Cyclic rna_hsa_circ_0001681 and carriers and detection kits thereof

By detecting and overexpressing the circular RNA_hsa_circ_0001681, the problem of poor prognosis in glioma patients was addressed, and the proliferation and invasion of glioma cells were inhibited, thus prolonging the survival of tumor-bearing mice.

CN117904295BActive Publication Date: 2025-10-21RENJI HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410065554.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-17
Publication Date
2025-10-21
Estimated Expiration
2044-01-17

AI Technical Summary

Technical Problem

There is a lack of effective treatments in the current technology to improve the prognosis of glioma patients, especially since the high heterogeneity of gliomas makes it difficult to control malignant progression.

Method used

We provide circular RNA_hsa_circ_0001681, its vector, and a detection kit. The expression of circular RNA_hsa_circ_0001681 can be detected by real-time fluorescence quantitative PCR for the diagnosis of malignant progression in glioma patients. We also inhibit the proliferation and invasion of glioma cells by using a vector that overexpresses circular RNA_hsa_circ_0001681.

Benefits of technology

It significantly inhibits the proliferation and invasion of glioma cells and prolongs the survival of tumor-bearing mice, showing potential as a prognostic and therapeutic tool for glioma patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117904295B_ABST
    Figure CN117904295B_ABST
Patent Text Reader

Abstract

The application provides application of circular RNA_hsa_circ_0001681 in preparation of a marker for diagnosing malignant progression prognosis of a brain glioma patient, and the sequence of the circular RNA_hsa_circ_0001681 is shown as SEQ ID NO. 1. The application further provides a vector containing the sequence of the circular RNA_hsa_circ_0001681. The application further provides application of the above-mentioned vector in preparation of a drug for treating a brain glioma patient. The application further provides application of a reagent for detecting the circular RNA_hsa_circ_0001681 in preparation of a kit for diagnosing malignant progression prognosis of a brain glioma patient. Compared with normal brain glioma cells, the circular RNA is significantly decreased in common glioma cell lines, and cell experiments reveal that overexpression of the circular RNA_hsa_circ_0001681 can reduce malignant proliferation of glioma cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical field:

[0001] The present invention belongs to the field of biomedicine and relates to a circular RNA, specifically a circular RNA_hsa_circ_0001681 and its carrier and detection kit. Background technology:

[0002] Brain tumors are among the top ten most common tumors in the human body. Although their incidence ranks only 9th to 10th, their mortality rate among young adults ranks second (for men) and fourth (for women). Among children, brain tumors are the second most common tumor, second only to leukemia. Glioblastoma (GBM) is the most common malignant brain tumor. Due to its high malignancy, highly invasive nature, and lack of a clear demarcation from normal brain tissue, it is difficult to completely resect surgically and is not very sensitive to chemotherapy or radiotherapy, resulting in a high recurrence rate. Consequently, despite a 71.6% surgical rate for GBM and a 51.4% rate for standardized postoperative chemoradiotherapy, the five-year survival rate for GBM patients is only approximately 3%, with a median survival of only 14.6 months, representing an extremely poor prognosis. This may be due to the high heterogeneity of glioma cells and the tumor microenvironment. Therefore, a deeper understanding of the biological mechanisms of GBM and the development of novel targets will help improve the clinical dilemma of GBM's high recurrence rate and poor prognosis, thereby promoting the development of new or improved treatments.

[0003] CircRNAs, a novel endogenous RNA, are implicated in disease progression in various tumors, including gliomas, due to their high abundance, high conservation, stability, and spatiotemporal specificity. Song et al., performing microarray analysis on 46 glioma and normal brain tissue samples, identified 476 differentially expressed circRNAs. They subsequently successfully experimentally validated 24 of 27 randomly selected circRNAs. This suggests that circRNAs are differentially expressed in gliomas and have the potential to serve as tumor molecular markers. CircRNAs can also influence the development and progression of gliomas through various mechanisms.

[0004] Although multiple reports have confirmed that circRNAs can participate in the malignant progression of gliomas and revealed some regulatory mechanisms, due to the high heterogeneity of gliomas, there is currently a lack of active and effective therapeutic drugs to improve the malignant progression of glioma patients in clinical practice, and further research is still needed. Summary of the invention:

[0005] In response to the above-mentioned technical problems in the prior art, the present invention provides a circular RNA_hsa_circ_0001681, its carrier, and a detection kit. The circular RNA_hsa_circ_0001681, its carrier, and detection kit are intended to solve the technical problem that the drugs in the prior art are not effective in treating brain gliomas.

