A response transcription regulator gene and its application

Abstract

The present invention discloses a response transcriptional regulator gene and its application, belonging to the field of genetic engineering technology. The response transcriptional regulator gene provided by the present invention has a nucleic acid sequence as shown in SEQ ID NO: 1. The gene is confirmed for the first time by the present invention to be related to the regulation of acid resistance of bacterial species. The development of this acid resistance is conducive to improving the fermentation performance of Oenococcus oeni in malic acid and lactic acid fermentation of wine, thereby further improving the quality of wine, and has important application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a response transcription regulatory factor gene and application thereof. Background Art

[0002] Winemaking mainly includes two fermentation processes: alcoholic fermentation and malolactic fermentation, which are led by different microorganisms. The alcoholic fermentation process is mainly completed by Saccharomyces cerevisiae, which decomposes organic sugars such as glucose to produce ethanol and form CO2. Malolactic fermentation is mainly completed by Oenococcus oeni, which is necessary for the production of high-quality wine, because malolactic fermentation will reduce the acidity of the wine, enhance the stability of microorganisms, reduce the bitterness, and change the aroma structure of the wine, increase its fruity aroma. In addition, Oenococcus oeni will produce aroma compounds such as diacetyl during metabolism, which will increase the taste and flavor of the wine.

[0003] The malolactic fermentation process usually starts in the late stage of alcoholic fermentation, when the fermentation liquid environment is relatively harsh and the pH is low, between 3.0 and 3.5. Lower pH values ​​usually affect the stability of bacterial intracellular pH and increase the difficulty of cells excreting protons from inside and outside the cells. When the intracellular pH value decreases, it will affect the stability of various intracellular enzymes and DNA, thereby affecting cell growth and division. Most lactic acid bacteria cannot survive in the harsh environment formed by such stress conditions. Oenococcus oeni has evolved into the main strain in the winemaking process due to its long-term adaptability and has become the main finisher of malolactic fermentation. Therefore, it is of great significance to explore the mechanism of why Oenococcus oeni can adapt to the acid stress conditions in the winemaking process. Summary of the invention

[0004] The present invention provides a response transcription regulatory factor gene, the nucleic acid sequence of which is shown in SEQ ID NO:1.

[0005] The present invention also provides a mutant of the above-mentioned response transcription regulator gene, the nucleic acid sequence of the mutant gene is as follows

[0006] As shown in SEQ ID NO:2.

[0007] The present invention also provides a recombinant expression vector, an expression cassette, a transgenic cell line, a recombinant bacterium or a recombinant virus containing the above-mentioned response transcription regulatory factor gene and / or its mutant form.

[0008] The present invention also provides the use of the above-mentioned response transcription regulatory factor gene and / or its mutant in improving the acid resistance of bacterial strains.

[0009] In the above application, the bacterial species include but are not limited to Oenococcus oeni, Lactobacillus plantarum and other bacterial species.

[0010] The present invention provides a method for improving the acid resistance of a bacterial strain, which comprises constructing the above-mentioned response transcription regulatory factor gene or its mutant form into an expression vector to form a recombinant expression vector, then transforming the recombinant expression vector into a strain to obtain a recombinant strain containing the response transcription regulatory factor gene or its mutant form, and finally improving the acid resistance of the strain through the expression of the response transcription regulatory factor gene or its mutant form.

[0011] In the above method, the expression vector includes but is not limited to vectors such as Escherichia coli pIB184 plasmid.

[0012] The present invention provides the use of the above-mentioned response transcription regulator gene and / or its mutant in improving the fermentation quality of wine dominated by Oenococcus oeni during the malolactic fermentation process.

[0013] In the above application, the Oenococcus oeni is transformed with the exogenous response transcription regulator gene and / or its mutant form.

[0014] The beneficial effects of the present invention are:

[0015] The orf00404 encoding gene in Oenococcus oeni was confirmed by the present invention for the first time to be related to the regulation of acid resistance of the strain. The development of this acid resistance is conducive to improving the fermentation performance of Oenococcus oeni in wine malolactic fermentation, thereby further improving the quality of wine, and has important application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is the amplified band of orf00404 target gene; among them, lane 1 is from SD-2a, and lane 2 is from DEa3;

[0017] Figure 2 Schematic diagram of the process of constructing a recombinant plasmid;

[0018] Figure 3 is an agarose gel electrophoresis diagram of the digestion products; wherein, lane 1 represents the pIB184 plasmid after double digestion with BamH I and EcoR I, and lanes 2 to 5 all represent the pIB184 plasmid;

