A method for creating cold-resistant cucumber germplasm through site-directed mutagenesis

Abstract

The application discloses a method for creating cold-tolerant cucumber germplasm through site-directed mutation. The method is realized by mutating the coding gene of CsSHI1 protein in a non-cold-tolerant cucumber variety; the CsSHI1 protein is a protein with an amino acid sequence shown as SEQ ID No: 3; the mutation is that the CsSHI1 gene shown as SEQ ID No: 1 is mutated into CsSHI1 / -5bp; the CsSHI1 / -5bp is a DNA molecule obtained by deleting the nucleotides CGATG at positions 62-66 from the 5' end of SEQ ID No: 1 and keeping other nucleotide sequences of SEQ ID No: 1 unchanged. The method can edit the coding gene of the CsSHI1 protein of cucumber and obtain cold-tolerant cucumber, and has important application value.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a method for creating cold-resistant cucumber germplasm through site-directed mutagenesis. Background Technology

[0002] Cucumber (Cucumis sativus L.), a dicotyledonous plant of the Cucurbitaceae family, also known as gourd or king cucumber, originated in the Himalayas and is characterized by its preference for warm, humid conditions and tolerance to some low light. In protected vegetable production in northern my country, cucumber is one of the main vegetable varieties. However, as a warm-season vegetable originating in subtropical regions, cucumber is sensitive to temperature. Therefore, the biggest obstacle in protected production is its low cold tolerance, frequently resulting in chilling injury, which significantly impacts yield and quality. In recent years, the problem of chilling injury in cucumbers has received widespread attention, leading to the development of technical measures to overcome the adverse effects of low temperatures and low light in protected cultivation, as well as the breeding of cold-resistant cucumber varieties. Research efforts in the scientific community have also gradually increased, including studies on the physiological and biochemical reactions of cucumbers under low temperatures, the changing patterns of their sensitivity to low temperatures, and chemical protection against chilling injury.

[0003] This demonstrates that cold damage significantly impacts cucumber yield and quality. In my country's cucumber cultivation process, early spring, late autumn, and year-round production are highly susceptible to low-temperature damage, leading to decreased yield and quality, or even complete crop failure, severely harming the economic benefits of farmers. Therefore, creating new cold-resistant cucumber germplasm is of significant economic and practical importance. Summary of the Invention

[0004] The purpose of this invention is to create cold-resistant cucumber germplasm.

[0005] This invention first protects a method for cultivating cold-resistant cucumbers, which is achieved by mutating the gene encoding the CsSHI1 protein (i.e., the CsSHI1 gene) in non-cold-resistant cucumber varieties.

[0006] The CsSHI1 protein is a1), a2), or a3):

[0007] a1) The amino acid sequence is that of the protein shown in SEQ ID No: 3;

[0008] a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2);

[0009] a3) A protein obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No: 3.

[0010] The proteins in a2) above are labeled as shown in Table 1.

[0011] Table 1. Sequence of Labels

[0012]

[0013]

[0014] The protein in a3) above, wherein the substitution and / or deletion and / or addition of one or more amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0015] The proteins mentioned in a3) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0016] The gene encoding the protein in a3) above can be obtained by deleting one or more amino acid residues from the codons of the DNA sequence shown in SEQ ID No: 1 or SEQ ID No: 2, and / or by performing a missense mutation of one or more base pairs, and / or by attaching the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

[0017] In the above method, the mutation can be to mutate the CsSHI1 gene shown in SEQ ID No: 1 to CsSHI1 / -5bp; CsSHI1 / -5bp is a DNA molecule obtained by deleting the nucleotide CGATG from position 62 to 66 of SEQ ID No: 1 from the 5' end, while keeping the other nucleotide sequences of SEQ ID No: 1 unchanged.

[0018] In the above method, the gene encoding the CsSHI1 protein in the mutant non-cold-resistant cucumber variety is introduced into the cucumber using a CRISPR / Cas9 system. The CRISPR / Cas9 system may include a recombinant expression vector that expresses a DNA molecule containing gRNA targeting the gene encoding the CsSHI1 protein.

[0019] In the above method, the target sequence of the gRNA may be as shown in SEQ ID No: 1, positions 56-78 from the 5' end.

[0020] In the above method, the recombinant expression vector can be the recombinant plasmid CRISPR / CAS9-CsSHI1. The recombinant plasmid CRISPR / CAS9-CsSHI1 can be obtained by inserting the DNA double-stranded molecule shown in SEQ ID No: 4 into the recognition site of the restriction endonuclease Bsal in the CRISPR / CAS9 vector.