[0006] The present invention provides the use of circular RNA_hsa_circ_0001681 in preparing a marker for diagnosing the prognosis of malignant progression in patients with brain glioma. The sequence of the circular RNA_hsa_circ_0001681 is shown in SEQ ID NO.1.

[0007] The present invention also provides a vector containing the overexpressed circular RNA_hsa_circ_0001681 sequence, wherein the sequence of the circular RNA_hsa_circ_0001681 is shown in SEQ ID NO.1.

[0008] The present invention also provides the use of the above-mentioned carrier in preparing medicine for treating patients with brain glioma.

[0009] The present invention also provides a use of a reagent for detecting circular RNA_hsa_circ_0001681 in preparing a kit for diagnosing the prognosis of malignant progression in patients with brain glioma. The sequence of the circular RNA_hsa_circ_0001681 is shown in SEQ ID NO.1.

[0010] Furthermore, the reagent for detecting circular RNA_hsa_circ_0001681 is a real-time fluorescence quantitative detection reagent.

[0011] Furthermore, the real-time fluorescence quantitative detection reagent contains primer sequences for real-time fluorescence quantitative detection of circular RNA_hsa_circ_0001681 expression in brain glioma tissue:

[0012] Forward primer: 5'-CGTCAGGGCATGAGGATGG-3',

[0013] Reverse primer: 5′-CAGGTCCCTCAGCCGC-3′.

[0014] Furthermore, the kit also contains:

[0015] Specific PCR primers for internal reference gene GAPDH:

[0016] Forward primer: 5'-GTCTCCTCTGACTTCAACAGCG-3'

[0017] Reverse primer: 5′-ACCACCCTGTTGCTGTAGCCAA-3′.

[0018] The present invention has the following beneficial effects:

[0019] 1. The present invention detected the expression of circular RNA_hsa_circ_0001681 in normal glial cells and glioma cell lines U87, U251, A172 and T98G, and found that the expression of this circular RNA was significantly downregulated in glioma cell lines, revealing that this circular RNA has the value of auxiliary diagnosis and therapeutic agent research and development and important academic significance.

[0020] 2. The cells of the present invention also revealed that overexpression of circular RNA_hsa_circ_0001681 can promote the proliferation and invasion of glioma cells, reduce tumor volume, and prolong the survival of tumor-bearing mice. In other words, overexpression of circular RNA_hsa_circ_0001681 can inhibit the malignant progression of brain glioma.

[0021] Compared with existing targets, the present study demonstrates significant and positive therapeutic effects. The circular RNA hsa_circ_0001681 provided by the present invention can be used in clinical and scientific research to effectively control and intervene in the progression of glioblastoma patients, significantly improving the prognosis of glioma patients and potentially serving as a prognostic indicator for patients with brain gliomas. This invention will play an important role in the fields of medical treatment and tumor therapy. Description of the drawings:

[0022] Figure 1 The expression of circular RNA_hsa_circ_0001681 in normal glial cells and glioma cell lines U87, U251, A172, and T98G was detected by qRT-PCR. The head-to-tail circular nature and linker sequence of this circular RNA were successfully identified.

[0023] Figure 2 To design and successfully construct a cell line overexpressing circular RNA_hsa_circ_0001681 and investigate its effect on glioma cell proliferation. CCK8 and plate cloning experiments revealed that overexpression of circular RNA_hsa_circ_0001681 inhibited cell proliferation.

[0024] Figure 3 The effect of cell lines overexpressing circular RNA_hsa_circ_0001681 on glioma cell invasion. Transwell and wound wound assays revealed that overexpression of circular RNA_hsa_circ_0001681 inhibited cell invasion.

[0025] Figure 4 Animal experiments revealed that overexpression of circular RNA_hsa_circ_0001681 can inhibit tumor volume and prolong the survival of tumor-bearing mice. Specific implementation method:

[0026] Example 1 Detect the expression of circular RNA_hsa_circ_0001681 in normal glial cells and glioma cell lines, and identify the head-tail junction sequences of the circular RNA.

