Application of PACSIN2 in promoting activation of the STING signaling pathway
By overexpressing PACSIN2 protein or its mRNA in tumor cells, the problems of systemic side effects caused by STING agonists and the suppression of innate immune responses in the tumor microenvironment were solved, the activation of the STING signaling pathway and the enhancement of type I interferon were achieved, and the effect of tumor immunotherapy was promoted.
Patent Information
- Application Number
- CN202410034253.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-10
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2044-01-10
AI Technical Summary
Existing STING agonists cause serious systemic immune side effects in tumor treatment, and the innate immune response in the tumor microenvironment is suppressed, resulting in low release of type I interferon and difficulty in effectively activating the STING signaling pathway.
By overexpressing PACSIN2 protein or its mRNA, the activation of the STING signaling pathway is promoted, the responsiveness of type I interferon in immune cells is enhanced, and the positive regulatory effect of PACSIN2 is utilized to promote the transport and activation of STING.
It significantly improves the responsiveness of STING agonists, activates type I interferon signaling, achieves the "cold-hot" conversion of tumor cells, and provides an effective solution for tumor immunotherapy.
Smart Images

Figure CN118001402B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine and relates to the application of PACSIN2 in promoting the activation of the STING signaling pathway. Background Art
[0002] Based on the fundamental mechanism that a dsDNA-cGAS-STING-mediated type I interferon-innate immune response can activate a tumor immune-inflammatory "hot" tumor phenotype, current research focuses on using direct STING agonists to activate type I interferon expression. Since Aduro Biotech first demonstrated that intratumoral injection of STING agonists can trigger innate and adaptive immunity to produce anti-tumor immune memory, several STING agonists or combination regimens have been marketed, and dozens of preclinical and clinical programs are currently underway worldwide, making related research a continuing hot topic. However, due to the systemic distribution of immune cells, the use of direct STING agonists can trigger fatal systemic immune side effects, severely restricting their clinical application. Currently, most studies on the in vivo effects of STING agonists have to use intratumoral injection or further development of targeted drug delivery formulations.
[0003] To overcome this drawback, the use of chemotherapy and radiotherapy to damage tumor cell DNA and activate the dsDNA-cGAS-STING-mediated type I interferon response to "heat" the tumor has become another important solution. Combining immunotherapy with chemotherapy and radiotherapy has therefore gained attention. For example, for tumors unresponsive to immune checkpoint blockade, such as lung cancer, malignant renal cell carcinoma, and breast cancer, clinical trials have further combined chemotherapy and / or targeted therapies to induce the release of tumor dsDNA and activate the STING signaling pathway to release type I interferons. Unfortunately, while some studies have achieved some success, the innate immune response in most tumor microenvironments is silenced. Even when chemotherapy and radiotherapy promote the accumulation of large amounts of cGAMP, type I interferon release remains low, indicating that it is hampered by inhibitory factors. Analyzing these inhibitory factors and developing corresponding drugs has therefore become a key focus in this field. Three major inhibitors have been identified: upstream of STING, TREX1 has been found to reduce cGAS tumor detection by degrading tumor-derived DNA, while ENPP1 has been found to degrade cGAMP, thereby reducing STING activation. During STING activation, poly (ADP-ribose) polymerase 7 (PARP7) can inhibit type I interferon expression by inhibiting TBK1 activation, and its inhibitor RBN-2397 has shown promising potential. However, these studies are still in the preclinical exploratory stage.
[0004] STING-mediated activation of the type I interferon signaling pathway is the core mechanism by which radiotherapy triggers the innate immune response in tumors. Therefore, understanding the inhibitory factors underlying activation of the STING-TBK1-IRF3 signaling pathway is crucial for elucidating immune escape mechanisms. Therefore, identifying stress-inhibiting factors in immune cells and restrictive inhibitory factors in tumor cells, and designing targeted intervention strategies that are both rational and adaptable, are key to stabilizing the immune response after radiotherapy and meet the inherent needs of oncology drug development.