[0019] Figure 4 It is the PCR electrophoresis of Escherichia coli colony transformation; wherein, lane 0 represents the electrophoresis of PCR product of pIB184 plasmid empty vector colony, lanes 1-5 represent the PCR electrophoresis of orf00404 gene recombinant plasmid colony derived from Oenococcus oeni DEa3, and lanes 6-10 represent the PCR electrophoresis of orf00404 gene recombinant plasmid colony derived from Oenococcus oeni SD-2a;

[0020] Figure 5 This is the electroporation result of orf00404 gene from wild-type Oenococcus SD-2a;

[0021] Figure 6 This is the electrophoresis diagram of the PCR product of the orf00404 gene colony from the mutant Oenococcus oeni DEa3;

[0022] Figure 7 This is the electrophoresis diagram of the PCR product of the orf00404 gene colony derived from the wild-type Oenococcus SD-2a;

[0023] Figure 8 The growth curves of the recombinant strain and the control strain under different pH conditions; the pH values ​​of A to E are 3.2, 3.4, 3.6, 3.8, and 4.0, respectively;

[0024] Fig. 9 This is the standard curve of intracellular pH value determination;

[0025] Fig.10 The results of measuring the intracellular and extracellular pH values ​​of the recombinant strain and the control strain at different time periods;

[0026] Fig.11 The Ka value determination diagram of the recombinant strain and the control strain under acid stress treatment at different times, where different letters indicate significant differences, p < 0.05;

[0027] Fig.12 The figure shows the cell membrane permeability of the recombinant strain and the control strain under acid stress treatment at different times, where different letters indicate significant differences, p < 0.05;

[0028] Fig.13 The values ​​of cell membrane integrity of the recombinant strain and the control strain under acid stress treatment at different times, where different letters indicate significant differences, p < 0.05;

[0029] Fig.14 This is the standard curve diagram for protein content determination;

[0030] Fig.15 The graph shows the determination of intracellular protein content of the recombinant strain and the control strain under acid stress treatment at different times, where different letters indicate significant differences, p < 0.05;

[0031] Fig.16 The figure shows the determination of intracellular ATP content of the recombinant strain and the control strain under acid stress treatment at different time periods; different letters indicate significant differences, p < 0.05;

[0032] Fig.17 It is the consumption of malic acid and the production of lactic acid. DETAILED DESCRIPTION

[0033] The test materials of the present invention are as follows:

[0034] Strains: wild-type Oenococcus oeni SD-2a, mutant Oenococcus oeni DEa3, Escherichia coli Top10, plasmid pIB184, Lactobacillus plantarum WCFS1. Among them, the mutant Oenococcus oeni DEa3 was obtained by screening in our laboratory.

[0035] Reagents: AG SteadyPure plasmid DNA extraction kit, AG SteadyPure bacterial genomic DNA extraction kit, AG SteadyPure PCR reaction solution purification kit, PCR high-fidelity enzyme, AG 2000bp DNA Marker, AG5000bp DNA Marker, QuickCut EcoR I, QuickCut BamH I, seamless cloning ligation kit, erythromycin, fluorescent probe BCECF AM, HEPES-K (pH 8.0), phosphate buffer of different concentrations, formaldehyde, pyrene probe, pNPG, pI, Solarbio BCA protein concentration determination kit, Solarbio ATP content detection kit.

[0036] Instruments: clean bench (SW-CJ-2D, Suzhou Purification Equipment Co., Ltd.), autoclave (GT-180, Zhiwei (Xiamen) Instrument Co., Ltd.), PCR instrument (T100TM Thermal Cycler, Beijing Liuyi Biotechnology Co., Ltd.), electrophoresis instrument (DYY-6D, Beijing Liuyi Biotechnology Co., Ltd.), gel imager (GenoSens 1860, Shanghai Qinxiang Scientific Instrument Co., Ltd.), biochemical incubator (LRH-250-A, Shaoguan Taihong Medical Equipment Co., Ltd.), micro-spectrophotometer (MD2000D, British Biofuture Company), high-speed refrigerated centrifuge (Sorvall ST 16R, Beijing World Trade Far East Scientific Instrument Co., Ltd.), electrotransfer instrument (SCIENTZ-2C, Ningbo Xinzhi Biotechnology Co., Ltd.), UV-visible spectrophotometer (UV-5500, Shanghai Yuanxi Instrument Co., Ltd.), microplate reader (INFINITE 200PRO, TECAN), high-performance liquid chromatograph (1220Infinity LC, Agilent Technologies Inc), fluorescence spectrophotometer (F-4700, Hitachi High-Tech Naka Office, Japan).

[0037] Culture medium: LB culture medium: peptone 10g, sodium chloride 10g, yeast extract 5g, water 1000g, agar 15g, pH 7.2-7.4, sterilization conditions: 121℃, 20min. MRS culture medium: beef extract 10g, yeast extract 5g, glucose 20g, K2HPO42g, sodium acetate 5g, magnesium sulfate 0.2g, manganese sulfate 0.05g, Tween 80 1mL, ammonium citrate 2g, water 1000mL, agar 15g, pH 6.2, sterilization conditions: 115℃, 15min.