[0027] The specific implementation methods are:

[0028] 1. Cell Preparation: All cellular RNA was extracted using Trizol. Discard the supernatant and wash the cells twice with PBS. Add an appropriate amount of Trizol. Use a pipette or cell scraper to remove the cells. Repeatedly pipette and lyse the cells until they are fully lysed. Transfer the cell-Trizol mixture into a 1.5 ml EP tube.

[0029] 2. RNA extraction and detection steps:

[0030] Transfer the above Trizol mixture to a 1.5 ml EP tube and let it stand at room temperature for 5 minutes;

[0031] (1) Add 0.2 ml of chloroform to a 1.5 ml EP tube, shake vigorously for 15 seconds (make sure to cover the EP tube tightly to prevent leakage), and let it stand on ice for 10 minutes until layers appear; pre-cool the centrifuge to 4°C.

[0032] (2) Centrifuge at 12,000 rpm for 15 minutes at 4°C. Prepare the next batch of EP tubes during the centrifugation process and mark them. (3) Take the aqueous phase: After high-speed centrifugation, the solution in the EP tube is divided into three layers. Transfer the aqueous phase (upper layer) to another EP tube. Generally, only 400-600 μl of the aqueous phase is used for 1 mL of Trizol. Avoid aspirating the middle phase and the lower red organic phase.

[0033] (4) Isopropanol precipitation: Add an equal volume of isopropanol (= the aqueous phase) and mix thoroughly by inversion. Let stand on ice for 10 min, then centrifuge at 12,000 rpm at 4°C for 10 min. A flocculent gel-like precipitate will appear.

[0034] (5) Ethanol washing: After centrifugation, discard the supernatant, add 1 mL of 75% ethanol for washing, flick the bottom, mix on a vortex, let stand at room temperature for 3-5 minutes, then centrifuge at 12000 rpm and 4°C for 5 minutes; wash with 75% ethanol and centrifuge twice. The white flocs obtained are RNA;

[0035] (6) Dry the precipitate and dissolve it: discard the supernatant, centrifuge briefly, remove as much supernatant as possible, place the precipitate at room temperature to dry for 5-10 minutes, add 30-100 μL of sterile enzyme-free DEPC water to dissolve the RNA, and gently pipette to eliminate the precipitate;

[0036] (7) Determine the concentration of extracted RNA: Take 2 μL of RNA solution and place it in a new blank EP tube. Then add 98 μL of sterile enzyme-free DEPC water and mix thoroughly. Use sterile enzyme-free DEPC water as a blank control and measure the OD 260 / 280 value. An OD 260 / 280 value of 1.8-2.0 is considered to be very pure. A concentration of 1000 ng / ml is generally more accurate. If the sample concentration is too high, dilute it before measuring. Record the concentration and purity of the extracted RNA. The quality of RNA is determined by denaturing agarose gel electrophoresis.

[0037] (8) RNase R digestion: The RNA sample obtained above was resuspended and divided into two parts. One part was digested with RNase R, and the other part was used as a control. The RNase R digestion group was added with 3 μL 10× RNase R reaction buffer, 1 μL RNase R (20 U / μl), and 3 U / mg RNase R (Epicentre, cat.#RNR07250) at 37°C under the following conditions. At the same time, DEPC water was added to the control group to eliminate interfering sequences. The digestion was terminated by shaking and mixed, and the centrifuge was pre-cooled in advance, 13000×g, 4°C for 5 minutes. In a new EP tube, the supernatant was added, 6 μL 4M lithium chloride, 1 μL glycogen, and 90 μL pre-cooled anhydrous ethanol were inverted and resuspended, and precipitated at -80°C for 1 hour. It can be used for the next experiment or stored in a -80°C refrigerator. The control is used to eliminate interfering sequences.

[0038] 3. Genomic DNA Extraction

[0039] (1) Add 400 μl of 1% SDS and 8 μl of proteinase K (the concentration of proteinase K is 20 mg / ml) to the cells, fully infiltrate them, and place them on a shaker (100 rpm, 55°C) for about 5 hours;

[0040] (2) Remove the liquid, add 300 μl of 6 mol / L NaCl and 200 μl of chloroform, gently invert the tube to fully emulsify, and then place it in a centrifuge at 13,000 rpm at 4°C for 30 minutes;

[0041] (3) Take the supernatant from the above tube, add an equal volume of chloroform to extract, gently invert upside down, and continue to centrifuge at 13,000 rpm at 4°C for 10 minutes;

[0042] (4) Different groups were treated with or without RNase A at 37°C, 3 U / mg RNase R (Epicentre, cat. #RNR07250);

[0043] (5) Take the supernatant from the above tube, add an equal volume of isopropanol, mix gently, and precipitate at -20°C for 10 minutes; then place in a centrifuge at 13,000 rpm at 4°C for 10 minutes; discard the supernatant;

[0044] (6) Wash with 75% and ice-cold anhydrous ethanol 1-2 times, discard the supernatant, and air dry. Save for subsequent experiments.