[0005] PACSIN2 (Protein kinase C and casein kinase substrate in neurons protein 2) was first discovered in neurons. As a common substrate protein for protein kinase C and tyrosine kinase, it regulates the formation and endocytosis of neural pits. It also binds lipids to promote the formation of tubular phospholipid membranes, thereby playing a role in vesicle transport. In recent years, regulators of the STING pathway have been increasingly identified, but the relationship between PACSIN2 and the STING pathway, or its association with the activation of tumor-innate immune pathways after radiotherapy, has remained largely unreported. Summary of the Invention
[0006] The present invention aims to address the problems existing in the prior art by providing a factor, PACSIN2, that plays a key role in the STING signaling pathway and its agonists. Overexpression of PACSIN2 significantly activates the STING signaling pathway, enhances the response to STING agonists, and improves the response to type I interferon signaling in immune cells, providing an important scientific basis for achieving the "cold-to-hot" transition of tumor cells.
[0007] In order to solve the above technical problems, the present invention is achieved through the following technical solutions.
[0008] A first aspect of the present invention provides use of PACSIN2 in preparing a product that promotes activation of the STING signaling pathway.
[0009] Preferably, the STING signaling pathway includes one or more of STING, TBK1, and IRF3.
[0010] A second aspect of the present invention provides the use of PACSIN2 in the preparation of a product for increasing the sensitivity of STING agonists to cancer treatment.
[0011] Preferably, the STING agonist is selected from one or more of Vadimezan (CAS: 117570-53-3), Mangostin (CAS: 6147-11-1), SR-717 (CAS: 2375421-09-1), and MSA-2 (CAS: 129425-81-6).
[0012] Preferably, the cancer is selected from one or more of liver cancer, kidney cancer, lung cancer, colorectal cancer, breast cancer, pancreatic cancer, thyroid cancer, and lymphoma.
[0013] The third aspect of the present invention provides the use of PACSIN2 in preparing a product for promoting the release of type I interferon.
[0014] Preferably, the type I interferon is selected from one or more of INFα, INFβ, and INFκ.
[0015] A fourth aspect of the present invention provides a use of a PACSIN2 active agent in promoting activation of the STING signaling pathway, wherein the PACSIN2 active agent includes but is not limited to one or more of a PACSIN2 protein and an mRNA that promotes overexpression of PACSIN2.
[0016] Preferably, the STING signaling pathway includes one or more of STING, TBK1, and IRF3.
[0017] In a fifth aspect, the present invention provides a pharmaceutical composition for promoting activation of the STING signaling pathway, comprising a PACSIN2 active agent, wherein the PACSIN2 active agent includes but is not limited to one or more of a PACSIN2 protein and an mRNA that promotes overexpression of PACSIN2.
[0018] Preferably, the STING signaling pathway includes one or more of STING, TBK1, and IRF3.
[0019] A sixth aspect of the present invention provides the use of PACSIN2 in preparing a product that enhances the activation effect of a STING agonist.
[0020] Preferably, the activation effect is an activation effect on type I interferon.
[0021] Preferably, the type I interferon is selected from one or more of INFα, INFβ, and INFκ.
[0022] It should be understood that, unless otherwise specified, in the context of the present invention, the PACSIN2 active agent refers to a substance that can specifically upregulate the expression level of PACSIN2 and / or the transcription level of its mature mRNA and / or the expression level or activity of PACSIN2 protein, such as PACSIN2 protein, mRNA preparation, vaccine, etc., as long as it can achieve an increase in the level and / or activity of PACSIN2.
[0023] Extensive research has revealed that knocking out PACSIN2 significantly reduces cellular responsiveness to STING agonists. Furthermore, overexpressing PACSIN2 significantly enhances cellular responsiveness to STING agonists. This demonstrates that PACSIN2 is a key factor in enhancing the response to STING agonists and, in turn, type I interferon signaling in immune cells. To clarify the role of PACSIN2, researchers examined both upstream and downstream components of the dsDNA-cGAS-STING-TBK1-IRF3 pathway. Using L929 cells as a model cell model, they found that knocking out PACSIN2 significantly downregulated STING / TBK1 and IRF3 phosphorylation levels triggered by STING agonists and slowed their activation, particularly STING and IRF3 phosphorylation. These results suggest that PACSIN2 can activate the STING pathway in immune cells. Through image analysis of the STING transport process and localization, it was further clarified that when PACSIN2 is knocked out, the transport of STING to the endoplasmic reticulum-Golgi intermediate island region (ERGIC) can be significantly inhibited. This shows that the transport process of STING is positively regulated by PACSIN2, and that PACSIN2 can act as an effector protein to promote the transport of STING, thereby achieving positive regulation of the STING pathway. Accordingly, PACSIN2 protein can be directly administered to humans or tumors or prepared into mRNA preparations, vaccines, etc. to activate the intracellular STIN G signaling pathway and activate the activation effect of STING agonists on type I interferon, thereby greatly improving the effect of tumor immunotherapy.