[0021] This invention also protects the use of the material encoding the CsSHI1 protein (i.e., the CsSHI1 gene) of any of the above-mentioned CsSHI1 protein in mutant non-cold-resistant cucumber varieties in the cultivation of cold-resistant cucumbers.

[0022] The CsSHI1 gene described above can be a DNA molecule of the following type: (b1) or (b2) or (b3) or (b4) or (b5):

[0023] (b1) A DNA molecule with a coding region as shown in SEQ ID NO:1;

[0024] (b2) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO:1;

[0025] (b3) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO:2;

[0026] (b4) A DNA molecule that hybridizes under stringent conditions with a DNA molecule defined by (b1) or (b2) or (b3) and encodes any of the CsSHI1 proteins described above;

[0027] (b5) A DNA molecule derived from cucumber and having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the DNA molecule defined in (b1), (b2), or (b3) and encoding any of the CsSHI1 proteins described above.

[0028] The stringent conditions were: hybridization in a solution of 2×SSC and 0.1% SDS at 68°C, followed by two washes of 5 min each, and then hybridization in a solution of 0.5×SSC and 0.1% SDS at 68°C, followed by two washes of 15 min each.

[0029] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0030] SEQ ID NO:1 consists of 2001 nucleotides, SEQ ID NO:2 consists of 5755 nucleotides, and the nucleotides shown in SEQ ID NO:1 encode the amino acid sequence shown in SEQ ID NO:3.

[0031] Those skilled in the art can readily mutate the nucleotide sequence encoding any of the aforementioned CsSHI1 proteins using known methods, such as directed evolution and point mutation. Any artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of any of the aforementioned CsSHI1 proteins isolated according to this invention, as long as they encode any of the aforementioned CsSHI1 proteins, are derived from and equivalent to the nucleotide sequence of this invention.

[0032] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or higher, 80% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence encoding the amino acid sequence of the CsSHI1 protein as shown in SEQ ID NO:3 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0033] In the above applications, the mutation can be the mutation of the CsSHI1 gene shown in SEQ ID No: 1 to CsSHI1 / -5bp; CsSHI1 / -5bp is a DNA molecule obtained by deleting the nucleotide CGATG from position 62 to 66 of SEQ ID No: 1 from the 5' end, while keeping the other nucleotide sequences of SEQ ID No: 1 unchanged.

[0034] In the above applications, the substance encoding the CsSHI1 protein gene in the mutant non-cold-resistant cucumber variety can be either B1) or B2):

[0035] B1) Nucleic acid molecules that inhibit or reduce the expression of the gene encoding the CsSHI1 protein;

[0036] B2) Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines containing the nucleic acid molecules described in B1).

[0037] In the above applications, the nucleic acid molecule described in B1) may be a DNA molecule expressing gRNA that targets the gene encoding the CsSHI1 protein or gRNA that targets the gene encoding the CsSHI1 protein.

[0038] In the above applications, the target sequence of the gRNA is shown in positions 56-78 from the 5' end of SEQ ID No: 1.

[0039] The non-cold-resistant cucumber variety mentioned above can specifically be cucumber inbred line 9930.

[0040] Experiments have shown that transforming cucumber inbred line 9930 with recombinant Agrobacterium containing the recombinant plasmid CRISPR / CAS9-CsSHI1 can edit the CsSHI1 gene. After editing the CsSHI1 gene using the CRISPR / Cas9 endonuclease, mutations occur. When both homologous chromosomes of the CsSHI1 gene are mutated (specifically, the CsSHI1 gene shown in SEQ ID No: 1 is mutated to CsSHI1 / -5bp; CsSHI1 / -5bp is obtained by deleting nucleotides CGATG from positions 62-66 of SEQ ID No: 1 from the 5' end, while keeping the other nucleotide sequences of SEQ ID No: 1 unchanged), the CsSHI1 protein activity is lost. This loss of CsSHI1 protein activity results in cold-resistant cucumber germplasm. The method of this invention can achieve CsSHI1 gene editing in cucumbers, obtaining cold-resistant cucumbers. Therefore, the CsSHI1 protein can regulate the cold resistance of cucumbers, and this invention has significant application value. Attached Figure Description

[0041] Figure 1 This is a schematic diagram of the structure of the recombinant plasmid CRISPR / CAS9-CsSHI1, as well as the positional relationship of the target site, Oligo F, and Oligo R.