[0045] 4. RNA Reverse Transcription and RT-qPCR Detection

[0046] According to the instructions, reverse transcription iScript was used from Bio-Rad, USA. TM RNA was reverse transcribed using a cDNA synthesis kit.

[0047] (1) Reverse transcription: extracting cell line RNA and reverse transcribe it into cDNA;

[0048] (2) Design amplification primers: The base sequences of primers spanning the reverse splicing site are as follows:

[0049] The primer information is shown in the following table:

[0050] Name / gene name Sequence / primer sequence, chain synthesis direction 5'~3' circ-0001681-F (upstream primer) CGTCAGGGCATGAGGATGG(SEQ ID NO.2) circ-0001681-R (downstream primer) CAGGTCCCTCAGCCGC (SEQ ID NO. 3) GAPDH-F (upstream primer) GTCTCCTCTGACTTCAACAGCG(SEQ ID NO.4) GAPDH-R (downstream primer) ACCACCCTGTTGCTGTAGCCAA(SEQ ID NO.5)

[0051] Based on gene comparison and primer specificity analysis, the specific primers in the above table were screened out.

[0052] (2) PCR sample amplification system

[0053]

[0054] (3) PCR sample reaction procedure is as follows:

[0055]

[0056] 5. Agarose Electrophoresis and Gel Imaging Analysis

[0057] Prepare an agarose gel of the appropriate concentration using 1× TAE gel buffer. Weigh the agarose powder (based on the fragment sizes of IDH1 / IDH2, which are 402 bp / 404 bp, and the corresponding sizes of circPLOD2 and PLOD2, which are between 100 and 250 bp). Dissolve the agarose powder in approximately 30 ml of 1× TAE electrophoresis buffer and heat to melt. Be careful not to allow bubbles to form during the dissolution process, as this will affect the results. Place the gel in a horizontal electrophoresis apparatus and add 1× TAE buffer to cover the gel. After approximately 15 minutes, gently and slowly remove the comb, taking care not to break the gel (add running buffer to moisten it appropriately). Add DNA Marker to the well on the left, add 10× loading buffer to the DNA sample, mix thoroughly, add samples in sequence, and perform electrophoresis at a constant voltage of 120 V for 30 minutes; remove the gel and image it on a gel imager, cut the single target band from the agarose gel under direct vision (be careful to use a sharp blade to avoid rough edges of the gel), put it into a clean centrifuge tube, and use a gel DNA recovery kit (Tiangen Biochemical Technology Co., Ltd., DP219-03) to recover the gel DNA. Use an ultra-micro UV spectrophotometer to determine the solubility and purity.

[0058] 6. PCR Product Recovery

[0059] Cut the gel of the target DNA size (between 100-250bp) neatly and try to remove the gel without fragments. Put it into a 1.5ml EP tube. Weigh the cut gel, place the adsorption column in the collection tube, and add 500μl of equilibration solution BL to the adsorption column CA2. Centrifuge at 12000rpm for 1 minute and discard the waste liquid in the collection tube. Add 3 times the volume of PN solution to the gel EP tube according to the previously weighed 1:3 ratio and incubate in a 50℃ constant temperature water bath until the gel melts, which usually takes about 10 minutes. Add the solution to the adsorption column CA2, let it stand at room temperature for 1-2 minutes, and centrifuge at 12000rpm for 30 seconds. Discard the waste liquid in the collection tube and add 600μl of rinsing solution PW to the adsorption column CA2 and centrifuge at 12000rpm for 45 seconds. After discarding the waste liquid, continue to centrifuge at 12000rpm for 2 minutes to centrifuge as cleanly as possible. Let it stand at room temperature for 2 minutes, dry it, add 30μl ddH2O to the adsorption column, let it stand at room temperature for 2 minutes, and then centrifuge it at 12000rpm for 2 minutes. Repeat this step twice to collect the DNA solution.

