by high performance liquid chromatography (HPLC). The separation and purification was carried out by 150 mM phosphate isogradient elution. The separation spectrum is as follows. The results show that the cyclization product can be effectively separated ( Figure 3 ).

[0109] collect Figure 3 The corresponding main peak sample was analyzed by HPLC, and the results showed that the impurities in the cyclization reaction had been basically removed ( Figure 4 ).

[0110] The collected circular RNA was used for reverse transcription experiments, and the reverse transcription was performed according to the full-form gold reverse transcription kit. The reverse transcribed product was subjected to PCR reaction using the designed specific primers, and the primer sequences are as follows:

[0111] GFP-F (SEQ ID NO.18)

[0112] TTGTAAAACGACGGCCAGTGCACCCAGTCCGCCCTGAGC

[0113] IRES-R (SEQ ID NO. 19)

[0114] GCTATGACCATGATTACGCCTGGTGTGCCACGCTGACTG

[0115] The product obtained by PCR amplification was inserted between EcoR1 and HidIII of the PUC57-kan vector by homologous recombination, and DNA sequencing was performed. The results showed that the circular RNA splicing reaction occurred at the expected position ( Figure 5 ).

[0116] In order to verify the efficiency of circular RNA protein expression prepared by the CPIE system, the purified circular RNA was transformed into 293F cells, and the expression of fluorescent protein was observed after 12 hours of cell culture. The results showed that circular RNA can efficiently express green fluorescent protein ( Figure 6 ).

[0117] Example 3: CPIE universality verification

[0118] To further demonstrate the versatility of the chimeric PIE system, the EGFP sequence in CPIE2 in Example 1 was replaced with a gene fragment fused with mouse cytokine IL-12 and human IgG Fc (IL-12+IgG Fc, as shown in SEQ ID NO. 20).

[0119] After HPLC purification, impurities were basically removed ( Figure 7 A), which is then desalted, concentrated and transformed into cells, and the effective expression can be detected by enzyme-linked immunosorbent assay (ELISA) ( Figure 7 B).

[0120] The EGFP sequence in CPIE2 in Example 1 was replaced with the porcine delta coronavirus (Porcinedeltacoronavirus, PDCoV) S1 sequence, as shown in SEQ ID NO.21.

[0121] After HPLC purification, impurities were basically removed ( Figure 8 A), which was desalted, concentrated and transformed into cells, and effective expression was detected by Western Blot ( Figure 8 B).

[0122] The above contents are further detailed descriptions of the present invention in combination with specific preferred embodiments, and it cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the concept of the present invention, which should be regarded as falling within the protection scope of the present invention.

Claims

1. A nucleic acid molecule, wherein the nucleic acid molecule is selected from any one of the following: (1) A nucleic acid molecule obtained by sequentially connecting the following structures: a first matching sequence, a 3' intron of a first intron structure Ana, a first splice site E3, a third matching sequence, a 3' intron of a third intron structure T4, a third splice site E1, a spacer sequence 1, a sequence to be cyclized or a restriction site, a spacer sequence 2, a fourth splice site E2, a 5' intron of a fourth intron structure T4, a fourth matching sequence, a second splice site E4, a 5' intron of a second intron structure Ana, and a second matching sequence; (2) A nucleic acid molecule obtained by sequentially connecting the following structures: a first matching sequence, a 3' intron of a first intron structure T4, a first splice site E1, a third matching sequence, a 3' intron of a third intron structure Ana, a third splice site E3, a spacer sequence 1, a sequence to be cyclized or a restriction site, a spacer sequence 2, a fourth splice site E4, a 5' intron of a fourth intron structure Ana, a fourth matching sequence, a second splice site E2, a 5' intron of a second intron structure T4, and a second matching sequence; The first matching sequence, the second matching sequence, the third matching sequence, and the fourth matching sequence are shown as SEQ ID NOs. 5-8 respectively; The sequences of the 3' intron of Ana, the 5' intron of Ana, the 3' intron of T4, and the 5' intron of T4 are shown in SEQ ID NOs. 1-4, respectively; The sequences of E1, E2, E3, and E4 are shown in positions 339-360, 449-464, 143-151, and 578-585 of SEQ ID NO.11, respectively; The sequence to be cyclized is a first spacer, a ribosome entry site (IRES), a target gene, and a second spacer connected in sequence; The IRES is CVB3 IRES. 2 . The nucleic acid molecule of claim 1 , wherein the first spacer region comprises polyAC, polyA, spacer, 5′UTR or 3′UTR. 3 . The nucleic acid molecule of claim 1 , wherein the second spacer region comprises polyAC, polyA, spacer, 5′UTR or 3′UTR. The nucleic acid molecule according to claim 1 , wherein the length of the first spacer or the second spacer is 10-80 nt. The nucleic acid molecule according to claim 4 , wherein the length of the first spacer or the second spacer is 20-30 nt.