[0038] Other materials used in the present invention, if not otherwise stated, can be obtained through commercial channels. Other terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art. The present invention is further described in detail below in conjunction with specific examples and with reference to data. The following examples are only for illustrating the present invention, and are not intended to limit the scope of the present invention in any way.

[0039] In the early stage, our laboratory used directed evolution technology to obtain the mutant strain DEa3 of Oenococcus oeni SD-2a, which has significantly better growth performance under acid stress conditions than the wild type.

[0040] The preliminary directed evolution experiment is as follows:

[0041] Before the experiment, the wine osmotic bacteria SD-2a was inoculated with an inoculation loop onto an ATB medium with a pH of 4.8 for activation. The activated bacterial solution was inoculated onto an ATB medium with a pH of 3.2, and cultured at 25°C for about five generations. Then it was transferred to an ATB medium with a pH of 3.1 and cultured for another five generations. Repeat the above process until it was transferred to an ATB medium with a pH of 2.8. Then prepare for experiments to detect various indicators. After more than four months of directed evolution experiments, the strains were subjected to the stress of the acidic environment and the influence of various factors, and while they were adaptable, they might also have favorable mutations. In this experiment, an acid-resistant wine osmotic bacteria strain was obtained during the directed evolution process. Genome sequencing revealed that the gene encoding the response transcriptional regulator orf00404 in the strain had a point mutation at 331bp, and the base mutated from G to T.

[0042] The orf00404 encoding gene sequence of wild-type Oenococcus oeni SD-2a is as follows:

[0043] ATGGTAAAACCAATCATTCTTATAATCGAAGATGAGACAGCTATTGTAGCTTATTTACAGACGGAACTTAAATTTGAAGATTATATTGTTTTGACAGCTAGTGATGGCGAAATGGGCCTTTCAGTTTTTGAACAGAATTCAAACCGAATTAATGTAGTTTTGCTTGATTGGATGTTGCCAAAACGAGATGGGCTCGAAGTTTTACGGCGCATTAGAAAATTAAATAGTCAGGTTTCTATAATTCTTATGACCGCTAAAAGTGATATTGGCGATAAAGTAGCTGCATTAGATTCTGGTGCAGATGACTATATTACGAAGCCTTTTGAAATT G AAGAACTTTTAGCACGTTTAAGAGTGACGATTCGTCATCAAAATAAGCCACGCCCAAAACTATATCAGGTATCTAACTTAGTGCTGGATTTAGACGCACACCGTGTTACAAGGGATGGACAGGTTATTGATTTAACGCAAAGAGAGTTCCAACTTTTAACATATTTAATTGAAAATGCAGGCAAAACGCTTACTCGCGATGATTTACTTGATAATGTTTGGGGAGTTGATTTTAACGGTCAATATAATACAGCTGATGTTTATATACGCTATCTTCGTCAAAAGATAGATGATCATTTTTATCCGAAGCTTATTCATACGGTTCGTAGTGTTGGATATGTCTTAAGGGCAAAATAA(SEQ ID NO:1)

[0044] The coding gene sequence of orf00404 of mutant Oenococcus oeni DEa3 is as follows:

[0045] ATGGTAAAACCAATCATTCTTATAATCGAAGATGAGACAGCTATTGTAGCTTATTTACAGACGGAACTTAAATTTGAAGATTATATTGTTTTGACAGCTAGTGATGGCGAAATGGGCCTTTCAGTTTTTTGAACAGAATTCAAACCGAATTAATGTAGTTTTGCTT GATTGGATGTTGCCAAAACGAGATGGGCTCGAAGTTTTACGGCGCATTAGAAAATTAAATAGTCAGGTTTCTATAATTCTTATGACCGCTAAAAGTGATATTGGCGATAAAGTAGCTGCATTAGATTCTGGTGCAGATGACTATATTACGAAGCCTTTTGAAATT T AAGAACTTTTAGCACGTTTAAGAGTGACGATTCGTCATCAAAATAAGCCACGCCCAAAACTATATCAGGTATCTAACTTAGTGCTGGATTTAGACGCACACCGTGTTACAAGGGATGGACAGGTTATTGATTTAACGCAAAGAGAGTTCCAACTTTTAACATATTTAATTGAAAATGCA GGCAAAACGCTTACTCGCGATGATTTACTTGATAATGTTTGGGGAGTTGATTTTAACGGTCAATAATACAGCTGATGTTTATATACGCTATCTTCGTCAAAAGATAGATGATCATTTTTATCCGAAGCTTATTCATACGGTTCGTAGTGTTGGATATGTCTTAAGGGCAAAATA(SEQ ID NO:2)