[0024] Compared with the prior art, the present invention has the following technical effects:
[0025] The present invention fully confirms that PACSIN2 can effectively promote the activation of the innate immune network mediated by type I interferon, especially participate in STING transport and promote the activation of the STING-mediated type I interferon pathway; at the effector level, it is confirmed that overexpressing PACSIN2 in the immune cell system by exogenous means can significantly enhance the response of the STING signaling pathway, providing an effective solution for improving the therapeutic effect of diseases in scenarios requiring innate immune activation. The revelation of this innovative mechanism for achieving sustained activation of the innate immune response in the tumor microenvironment and the implementation of a targeted strategy will reverse the dilemma of difficult activation of innate immune signals in tumor cells, and provide an important scientific basis for achieving the self-"cold-hot" conversion of tumor cells. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 Validation of PACSIN2 knockout in immune model cells L929.
[0027] Figure 2 The difference in type I interferon expression activated by STING agonists before and after PACSIN2 knockout in L929 cells.
[0028] Figure 3 Verification of overexpression of PACSIN2 in immune model cells L929.
[0029] Figure 4 The difference in the expression of type I interferon activated by STING agonist before and after overexpression of PACSIN2 in L929 cells.
[0030] Figure 5 The difference in the activation of the STING-TBK1-IRF3 pathway by STING agonists before and after PACSIN2 knockout in L929 cells.
[0031] Figure 6 The difference in the effects of STING agonists on STING localization before and after PACSIN2 knockout in L929 cells. DETAILED DESCRIPTION
[0032] In order to make the purpose, technical solution and effect of the present invention clearer and more specific, the present invention is further described in detail with reference to the following examples. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.
[0033] Unless otherwise specified, the cell lines listed in the present invention, including L929, were cultured according to existing techniques. All cell lines were identified by short tandem repeat analysis at the China Center for Type Culture Collection (Wuhan) and verified for mycoplasma contamination using a PCR detection kit (Shanghai Biothrive Sci). They were then frozen in liquid nitrogen and used for subsequent experiments. The reagents used in the present invention were all commercially available. To facilitate the demonstration of the technical solutions and concepts of the present invention, experiments involving STING agonists in the present invention were conducted using MSA-2. Those skilled in the art will recognize that other components with STING agonist activity have the same or similar effects and have been specifically verified using methods described in the art or in the present invention. The enumeration and selection of STING in the present invention do not constitute a limitation of the present invention. Informed consent was obtained from patients for the use of clinical specimens, and the relevant procedures and methods complied with medical ethics requirements and Good Clinical Practice guidelines for pharmaceutical clinical trials. The experimental methods used in the present invention, such as DNA extraction, whole genome sequencing, primer design, Western blot, and cell experiments, are conventional methods and techniques in the art. The primer sequences that may be used in the context of the present invention are shown in Table 1 below:
[0034] Table 1
[0035] name sequence SEQ ID NO sgPACSIN2 atacccagccaactatgtcg 1 Human-IFN-β1-F agtaggcgacactgttcgtg 2 Human-IFN-β1-R agcctcccattcaattgcca 3 Mouse-IFN-β1-F ggtggaatgagactattgttg 4 Mouse-IFN-β1-R aagtggagagcagttgag 5
[0036] Representative results from replicate experiments are presented in the accompanying figures. Data are presented as mean ± SD and mean ± SEM as indicated in the figures. All in vitro experiments were repeated at least three times. Data were analyzed using GraphPad Prism 8.0 or SPSS 22.0 software. Differences in mean values between two or more groups were compared using standard medical statistical methods, such as t-tests, chi-square tests, and analysis of variance. A p < 0.05 was considered significant.