[0060] 7. PCR product sequencing

[0061] The gene products were recovered and purified after gel running. All recovered and purified samples were sent to GeneWeichi Biotechnology Co., Ltd. for gene sequencing.

[0062] Figure 1A The expression of circular RNA_hsa_circ_0001681 in normal glial cells and glioma cell lines U87, U251, A172, and T98G was detected. Figure 1 C is the genomic location of the circular RNA source and the schematic diagram of the loop, Figure 1 B and successfully identified the circular characteristics and linker sequence of the head-to-tail connection of the circular RNA. Figure 1 D shows the mature sequence of the circular RNA (SEQ ID NO. 1). Figure 1 Agarose gel electrophoresis and other experiments confirmed that the circular RNA hsa_circ_0001681 is resistant to exonuclease degradation and is not present in genomic DNA, but is produced during transcription. The same-direction primer in PCR amplified the product in linear mRNA but failed to amplify it after RNase-R treatment.

[0063] The experimental results showed that circular RNA_hsa_circ_0001681 is a circular structure connected end to end, and its expression is decreased in glioma cell lines.

[0064] Conclusion: This study demonstrated decreased expression of the circular RNA hsa_circ_0001681 in glioma cell lines using qRT-PCR. The end-to-end circular nature and linker sequence of this circular RNA were successfully identified. Example 2 constructed a cell line overexpressing hsa_circ_0001681 and examined its effect on cell proliferation.

[0065] 1. Extract the circ_0001681 overexpressing lentiviral vector and its auxiliary vector plasmid. Co-transfect the constructed circ_0001681 overexpressing lentiviral vector and its auxiliary vector plasmid into the target cells using Transgene reagent. Add the enhancing buffer 12 hours after transfection. Replace with fresh complete medium 4 hours later. Continue culturing for 48 hours. Collect and concentrate the cell supernatant enriched with the circ_0001681 lentivirus.

[0066] 2. Construction of Circ_0001681 overexpressing stable cell lines

[0067] Lentiviral infection of target cells (U251-MG, U87-MG)

[0068] Day 1: Seed the target GBM cells in a six-well plate at a ratio of about 35%.

[0069] The next day: Thaw the virus stock solution on ice, then dilute the virus stock solution with fresh complete medium containing 8 μg / mL Polybrene. Aspirate the original medium in the six-well plate and add the lentivirus dilution solution to the GBM cells. The medium replacement time can be appropriately extended according to the cell status (usually 4h-8h).

[0070] On the third day, when the cells grew to 80%-90%, the cells were digested according to the aforementioned digestion and subculture steps and placed in a culture flask for culture.

[0071] On day 4, infection efficiency was assessed by observing fluorescence (lentiviral vector carriers) under an inverted fluorescence microscope to assess the efficiency of lentiviral infection of GBM cells. Subsequently, 2 μg / mL puromycin was added to the cells and cultured at 37°C, 5% CO₂ for 24 hours to screen for puromycin-resistant stable transfectants. Cells were harvested and infection efficiency was verified by PCR.

[0072] 3. CCK-8 assay

[0073] First, trypsinize the cells and centrifuge at low speed to remove cell debris. Resuspend with fresh culture medium and count the cells. Plate 3000 (100 μL) cells / well in a 96-well plate, repeat 3 times for each group, and add only culture medium to the control wells. Culture overnight in a conventional incubator at 37°C and 5% CO2. At specific time points such as 24 hours, 48 ​​hours, 72 hours, 96 hours, etc., add 10 μL CCK8 / 100 μL culture medium to each well, incubate at 37°C for 2 hours, and measure the absorbance OD450 at 450nm. Then calculate the data and draw a graph.

[0074] 4. Plate colony formation experiment

[0075] Cell preparation is the same as that for the CCK8 experiment. Digest with trypsin, resuspend, and count. Plate cells in a six-well plate at a density of 500 cells / well based on the calculated results. Mix thoroughly. Repeat three times for each group. Culture in an incubator for routine testing. Add a small amount of culture medium every 3-5 days as needed, and observe the cells after 10 to 14 days. When a single clone has more than 50 cells, proceed to the next step. Fix the cells with 4% paraformaldehyde at room temperature for 15 minutes, wash three times with PBS, and stain with 1% crystal violet for 1-2 hours. Wash three times with PBS, then observe and count under a microscope. Statistical graphing is performed.