[0046] Because the genetic transformation system of Oenococcus oeni is not mature enough, our laboratory used recombinant plasmids and transformation technology to obtain the recombinant Lactobacillus plantarum WCFS1 strain containing the orf00404 encoding gene from the wild-type strain SD-2a and mutant strain DEa3 of Oenococcus oeni, as well as a control strain containing an empty vector. By measuring the cell membrane fluidity, cell membrane integrity, cell membrane permeability, intracellular pH and other indicators of the recombinant strains and the control strains under stress conditions, we determined the pathway by which the orf00404 encoding gene exerted its function, laying the foundation for the final elucidation of the function of the orf00404 encoding gene in Oenococcus oeni SD-2a.

[0047] Functional verification of orf00404 coding gene, specific experiments are as follows:

[0048] 1. Construction of recombinant plasmid

[0049] (1) Genome extraction and primer synthesis

[0050] Take a small amount of Oenococcus SD-2a and DEa3 bacterial liquid, streak it on the FT80 solid plate, and culture it at 30℃. After the colonies grow, pick a single colony to expand the culture, and then extract the genomic DNA. The orf00404 primer and transformant verification primer sequence are shown in Table 1:

[0051] Table 1

[0052]

[0053] Note: The bold italic sequence is the homology arm sequence of the pIB184 plasmid, used for seamless cloning

[0054] (2) PCR amplification of target gene

[0055] PCR amplification was performed using SD-2a and DEa3 genomic DNA as templates, respectively. The PCR reaction system was as follows: template 1 μL, forward primer 1 μL, reverse primer 1 μL, high-fidelity enzyme 12.5 μL, ddH2O 9.5 μL, and PCR amplification reaction conditions were as follows: pre-denaturation (94°C, 30 s, 1 cycle), denaturation (98°C, 10 s, 34 cycles), annealing (57°C, 30 s, 34 cycles), extension (72°C, 1 min, 34 cycles), and final extension (72°C, 2 min, 1 cycle). The PCR products were subjected to agarose gel electrophoresis to compare whether the amplified fragments met the designed length.

[0056] The electrophoresis results are as follows Figure 1 As shown: The electrophoresis bands are clear, single and of the correct size, so the PCR amplification product can be used for subsequent experiments.

[0057] (3) Purification of target gene fragments

[0058] Purify the amplified fragment of the correct size according to the instructions of the purification kit.

[0059] (4) Extraction of pIB184 plasmid

[0060] The bacterial liquid of E. coli Top10 (containing pIB184 plasmid) was streaked onto an LB plate containing erythromycin (final concentration 100 μg / mL) to extract the plasmid.

[0061] (5) pIB184 double restriction digestion

[0062] The pIB184 plasmid was double-digested with EcoR I and BamH I to obtain a linearized vector. The method was referred to the instructions of EcoR I and BamH I. The digestion product was purified, and the concentration was determined and frozen at -35°C.

[0063] (6) Construction of recombinant plasmid

[0064] The recombinant plasmid construction process map is as follows Figure 2 As shown. Incubate at 37℃ for 30min using a PCR instrument, and finally lower the temperature to 4℃ to complete seamless cloning. The recombination reaction system is as follows: linearized vector XμL, insert fragment YμL, 5×CEⅡBuffer 4μL, ExnaseⅡ2μL, ddH2O added to 20μL. The optimal amount of cloning fragments used is added according to the Vazyme instruction manual.

[0065] The double enzyme digestion product verification results are as follows Figure 3 As shown: the electrophoresis band is clear and single, and the length of the enzyme digestion product is larger than the original pIB184 plasmid. After purification, the concentration is measured to be 102.0251ng / μL and there are few protein and RNA residues in the product. Therefore, this linear vector can be used for subsequent recombination experiments.

[0066] (7) Preparation of E. coli Top10 competent cells

[0067] For details on the preparation of E. coli Top10 competent cells, please refer to the reference: Liu Lu, et al. Construction of enhanced green fluorescent protein reporter system in Lactococcus lactis NZ9000[J]. Food and Fermentation Industries, 2020, 46(11): 46-5.

[0068] 2. Transformation of recombinant products

[0069] For details on the transformation method of the recombinant product, please refer to the Vazyme instruction manual.