[0037] Example 1
[0038] First, construct and verify the PACSIN2 knockout L929 stable cells. The specific steps are as follows:
[0039] (1) The KOD-Plus-Neo kit of TOYOBO was used to amplify the DNA fragment according to the system shown in Table 2 for the sequence of PACSIN2. The PCR reaction procedure was as follows: pre-denaturation (94°C, 2 min), denaturation (94°C, 15 s), annealing (Tm, 30 s), extension (68°C, 1 kb / 30 s), terminal extension (68°C, 10 min), and end (4°C) (the sgRNA sequence designed for PACSIN2 is shown in SEQ ID NO: 1, which is atacccagccaactatgtcg).
[0040] Table 2 PCR reaction system
[0041] Components Dosage (μL) 10×PCR buffer 5 2mM dNTPs 5 <![CDATA[25mM MgSO4]]> 3 10 μM upstream primer 1.5 10 μM downstream primer 1.5 KOD-Plus-Neo 1 template x <![CDATA[ddH2O]]> 33-x
[0042] (2) After agarose gel electrophoresis, DNA was extracted using a gel recovery kit (Omega); the obtained single-stranded DNA was dissolved in double-distilled water to a concentration of 10 μM, mixed according to the annealing reaction system shown in Table 3, heated in a 95°C water bath for 5 min, closed the water bath, and naturally cooled to room temperature.
[0043] Table 3 Annealing reaction system
[0044] Components Dosage (μL) Upstream nucleic acid (10 μM) 1 Downstream nucleic acid (10 μM) 1 <![CDATA[ddH2O]]> 8 Total volume 10
[0045] (3) Select appropriate restriction endonucleases based on the restriction sites of the target DNA fragment and vector. Then, mix the components according to the system shown in Table 4 and perform an enzyme digestion reaction to produce sticky ends between the fragment and vector. Then, use a DNA purification kit to purify the DNA product after digestion to remove the endonuclease and digestion buffer.
[0046] Table 4 Enzyme digestion reaction system
[0047] Components Vector digestion PCR product digestion <![CDATA[ddH2O]]> 17-x 26-x Fast Digest buffer 2μL 3μL DNA x (up to 1 μg) x (up to 0.2 μg) enzymes 1 μL 1 μL Total volume 20 μL 30 μL
[0048] (4) The purified target fragment with sticky ends and the linearized vector were ligated using the system shown in Table 5 to load the target fragment onto the vector. The ligation product was then transformed into competent E. coli cells and screened and identified to obtain bacterial clones containing the correct plasmid.
[0049] Table 5 Ligation reaction system
[0050] Components Dosage Linear vector 20-100 μg target gene 1 / 5 carrier volume 10×T4 DNA ligase buffer 2μL T4 DNA ligase 1U (0.2μL) <![CDATA[ddH2O]]> to 20 μL Total volume 20 μL
[0051] (5) After cloning the bacteria expressing the correct plasmid in step (4), inoculate the bacteria into 50 mL of LB medium (containing antibiotics) and culture in a 37°C shaker at 200 rpm for 12-14 h. After the bacteria are amplified, use an endotoxin-free plasmid extraction kit to extract the target plasmid.
[0052] (6) 9000 ng of the target plasmid, 6000 ng of psPAX2, and 3000 ng of Pmd2.G were co-transfected into 293T cells and cultured for 48 h. The culture supernatant (containing the virus) was collected and the 293T cell debris was filtered out using a 0.45 μm syringe filter to obtain the virus solution.
[0053] (7) Infecting cells: L929 cells in the logarithmic growth phase were inoculated into a 6 cm dish. After 24 h of inoculation, the cells were completely adhered to the wall. The original culture medium was discarded and 3 mL of virus solution was added. At the same time, 3 μL of polybrene (1 mg / mL) was added to promote viral infection. After 24 h of incubation, the virus solution was discarded and replaced with fresh culture medium. The culture was continued for another 24 h. After waiting for gene expression, stable L929 cells with PACSIN2 knockout were screened.
[0054] (8) PACSIN2 knockout L929 stable cells in the logarithmic growth phase were digested and collected, lysed with lysis buffer, and lysed on ice for 1 h; centrifuged at 15,000 g for 15 min at 4°C, and the supernatant was added to loading buffer (to 1×) and heated in a 95°C water bath for 5 min.