[0076] Figure 2 A cell line overexpressing circular RNA_hsa_circ_0001681 was successfully constructed, and its effect on the proliferation of glioma cell lines was detected. Figure 2 A, B show the successful construction of cell lines overexpressing circular RNA_hsa_circ_0001681. Figure 2C, 2D showed that CCK-8 experiments confirmed that overexpression of circular RNA-hsa_circ_0001681 could significantly reduce the proliferation activity of U87-MG and U251-MG cells compared with the control group. Figure 2 E, 2G show that the plate clone formation experiment found that compared with the control group, overexpression of circular RNA-hsa_circ_0001681 can significantly reduce the number of clones of U87-MG and U251-MG cells. Figure 2 F and 2H show the corresponding statistical data.

[0077] The experimental results showed that U87-MG and U251-MG cell lines overexpressing circular RNA_hsa_circ_0001681 were successfully constructed, and detection found that overexpression of this circular RNA can inhibit the proliferation of glioma cells.

[0078] Example 3 Detection of the effect of overexpression of circular RNA_hsa_circ_0001681 on glioma cell invasion 1. Scratch assay

[0079] First, use a marker to draw a horizontal line evenly across the center of the well on the back of a six-well plate. Count the digested cells, remix them, and add them to the six-well plate. Place in an incubator overnight. The next day, wait until the six-well plate is fully covered before starting the experiment. Use the tip of the pipette to draw a line perpendicular to the horizontal line on the back, but do not draw it at an angle. Wash the cell fragments removed with PBS. Add fresh serum-containing culture medium. Place in an incubator and culture overnight. Take photos every 24 hours. Terminate the experiment when cells are fused.

[0080] 2. Transwell Assay Preparation: First, prepare the Matrigel: Place the Matrigel at 4°C overnight to allow it to become liquid. 12 to 24 hours before passaging, aspirate the original culture medium and add fresh culture medium without FBS. Incubate at 37°C, 5% CO2, and incubate for 24 hours.

[0081] The following steps were all performed on ice: Using a pre-chilled pipette tip, dilute 50 μl of Matrigel matrix solution with 400 μl of DMEM medium. Add 50 μl of Matrigel dilution to the upper chamber and place in the incubator for 4-5 hours. When a "white layer" appears, add 100 μl of culture medium to infiltrate and discard. Count the digested experimental cells and use 2×10 4Add 100 μL of complete culture medium containing 10% serum to the upper chamber at a density of 100 μL / 100 μL, and add 600 μL of complete culture medium containing 10% serum to the lower chamber. Gently place the upper chamber on the lower chamber to avoid creating bubbles; then incubate in an incubator. After 48 hours, remove the upper chamber, discard the culture medium, and wash three times with PBS. Fix the cells with 4% paraformaldehyde for 15 minutes and wash three times with PBS. Stain with crystal violet for 1 hour and wash three times with PBS. Keep the cells moist and randomly select 3-5 fields of view for photographing and counting. Statistical analysis is performed.

[0082] 3. Such as Figure 3 As shown in the figure, the experimental results showed that overexpression of circular RNA_hsa_circ_0001681 can reduce the invasive ability of glioma cells. Figure 3 A, 3C showed that the Transwell experiment confirmed that compared with the control group, overexpression of circular RNA-hsa_circ_0001681 could significantly reduce the invasive ability of U87-MG and U251-MG cells. Figure 3 B, 3D show the corresponding statistical data. Figure 3 E, 3G confirmed by the scratch experiment: compared with the control group, overexpression of circular RNA-hsa_circ_0001681 can significantly reduce the "wound healing" ability of U87-MG and U251-MG cells. Figure 3 F, 3H show the corresponding statistical data.

[0083] Example 4 Detection of the effect of overexpression of circular RNA_hsa_circ_0001681 on tumor-bearing mice

[0084] In this study, two orthotopic glioma models were constructed. Twelve nude mice (4-5 weeks old) were randomly divided into two groups: U87-MG-NC and U87-MG-hsa_circ_0001681-OE (n = 6 per group).

[0085] (1) U87-MG cells: Digest according to the cell digestion steps and count using a hemocytometer. Adjust the U87-MG concentration to 1×10 6 Place on ice and bring to the animal room for inoculation.