[0070] 3. Verify transformants

[0071] Pick a single colony as a template and add the reaction solution according to the following system. The PCR reaction system: template 1μL, pIB184-BDYZ-F 1μL, pIB184-BDYZ-R 1μL, 2X Accurate Taq Master Mix 12.5μL, ddH2O added to 25μL. Perform colony PCR according to the following procedures. The PCR reaction procedure: pre-denaturation (94℃, 30s, 1 cycle), denaturation (98℃, 10s, 34 cycles), annealing (57℃, 30s, 34 cycles), extension (72℃, 1min, 34 cycles), final extension (72℃, 2min, 1 cycle). After the PCR reaction program is completed, take 2μL of the PCR product for 1% agarose gel electrophoresis, the electrophoresis voltage is 100V, and the electrophoresis time is 30min. After the electrophoresis, the band size is observed by ultraviolet perspective using a gel imager. The plasmid is extracted and sequenced from the transformant with the correct sequence length alignment. Finally, freeze the plasmid with the correct gene sequence.

[0072] The results of the recombination transformation verification are as follows Figure 4 As shown: the bands are clear and single. The size of the electrophoresis bands is compared according to the length of the target gene. The size of the bands detected in lanes 2, 3, 4, 5, 7, 8, 9, and 10 is consistent with the length of the target bands, and the corresponding colonies are the colonies that have successfully been transformed with the recombinant plasmid.

[0073] The correct transformants verified by electrophoresis were cultured and preserved, and the plasmids were extracted after activation and transfer and sent to the company for sequencing. After sequencing, the gene sequences were compared and the correct transformants were determined as the subsequent experimental materials.

[0074] 4. Transfer of recombinant plasmid into Lactobacillus plantarum WCFS1

[0075] The successfully constructed recombinant plasmid and pIB184 plasmid were electroporated into Lactobacillus plantarum WCFS1 competent cells respectively. The electroporation method was referred to the following literature: Teresa AM, Carmen RM, Mesas JM. Transformation of Lactobacillus plantarum by electroporation with in vitro modified plasmid DNA [J]. Fems Microbiology Letters, 2010, 241 (1): 73-77. The cells were then cultured on FT80 solid medium.

[0076] The results of the culture after electroporation are as follows Figure 5 Shown: The single colony on the plate conforms to the colony morphology of Lactobacillus plantarum.

[0077] 5. Verify transformants

[0078] The method for transformant verification is the same as step 3 above: "Verification of transformants". Pick a single colony for colony PCR experiment, and detect the colony PCR product by 1% agarose gel electrophoresis.

[0079] The electrophoresis results are as follows Figure 6 and Figure 7 As shown:

[0080] The electrophoresis bands are clear and bright, without double peaks or tailing, and the band length is consistent with the length of the target gene. The cultured transformants can be used for subsequent experiments. After the cultured transformant bacterial liquid grows to a turbid state, it is stored in a glycerol tube at -35℃.

[0081] 6. Recombination tolerance test

[0082] (1) Acid stress tolerance experiment

[0083] WCFS1(pIB184), WCFS1(pIB184-wild), and WCFS1(pIB184-mutant) strains were activated and inoculated into MRS medium with pH values ​​of 3.2, 3.4, 3.6, 3.8, and 4.0 at 1% concentration, and OD values ​​were measured every 12 h at 37 °C. 600nm The value was obtained and the growth curve was drawn. The effect of orf00404 gene on acid stress tolerance of Lactobacillus plantarum was analyzed, and the culture conditions with the greatest difference in growth between the recombinant strain and the control strain were selected. The conditions for measuring physical and chemical indicators can be found in the following literature: Zhao Wenying, Li Hua, Wang Hua. Effects of ethanol stress treatment on physiological characteristics of Oenococcus SD-2a [J]. Bulletin of Microbiology, 2011, 38(01): 51-56.

[0084] The growth curves of the strains under different acid stress conditions are shown in Figure 8 As shown:

[0085] In five acid stress environments with different pH values, the growth rate of the recombinant strain was significantly faster than that of the control strain. Under pH 3.2 and pH 3.4 conditions, the biomass of the recombinant strain in the logarithmic growth phase and the stable growth phase was significantly higher than that of the control strain, and the growth of the recombinant strain WCFS1(pIB184-mutant) was slightly faster than that of WCFS1(pIB184-wild), indicating that under pH 3.2 and pH 3.4 conditions, the recombinant strain had stronger acid stress resistance than the control strain, and the acid stress resistance of the recombinant strain WCFS1(pIB184-mutant) was better than that of the recombinant strain WCFS1(pIB184-wild). Under the conditions of pH 3.6, pH 3.8, and pH 4.0, the biomass of the recombinant strain and the control strain were significantly higher than those under the acid stress conditions of pH 3.2 and pH 3.4, and the growth rate of the recombinant strain in the logarithmic growth period was significantly faster than that of the control strain. After entering the stable period, due to factors such as the limitation of the nutrient conditions of the culture medium, the biomass of the control strain gradually approached that of the recombinant strain or had no significant difference with the control strain. The growth curve measurement results showed that the growth performance of the recombinant strain under acid stress conditions was better than that of the control strain.