[0055] (9) Take the sample prepared in step (8) and perform protein gel electrophoresis; after the electrophoresis is completed, take the protein gel and perform membrane transfer operation (PVDF membrane, 200mA constant current transfer for 2h); after the membrane transfer is completed, take out the PVDF membrane and place it in the blocking solution, and block it on a vertical shaker at 10rpm and room temperature for 2h. After the blocking is completed, wash the PVDF membrane, immerse it in the primary antibody (anti-PACSIN2), and incubate it on a vertical shaker at 10rpm and 4℃ overnight. After the primary antibody incubation is completed, wash the PVDF membrane, then immerse it in the secondary antibody (HRP-linked anti-rabbit IgG), and incubate it on a vertical shaker at 10rpm and room temperature for 2h. After the secondary antibody incubation is completed, wash the PVDF membrane and detect the target protein using a chemiluminescence instrument (β-actin is used as an internal reference).
[0056] Test results such as Figure 1 The results showed that the method of the present invention can effectively knock out PACSIN2 in cells to reduce the expression level of PACSIN2.
[0057] Subsequently, we investigated the effect of PACSIN2 knockout on the activation of type I interferon by STING agonists. We first detected the mRNA expression of IFNβ1 in PACSIN2 knockout cells by qPCR. The specific steps were as follows:
[0058] (1) PACSIN2 knockout L929 stable cells in the logarithmic growth phase were seeded into culture dishes. After complete attachment, different concentrations of STING agonist (MSA-2) were added to each well and incubated for 12 hours. A blank group and a control group were set up. The blank group only received an equal volume of culture medium without inoculating cells, while the control group received an equal volume of cells without MSA-2 treatment. After the cells were treated, the culture medium was discarded, the cells were washed with PBS, 1 mL of RNA extraction and lysis buffer was added, and the cells were allowed to stand for full lysis, and then transferred to a 1.5 mL centrifuge tube; 200 μL of chloroform was added, vortexed for 20 seconds, and allowed to stand at room temperature for 2 minutes; centrifuged at 12,000 rpm and 4°C for 10 minutes, the supernatant was transferred to a new 1.5 mL centrifuge tube (do not aspirate the white middle layer and red bottom layer), an equal amount of isopropanol was added, inverted to mix, and allowed to stand at room temperature for 10 minutes; centrifuged at 12,000 rpm and 4°C for 10 minutes, at which point a small amount of white precipitate could be seen at the bottom of the centrifuge tube; the supernatant was discarded, 1 mL of 75% ethanol (prepared with DEPC water) was added, the tube was slowly inverted until the white precipitate floated, centrifuged at 12,000 rpm and 4°C for 3 minutes, and the supernatant was discarded, and this process was repeated once; the supernatant was aspirated, dried at room temperature for 15 minutes, and the precipitate was dissolved in 30 μL of DEPC water, and the concentration was determined by microquantitator.
[0059] (2) DNA cleaning and reverse transcription: using reverse transcription kit II Q RT SuperMix for qPCR (+g DNA wiper) was used. The gDNA removal reaction system was prepared according to Table 6 below and incubated at 42°C for 3 minutes. Subsequently, 4 μL of Qrt SuperMix was added to the system, and the mixture was incubated at 50°C for 15 minutes, followed by heating at 85°C for 3 minutes to obtain cDNA. The total system was diluted to 100 μL with DEPC water.
[0060] Table 6 gDNA cleanup reaction system
[0061] Components Dosage RNase-free ddH2O to 16 μL 4×gDNA wiper 4 μL Template RNA 2 μg
[0062] (3) Add 7.5 μL qPCR reaction solution was prepared with SYBR Green Master Mix (No Rox), 1.5 μL upstream + downstream primers (1:1 mixture) and 6 μg diluted cDNA, centrifuged briefly, and detected according to the procedure shown in Table 7.
[0063] Table 7 Detection reaction system
[0064] step Temperature / ℃ Time / s Remark Pre-denaturation 95 180 transsexual 95 15 annealing 55 30 Loop 44 times extend 72 20 Melting curve test - - Instrument Procedure
[0065] (4) According to 2 -δδcq The experimental results were analyzed by the method, δcq = cq (target gene) - cq (reference gene), δδcq = δcq (control group) - δcq (intervention group), 2 -δδcq Calculate the relative expression of the target gene. Independent experiments were repeated at least three times, and statistics were calculated as mean ± standard deviation.