[0086] (2) Anesthetize the nude mice with 0.9% sodium pentobarbital (0.05 ml / 10 g) intraperitoneally. After 3-5 minutes, ensure that the nude mice are fully anesthetized and place them on a small animal stereotaxic apparatus, securing them so that they cannot move. Place the nude mice on a 37°C thermostatted blanket.

[0087] (3) Disinfect the skin of the nude mouse skull with alcohol, make an incision in the middle of the head to expose the skull, and be careful not to use excessive force. Pay attention to distinguish the bony landmarks such as the anterior fontanelle, the coronal suture, and the sagittal suture. From the anterior fontanelle, move 1.0 mm forward and 1.8 mm to the side to select the craniotomy point. Use a drill to grind the skull, but be careful not to use too much force. Use a micropump to aspirate 5 μl of cells. Start injecting cells after the needle is inserted 3 mm, and the injection will be completed in about 10 minutes. Remove the microsyringe and seal the skull with bone wax. Disinfect and suture the scalp, and continue disinfection 3 times.

[0088] (4) After the nude mice recover, place them in a clean cage. Continue feeding them. Pay close attention to their condition and weight changes.

[0089] (5) When nude mice showed symptoms such as unsteady walking, decreased food intake, or weight loss, both groups of mice were promptly subjected to cranial MRI scans (intraperitoneal injection of Gd-DTPA (100 μl / 20 g), followed by T1 enhanced scanning 5 minutes later). (6) The nude mice were kept in the animal room. When the nude mice significantly lost weight and stopped eating, they were euthanized by injection of an overdose of anesthetic and cardiac perfusion. Brain tissue samples were collected and the time of death was recorded.

[0090] Figure 4 Compared with the control group, overexpression of circular RNA_hsa_circ_0001681 prolonged the survival of tumor-bearing mice. Figure 4 A, 4B T1 enhancement MRI examination of nude mice showed that the tumor volume in the group overexpressing circular RNA_hsa_circ_0001681 was significantly smaller than that in the NC group. Figure 4 C shows that the body weight of mice in the overexpression group was significantly higher than that in the control group. Figure 4 D shows that the median survival time of the circular RNA_hsa_circ_0001681 overexpression group was significantly longer than that of the control group.

[0091] The experimental results showed that overexpression of circular RNA_hsa_circ_0001681 can inhibit the tumor volume of tumor-bearing mice and prolong the survival of tumor-bearing mice.

[0092] In summary, compared to normal glial cells, the expression of this circular RNA in glioma cell lines was significantly decreased, and cell experiments revealed that overexpression of circular RNA_hsa_circ_0001681 inhibited the proliferation and invasion of glioma cells and suppressed the malignant progression of gliomas. Therefore, this circular RNA has the potential to serve as a target for malignant progression in patients with brain gliomas.

Claims

1. A vector for preparing a drug for treating a patient with a brain glioma, wherein the vector contains the sequence of an overexpressed circular RNA_hsa_circ_0001681, and the sequence of the circular RNA_hsa_circ_0001681 is shown in SEQ ID NO.

1.

2. Use of a reagent for detecting circular RNA_hsa_circ_0001681 in the preparation of a kit for diagnosing the prognosis of malignant progression in patients with brain glioma, wherein the sequence of the circular RNA_hsa_circ_0001681 is shown in SEQ ID NO.

1.

3. The use according to claim 2, characterized in that The reagent for detecting circular RNA_hsa_circ_0001681 is a real-time fluorescence quantitative detection reagent.

4. The use according to claim 3, characterized in that The real-time fluorescence quantitative detection reagent contains primer sequences for real-time fluorescence quantitative detection of circular RNA_hsa_circ_0001681 expression in brain glioma tissue: Forward primer: 5'-CGTCAGGGCATGAGGATGG-3', Reverse primer: 5′-CAGGTCCCTCAGCCGC-3′.

5. The use according to claim 3, characterized in that The kit also contains: Specific PCR primers for internal reference gene GAPDH: Forward primer: 5'-GTCTCCTCTGACTTCAACAGCG-3' Reverse primer: 5′-ACCACCCTGTTGCTGTAGCCAA-3′.

Citation Information

Patent Citations

  • Analysis method for application of circRNAs in lung adenocarcinoma

    CN114058703A