[0086] (2) Determination of physical and chemical properties

[0087] a. Intracellular pH

[0088] As a basic parameter of the internal environment of the cell, the intracellular pH plays an important role in maintaining various enzymatic reactions in the cell. The stability of the intracellular pH and the extracellular pH is also an important mechanism for Lactobacillus plantarum to resist acid stress. The determination of the pH standard curve and the determination and calculation of the intracellular pH of the sample group refer to the following literature: Zhang Mengru. Effects of DNA repair protein RecO and leucine metabolism on the resistance of lactic acid bacteria to multiple stresses [D]. Jiangnan University, 2014.

[0089] The standard curve of intracellular pH was drawn using Lactobacillus plantarum WCFS1 containing an empty vector, such as Fig. 9 As shown, the square value of R is 0.9943, which shows that the standard curve has a good linear relationship and can be used for the subsequent determination of intracellular pH values ​​of recombinant strains and control strains.

[0090] The results of intracellular pH values ​​of the recombinant strain and the control strain at different time periods are shown in Fig.10As shown in the figure, after acid stress treatment, the intracellular pH of the recombinant strain and the control strain decreased after experiencing fluctuations. The intracellular pH of the recombinant strain WCFS1 (pIB184-mutant) was stable at 6.62, the intracellular pH of the recombinant strain WCFS1 (pIB184-wild) was stable at 6.47, and the intracellular pH of the control strain was stable at 6.42. By comparison, there was no significant difference in the intracellular pH value of the recombinant strain and the control strain after 108h of acid stress treatment, but the decrease in the intracellular pH of the recombinant strain after 108h of acid stress treatment (compared to 0h) was lower than that of the control strain. After acid stress treatment, the extracellular pH of the recombinant strain and the control strain gradually decreased, the extracellular pH of the recombinant strain WCFS1 (pIB184-mutant) dropped to 3.58, the extracellular pH of the recombinant strain WCFS1 (pIB184-wild) dropped to 3.65, and the control strain dropped to 3.79. Different from the intracellular pH, the decrease in the extracellular pH of the recombinant strains was greater than that of the control strains. Figure 8 The experimental results show that when the decrease in extracellular pH is higher than that of the control group, the growth of the recombinant strain is better than that of the control strain, which indicates that the acid resistance of the recombinant strain is better than that of the control strain.

[0091] b. Cell membrane fluidity

[0092] The cell membrane is the first barrier for bacteria to resist the external stress environment of the cell. Acid stress culture will cause the cell membrane to harden. After the strains were treated with acid stress for different time periods, pyrene was used as a cell membrane probe. The measured fluorescence intensity ratio Ka was used to indicate the fluidity of the bacterial cell membrane. The larger the ratio, the worse the fluidity. The bacterial concentration was adjusted to OD 600nm =0.6 (the bacterial collection time is the same as step a above), the cell membrane fluidity refers to the following literature: Wu Zhongde. Analysis of the physiological mechanism of Lactobacillus casei in resisting acid stress [D]. Jiangnan University, 2012.

[0093] The results of cell membrane fluidity of recombinant strains and control strains are as follows Fig.11 As shown in the figure, after 60h of acid stress treatment, the Ka values ​​of the recombinant strain and the control strain increased significantly compared with 0h, indicating that at this stage, the cell membrane hardened and the cell membrane fluidity decreased in order to resist the external acidic environment. The Ka values ​​measured at 72h of acid stress treatment decreased significantly compared with 60h, while the Ka values ​​of each strain increased significantly after 108h of acid stress culture. The Ka values ​​of the recombinant strain at 72h and 108h of acid stress treatment were lower than those of the control strain, indicating that the cell membrane fluidity of the recombinant strain at these two time points was better than that of the control strain, and the cell membrane fluidity of the recombinant strain WCFS1 (pIB184-wild) was better than that of the recombinant strain WCFS1 (pIB184-mutant) at 72h and 108h of acid stress treatment (P < 0.05).

[0094] c. Cell membrane permeability

[0095] Lactobacillus plantarum cells also contain β-D-galactosidase, which will penetrate into the extracellular space when the permeability of the intracellular membrane increases to a certain level. The substrate of β-D-galactosidase is pNPG, which has an absorption peak at a wavelength of 420nm. Therefore, the absorbance value of the treated cells at 420nm can be used to indicate the change in the permeability of the intracellular membrane.

[0096] The bacterial cells were collected by centrifugation (3000 rpm, 15 min), resuspended in 10 mmol / L phosphate buffer (pH 7.4) and adjusted to OD 600nm The concentration of 5 μL pNPG was 1 (the bacterial collection time was the same as in step a above), 10 μL of 5 mmol / L pNPG was added, and the mixture was placed at 37°C for treatment. After 2 h, the reading was taken at 420 nm.