6. The nucleic acid molecule according to claim 5, wherein the first spacer region or the second spacer region is the DNA shown in SEQ ID NO. 22-23 or the RNA produced by transcription thereof.

7. The nucleic acid molecule according to claim 1, wherein the nucleic acid molecule is a structure of CPIE upstream-sequence to be cyclized or restriction site-CPIE downstream, wherein the CPIE upstream is the DNA shown in SEQ ID NO.9 or 12 or the RNA produced by SEQ ID NO.9 or 12, and the CPIE downstream is the DNA shown in SEQ ID NO.10 or 13 or the RNA produced by SEQ ID NO.10 or 13.

8. The nucleic acid molecule according to claim 1, wherein the nucleic acid molecule is the DNA shown in SEQ ID NO. 11 or 14 or the RNA produced by SEQ ID NO. 11 or 14.

9. A vector, comprising the nucleic acid molecule according to any one of claims 1 to 8, or encoding the nucleic acid molecule according to any one of claims 1 to 8.

10. A cell, comprising the nucleic acid molecule according to any one of claims 1 to 8 or the vector according to claim 9.

11. A composition comprising one or more of the nucleic acid molecule according to any one of claims 1 to 8, the vector according to claim 9 and the cell according to claim 10.

12. The composition according to claim 11, further comprising an agent that promotes gene transfection.

13. The composition of claim 12, wherein the agent is a lipid, a liposome, calcium phosphate, polyethylene glycol or a cationic polymer.

14. The composition according to claim 11, which is a pharmaceutical composition, further comprising a pharmaceutically acceptable carrier.

15. Use of the nucleic acid molecule of any one of claims 1 to 8, the vector of claim 9, the cell of claim 10 or the composition of any one of claims 11 to 14 in preparing a target circularized RNA or in increasing the target RNA content or expression in a cell for a non-therapeutic purpose.

16. A method for preparing circular RNA, comprising the step of incubating the nucleic acid molecule according to any one of claims 1 to 8 in a buffer containing GTP and / or magnesium ions, Alternatively, the step of incubating the nucleic acid molecule according to any one of claims 1 to 8 in a buffer containing excess GMP and / or magnesium ions.

17. The method of claim 16, wherein the incubation is carried out in the following buffer containing GTP: 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.5 and GTP. The method according to claim 17 , wherein the final concentration of GTP is 2 mM.

19. The method of claim 17, wherein the incubation step comprises alternating high temperature and low temperature treatments for 1 to 5 times; The high temperature is 55-70°C, and the high temperature treatment lasts for 1-10 minutes; The low temperature is 37-55° C., and the low temperature treatment lasts for 5-30 min.

20. The method of claim 16, wherein the incubation step is performed at 70°C for 5 min, then at 55°C for 10 min, and the steps are repeated for a total of 3 times.

21. A method for preparing cells that highly express a target gene in vitro, the method comprising preparing circular RNA according to the method for preparing circular RNA according to any one of claims 16 to 20, and delivering the circular RNA to the target cells.

Images