[0066] The protein expression of IFNβ1 in the cell supernatant was then detected by ELISA. The specific steps are as follows:
[0067] (1) Sample collection: PACSIN2 knockout L929 stable cells in good condition and growing in the logarithmic phase were inoculated into culture dishes and treated after they were completely attached to the wall. After the treatment, the culture supernatant was collected and centrifuged at 1000 g for 20 min. The supernatant was separated and frozen at -80°C.
[0068] (2) Before the experiment, remove the test sample and thaw it to room temperature; remove the ELISA kit and equilibrate it to room temperature; prepare the gradient standard protein solution, biotinylated antibody working solution, HRP working solution, and washing solution according to the instructions.
[0069] (3) Add 100 μL of sample or standard protein solution to each well coated with the recognition antibody and incubate at 37°C for 1 h. After the incubation, discard the liquid in the well and add 100 μL of biotin antibody working solution to each well and incubate at 37°C for 1 h.
[0070] (4) Discard the biotinylated antibody working solution, add 300 μL of the prepared washing solution to each well, let it stand for 1 min, then discard it, pat it dry on absorbent paper, and repeat 3 times.
[0071] (5) Add 100 μL of HRP working solution to each well and incubate at 37°C for 30 min in the dark. Wash according to the method in (4) and repeat 5 times. Add 90 μL of reaction solution to each well. Add 50 μL of stop solution to each well and measure the absorbance at 450 nm. Prepare a standard curve and calculate the sample concentration.
[0072] Test results such as Figure 2The results showed that compared with PACSIN2 wild-type (PAC SIN2-WT) cells, after PACSIN2 knockout (PASCIN2-KO) in the cells, the activation effect of STING agonists on type I interferon was significantly reduced, resulting in a significant decrease in the expression level of intracellular interferon, thus proving that the expression level of PASCIN2 has a key influence on the activation of type I interferon by STING agonists.
[0073] Example 2
[0074] First, the target fragment was amplified and purified from the template plasmid by PCR to construct and verify the PACSI N2 overexpression in L929 stable cells. The specific steps are as follows:
[0075] (1) According to the method in Example 1, a PACSIN2-overexpressing L929 stable cell line was constructed using molecular cloning and lentiviral transfection system (wherein the PACSIN2 gene sequence is shown in SEQ ID NO: 6, CDS region, human and mouse homologous).
[0076] (2) L929 stable cells overexpressing PACSIN2 in the logarithmic growth phase were digested and collected, lysed on ice for 1 h, centrifuged at 15,000 × g at 4°C for 15 min, and the supernatant was added to loading buffer (to 1×) and incubated in a 95°C water bath for 5 min.
[0077] (3) Take the sample prepared in step (2) and perform protein gel electrophoresis; after the electrophoresis is completed, take the protein gel and perform membrane transfer operation (PVDF membrane, 200mA constant flow transfer for 2h); after the membrane transfer is completed, take out the PVDF membrane and place it in the blocking solution, and block it on a vertical shaker at 10rpm and room temperature for 2h. After the blocking is completed, wash the PVDF membrane, immerse it in the primary antibody (anti-PACSIN2), and incubate it on a vertical shaker at 10rpm and 4℃ overnight. After the primary antibody incubation is completed, wash the PVDF membrane, then immerse it in the secondary antibody (HRP-linked anti-rabbit IgG), and incubate it on a vertical shaker at 10rpm and room temperature for 2h. After the secondary antibody incubation is completed, wash the PVDF membrane and detect the target protein using a chemiluminescence instrument (β-actin is used as an internal reference).
[0078] Test results such as Figure 3 The results showed that the method of the present invention can significantly overexpress PACSIN2 in cells to increase the expression level of PACSIN2 protein.
[0079] Subsequently, the expression of IFNβ1 mRNA in PACSIN2 knockout cells was detected by qPCR, and the protein expression of IFNβ1 in the cell supernatant was detected by ELISA. For specific experimental steps, see Example 1.
[0080] Test results such as Figure 4 The results showed that compared with PACSIN2 wild-type (Ctr l) cells, overexpression of intracellular PACSIN2 (PASCIN2-OE) significantly enhanced the activation effect of STING agonists on type I interferon, significantly increasing the expression level of intracellular interferon. This further demonstrated that the expression level of PASCIN2 plays a key role in the activation of type I interferon by STING agonists, that is, PASCIN2 can significantly promote the activation effect of STING agonists on type I interferon.