[0097] The test results are as follows Fig.12 As shown:

[0098] After 60h of acid stress treatment, the permeability of the cell membrane decreased significantly; after a period of adaptation to acid stress, the tolerance of each strain was enhanced, and the permeability of the cell membrane increased significantly at 72h. As the acid stress treatment time increased, the permeability of the cell membrane decreased significantly at 108h. The permeability of the cell membrane of the recombinant strain was higher than that of the control strain at 60h and 72h of acid stress treatment.

[0099] d. Cell membrane integrity

[0100] Acid stress treatment will affect the cell membrane integrity of the strain. The PI probe will only stain cells with damaged cell membranes. The larger the fluorescence value measured, the worse the cell membrane integrity. Collect bacterial cells by centrifugation (the time for bacterial collection is the same as step a above). The cell membrane integrity determination of the sample group refers to the following literature: da Silveira M, Vitória San M,Loureiro-Dias Maria C,Rombouts Frans M,Abee T.Flow cytometric assessment of membrane integrity of ethanol-stressed Oenococcus oeni cells[J].Applied and environmental microbiology,2002,68:6087-6093.

[0101] The test results are as follows Fig.13 As shown:

[0102] There was no significant difference in the cell membrane integrity between the recombinant strain and the control strain at 0h without acid stress (P>0.05); after 60h of acid stress, the cell membrane integrity of the recombinant strain and the control strain dropped to the lowest level, and the cell membrane integrity of each strain gradually recovered as the acid stress treatment time prolonged. At 60h and 72h of acid stress treatment, the cell membrane integrity of the recombinant strain was better than that of the control strain. However, at 108h of stress treatment, the cell membrane integrity of the recombinant strain WCFS1 (pIB184-mutant) was lower than that of the other two strains (P<0.05).

[0103] e. Determination of intracellular protein concentration

[0104] The intracellular protein concentration of the strain is mainly used to assist in the expression of intracellular ATP content. After collecting the bacteria by low-temperature centrifugation, wash the bacteria with PBS (pH 7.0) and resuspend (the bacteria collection time is the same as step a above), ultrasonically disrupt the bacterial cells, and take the supernatant. Ultrasonic conditions: 40% power, 20min, working 5s, rest 5s. The determination method is carried out according to the steps in the instructions of the Solarbio BCA protein concentration determination kit.

[0105] The results of intracellular protein content calibration curve are as follows Fig.14 As shown, the square value of R is 0.99937, indicating that the standard curve has a good linear relationship and can be used for subsequent experiments.

[0106] Results of intracellular protein content of recombinant strains and control strains Fig.15 As shown in the results, the intracellular protein content of the recombinant strain and the control strain was maintained at a high level when not treated with acid stress, and there was no significant difference between the recombinant strain WCFS1 (pIB184-mutant) and the control strain (P>0.05); at 60h after acid stress treatment, the control strain did not undergo obvious up- and down regulation, but the intracellular protein content of the recombinant strain WCFS1 (pIB184-mutant) increased significantly, and the intracellular protein content of the recombinant strain WCFS1 (pIB184-wild) decreased significantly. After 72h of acid stress treatment, the intracellular protein content of both the recombinant strain and the control strain decreased significantly. At 108h of acid stress, the intracellular protein content of both the recombinant strain and the control strain increased compared with that at 72h. During the three time periods of acid stress treatment, there were significant differences in protein content between the recombinant strain and the control strain (P < 0.05). At the same time, in the later stage of acid stress treatment (72h and 108h), the intracellular protein content of the recombinant strain was significantly higher than that of the control strain (P < 0.05).

[0107] f. Determination of intracellular ATP content

[0108] Under acid stress, the protons in the cells will gradually be consumed and discharged, and a proton gradient-driven transmembrane electromotive force will gradually form inside and outside the cell membrane of the strain, which is used to drive the ATPase on the cell membrane of the strain to synthesize ATP, providing the strain cells with the energy necessary for survival.

[0109] The cells were disrupted by ultrasound. The bacterial collection time was the same as in step a above, the disruption conditions were the same as in step e above, and the determination method was referred to the instructions of the Solarbio ATP content detection kit.