[0081] Example 3
[0082] To explore the specific molecular mechanism of PACSIN2 on the STING pathway, Western blot was used to investigate the expression levels, degradation, and activation windows of key signaling molecules such as STING, TBK1, and IRF3. Immunofluorescence was used to observe the migration and nuclear translocation of key signaling factors such as STING, TBK1, and IRF3. The specific steps are as follows:
[0083] (1) PACSIN2 knockout L929 stable cells (PACSI N2-KO) and wild-type L929 cells (PACSIN2-WT) were digested and collected using a cell counter and then seeded into 6-well plates at a density of 50,000 cells / well.
[0084] (2) After cell adhesion, STING agonist (MSA-2, 5 μM) was added to each well and incubated for another 12 hours.
[0085] (3) After digestion and collection of cells, add lysis buffer and lyse on ice for 1 h; centrifuge at 15,000 × g at 4°C for 15 min, take the supernatant and add loading buffer (to 1×), and heat in a 95°C water bath for 5 min.
[0086] (4) The sample prepared in step (3) was subjected to protein gel electrophoresis; after the electrophoresis was completed, the protein gel was taken for membrane transfer (PVDF membrane, 200 mA constant current transfer for 2 h); after the membrane transfer was completed, the PVDF membrane was taken out and placed in a blocking solution, and blocked at room temperature for 2 h on a vertical shaker at 10 rpm.
[0087] (5) After blocking, the PVDF membrane was washed and immersed in primary antibodies (anti-P-STING, anti i-STING, anti-P-TBK1, anti-TBK1, anti-P-IRF3, anti-IRF3), and incubated on a vertical shaker at 10 rpm and 4°C overnight.
[0088] (6) After the primary antibody incubation is completed, the PVDF membrane is washed and then immersed in the secondary antibody (HRP-linked anti-rabbit IgG) and incubated on a vertical shaker at 10 rpm at room temperature for 2 h.
[0089] (7) After the secondary antibody incubation is completed, the PVDF membrane is washed and the target protein is detected using a chemiluminescence analyzer (Vinculin is used as an internal reference).
[0090] The results are as follows Figure 5 The results showed that PACSIN2 knockout significantly downregulated the phosphorylation levels of STING / TBK1 and IRF3 triggered by STING agonists and slowed their activation process, especially the phosphorylation of STING and IRF3. These results indicate that PACSIN2 can activate the STING pathway in immune cells.
[0091] Furthermore, to explore how PACSIN2 affects the transport and localization of STING after activation, live cell imaging, immunofluorescence, and scanning electron microscopy were used to observe the temporal changes in STING transport in the absence of PACSIN2. The specific steps are as follows:
[0092] (1) Reagent configuration:
[0093] Blocking solution: Prepare 0.3% Triton-X 100 (v / v) in PBS, then measure 950 μL of 0.3% Triton-X-PBS and add 50 μL of normal goat serum;
[0094] Antibody diluent: Weigh 0.01 g of BSA and dissolve it in 1 mL of 0.3% Triton-X-PBS;
[0095] Primary antibody: Prepare the primary antibody in the proportion according to the antibody instructions using antibody diluent;
[0096] Secondary antibody: Prepare fluorescent secondary antibody at a ratio of 1:1000 using antibody diluent;
[0097] DAPI: Prepare DAPI to 1 μg / mL in PBS.
[0098] (2) Cell treatment: The intervention process needs to be carried out in a glass-bottom culture dish. After the intervention, the culture medium is discarded and the cells are washed three times with PBS.
[0099] (3) Discard PBS, add 1 mL of paraformaldehyde, and fix at room temperature for 20 minutes.
[0100] (4) Discard paraformaldehyde, add 1 mL of PBS, and wash at room temperature for 5 min on a vertical shaker at 60 rpm. Repeat three times.
[0101] (5) Discard PBS, add blocking solution, and block at 37°C for 1 hour.
[0102] (6) Discard the blocking solution and add the primary antibody and incubate overnight at 4°C.
[0103] (7) Recover the primary antibody, add 1 mL of PBS, and wash at room temperature for 5 min on a vertical shaker at 60 rpm. Repeat three times.
[0104] (8) Discard PBS, add secondary antibody and incubate at room temperature in the dark for 1 h.