[0110] The test results are as follows Fig.16 As shown:

[0111] The intracellular ATP of the recombinant strain and the control strain was at a high level before acid stress treatment, but there was no significant difference between the recombinant strain WCFS1 (pIB184-wild) and the control strain. After 60 hours of acid stress treatment, the intracellular ATP content of the recombinant strain and the control strain decreased significantly. After acid stress treatment, the intracellular ATP content of the two recombinant strains and the control strain showed significant differences (P < 0.05). At the same time, at this stage, the amount of reduction in the intracellular ATP content of the control strain was significantly higher than that of the two recombinant strains. As the strains adapted to the acid stress treatment, the intracellular ATP content of each strain gradually recovered or increased. Under acid stress treatment, the intracellular ATP content of the recombinant strains was significantly higher than that of the control strain (P < 0.05), and the intracellular ATP content of the recombinant strain WCFS1 (pIB184-mutant) was significantly higher than that of the recombinant strain WCFS1 (pIB184-wild) (P < 0.05). This shows that the intracellular ATP synthesis ability of the recombinant strain under acid stress conditions is stronger than that of the control strain.

[0112] g. Determination of malic acid consumption and lactic acid production

[0113] At 0 h, 60 h, 72 h, and 108 h, 2 mL of the bacterial solution was centrifuged at 12000 r / min for 2 min at 4 °C, and the supernatant was taken and the contents of malic acid and lactic acid were detected by HPLC.

[0114] The HPLC conditions were referred to the following literature: Mo Runming, et al. Analysis of changes in characteristic organic acids during the aging process of Chenxiang Tieguanyin [J]. Food Research and Development, 2021, 42(20): 21-27. The method was slightly adjusted: the aqueous phase was changed to 99% ultrapure water (pH 2.5, pH adjusted with perchloric acid), and the column temperature was set to 55°C.

[0115] The test results are as follows Fig.17 As shown:

[0116] As the acid stress time continued to increase, the malic acid content in the culture medium of the recombinant strain and the control strain showed a decreasing trend. According to the comparison of the malic acid content of the culture medium of each strain at 0h, 60h, 72h, and 108h, it can be seen that the recombinant strains WCFS1 (pIB184-wild) and WCFS1 (pIB184-mutant) have higher malic acid degradation capabilities than the control strain. At 108h, the malic acid content of the recombinant strains was 42.358% and 86.145% of that of the control strain, respectively. Correspondingly, the change pattern of the lactic acid content in the culture medium of the recombinant strain and the control strain is opposite to that of malic acid. As the culture time increases, the lactic acid content in the culture medium gradually increases. At 108h, the lactic acid content in the culture medium of the recombinant strain is significantly higher than that of the control strain. The above data show that the malic acid and lactic acid fermentation activity of the recombinant strain under acid stress conditions is significantly stronger than that of the control strain.

[0117] In summary, according to the results of the acid stress tolerance test of the above recombinant strains and the control strains, the growth performance of the recombinant strains under acid stress conditions was better than that of the control strains, which indicated that heterologous expression of the transcriptional regulatory factor orf00404 gene could improve the acid stress tolerance of Lactobacillus plantarum. It also indicated that the orf00404 gene could regulate the acid resistance of the strain.

[0118] Oenococcus oeni is one of the bacteria that initiates the malolactic fermentation process of wine. Malic acid degradation ability and lactic acid production are key indicators for evaluating the fermentation performance of Oenococcus oeni. The functional development of the orf00404 gene is conducive to improving the fermentation performance of Oenococcus oeni in malolactic fermentation of wine, thereby further improving the quality of wine, and has important application prospects.

[0119] The above is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention without departing from the technical solution of the present invention still belongs to the protection scope of the technical solution of the present invention.

Claims

1. A mutant of orf00404 gene, characterized in that: The nucleic acid sequence of the mutant gene is shown in SEQ ID NO:2; the nucleic acid sequence of the orf00404 gene is shown in SEQ ID NO:

1.

2. A recombinant expression vector, expression cassette, transgenic cell line, recombinant bacteria or recombinant virus containing the mutant gene of claim 1.

3. Application of orf00404 gene or its mutant in improving the acid resistance of Lactobacillus plantarum; The nucleic acid sequence of the orf00404 gene is shown in SEQ ID NO:1, and the nucleic acid sequence of the orf00404 gene mutant is shown in SEQ ID NO:

2.

4. A method for improving the acid resistance of Lactobacillus plantarum, characterized in that: The orf00404 gene or its mutant is constructed into an expression vector to form a recombinant expression vector, and then the recombinant expression vector is transformed into Lactobacillus plantarum to obtain a recombinant strain containing the orf00404 gene or its mutant, and finally the acid resistance of Lactobacillus plantarum is improved by expressing the orf00404 gene or its mutant; The nucleic acid sequence of the orf00404 gene is shown in SEQ ID NO:1, and the nucleic acid sequence of the orf00404 gene mutant is shown in SEQ ID NO:

2.

5. The method according to claim 4, characterized in that The expression vector is selected from Escherichia coli pIB184 plasmid.

Images