[0105] (9) Discard the secondary antibody, add 1 mL of PBS, and wash at room temperature for 5 min on a vertical shaker at 60 rpm in the dark. Repeat three times.
[0106] (10) Discard PBS, add DAPI, and incubate at room temperature for 2 min in the dark.
[0107] (11) Discard DAPI, add 1 mL of PBS, and wash at room temperature for 5 min in a vertical shaker at 60 rpm in the dark. Repeat three times.
[0108] (12) Observe and take photos using a laser confocal microscope.
[0109] The results are as follows Figure 6 The results showed that when PACSIN2 was knocked out, the transport of STING to the endoplasmic reticulum-Golgi intermediate island region (ERGIC) was significantly inhibited, indicating that the transport process of STING is positively regulated by PACSIN2. It also shows that PACSIN2 can act as an effector protein to promote the transport of STING and thus achieve positive regulation of the STING pathway.
[0110] The above results clearly demonstrate that knocking out PACSIN2 significantly reduces cellular responsiveness to STING agonists. Furthermore, overexpressing PACSIN2 significantly enhances cellular responsiveness to STING agonists, demonstrating that PACSIN2 is a key factor in enhancing STING agonist responses and type I interferon signaling in immune cells. To pinpoint the key mechanisms of PACSIN2 action, the present invention investigated both upstream and downstream aspects of the dsDNA-cGAS-STING-TBK1-IRF3 pathway. Using L929 cells as a model cell model, the authors found that PACSIN2 knockout significantly downregulated STING / TBK1 and IRF3 phosphorylation levels triggered by STING agonists and slowed their activation, particularly STING and IRF3 phosphorylation. These results suggest that PACSIN2 can activate the STING pathway in immune cells. Through image analysis of the STING transport process and localization, it was further clarified that when PACSIN2 is knocked out, the transport of STING to the endoplasmic reticulum-Golgi intermediate island region (ERGIC) can be significantly inhibited. This shows that the transport process of STING is positively regulated by PACSIN2. It also shows that PACSIN2 can act as an effector protein to promote the transport of STING, thereby achieving positive regulation of the STING pathway. PACSIN2 protein can be directly administered to humans or tumors or prepared into mRNA preparations, vaccines, etc. to activate the intracellular STING signaling pathway and activate the activation effect of STING agonists on type I interferon, thereby greatly improving the effect of tumor immunotherapy.
[0111] The development of immunotherapy drugs for cancer is booming, and innovative drug development strategies have been a key driver of this field. This study demonstrates that PACSIN2 can effectively promote the activation of type I interferon-mediated innate immune networks, particularly by participating in STING transport and promoting STING-mediated type I interferon activation. It serves as a key factor in triggering the STING-TBK1-IRF3 signaling pathway to activate a "hot" tumor phenotype. Exogenous overexpression of PACSIN2 in immune cells has been shown to significantly enhance the response of the STING signaling pathway. This study provides an effective solution for improving the therapeutic efficacy of diseases requiring innate immune activation. The discovery of this innovative mechanism for sustained activation of innate immune responses within the tumor microenvironment and the implementation of targeted strategies will overcome the difficulty in activating innate immune signaling in tumor cells, providing an important scientific basis for achieving the "cold-to-hot" transition of tumor cells. This provides a necessary and solid foundation for the development of cancer immunotherapy drugs, and holds significant scientific significance and clinical application value.
[0112] The above detailed description of the analytical methods involved in the present invention provides a detailed introduction. It should be noted that the above description is intended solely to help those skilled in the art better understand the methods and concepts of the present invention, and is not intended to limit the relevant content. Without departing from the principles of the present invention, those skilled in the art may make appropriate adjustments or modifications to the present invention, and such adjustments and modifications shall also fall within the scope of protection of the present invention.
Claims
1. Application of overexpressed PACSIN2 protein in the preparation of products that enhance the sensitivity of STING agonists to cancer treatment.
2. The use according to claim 1, characterized in that The cancer is selected from one or more of liver cancer, kidney cancer, lung cancer, colorectal cancer, breast cancer, pancreatic cancer, thyroid cancer, and lymphoma.
Citation Information
Patent Citations
Application of PACSIN2 inhibitor in preparation of antidepressant drug
CN116763922A
Methods for treating triple-negative breast cancer
US20210121495A1