[0042] Figure 2 This section presents partial sequencing results of the csshi1 homozygous mutant strain and the mutation types of the CsSHI1 gene and CsSHI1 protein.

[0043] Figure 3 To identify the cold resistance of the csshi1 homozygous mutant. Detailed Implementation

[0044] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0045] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0046] The cucumber inbred line 9930 is described in the following literature: Li Q, Li H1, Huang W, Xu Y, Zhou Q, Wang S, Ruan J, Huang S, Zhang Z (2019). A chromosome-scale genome assembly of cucumber (Cucumis sativus L.). Gigascience 8:giz072. It is publicly available from the Beijing Academy of Agricultural and Forestry Sciences (the applicant). This biological material is only for repeating the relevant experiments of this invention and cannot be used for other purposes. Cucumber inbred line 9930 is a cold-intolerant cucumber variety; its optimal growth temperature is 18-30℃, and its survival rate is only 10-15% when the temperature is below 8℃.

[0047] The CRISPR / CAS9 vector construction kit is a product of Hangzhou Baige Biotechnology Co., Ltd., with product catalog number BGK03.

[0048] MS powder is a product of Phyto Technology Laboratories, catalog number M519.

[0049] The culture media involved in the following examples are as follows:

[0050] The solute and concentration of MS liquid medium were 4.43 g / L MS powder and 30 g / L sucrose, with water as the solvent and a pH of 5.7-5.8.

[0051] The solutes and their concentrations in the MS solid medium were 4.43 g / L MS powder, 30 g / L sucrose, and 2.5 g / L plant gel, with water as the solvent and a pH of 5.7-5.8.

[0052] The solutes and their concentrations in the differentiation medium were MS powder 4.43 g / L, sucrose 30 g / L, plant gel 2.5 g / L, 6-BA 0.5 mg / L and ABA 1 mg / L, with water as the solvent and a pH of 5.7-5.8.

[0053] The solutes and their concentrations in the resistance differentiation medium were: MS powder 4.43 g / L, sucrose 30 g / L, plant gel 2.5 g / L, 6-BA 0.5 mg / L, ABA 1 mg / L, kanamycin 25 mg / L and carbenicillin 500 mg / L, with water as the solvent and a pH of 5.7-5.8.

[0054] The solutes and their concentrations in the rooting medium were MS powder 4.43 g / L, sucrose 30 g / L and plant gel 2.5 g / L, with water as the solvent and a pH of 5.7-5.8.

[0055] The solute and concentration of 1 / 2 MS liquid medium were 2.22 g / L MS powder and 30 g / L sucrose, with water as the solvent and a pH of 5.7-5.8.

[0056] The nucleotide sequence of the CsSHI1 gene in the cDNA of cucumber inbred line 9930 is shown in SEQ ID NO:1; the nucleotide sequence of the CsSHI1 gene in the genomic DNA of cucumber inbred line 9930 is shown in SEQ ID NO:2. The CsSHI1 gene encodes the CsSHI1 protein. The amino acid sequence of the CsSHI1 protein is shown in SEQ ID NO:3.

[0057] Example 1: Creation of Cold-Resistant Cucumber Germplasm through Site-Specific Mutation

[0058] Target design was performed using the DNA sequence shown in SEQ ID No: 1 on the E-CRISPR website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html). In this embodiment, one target was selected for the experiment. The target sequence is: 5'-CCGACTCGATGGGTAGAACCAGA-3' (i.e., positions 56-78 from the 5' end of SEQ ID No: 1), corresponding to the CsSHI1 gene.

[0059] I. Construction of recombinant plasmid CRISPR / CAS9-CsSHI1

[0060] 1. Design and synthesize Oligo F based on the target:

[0061] 5'-TGTGTGCCGACTCGATGGGGTAGAACCAGA-3' and Oligo R: 5'-AAACTCTGGTTCTACCCATCGAGTCGGCA-3'.

[0062] 2. Dilute Oligo F and Oligo R to 10 μM with deionized water to obtain Oligo F dilution and Oligo R dilution, respectively.

[0063] 3. Preparation of the annealing reaction system. The annealing reaction system is 20 μL, consisting of 1 μL Oligo F diluent, 1 μL Oligo R diluent, and 18 μL BufferAneal (a component of the CRISPR / CAS9 vector construction kit).

[0064] 4. Take the reaction system prepared in step 3, anneal it, and obtain oligo dimer.

[0065] The annealing procedure is as follows: first 95℃ for 3 minutes, then cool down to 20℃ at a rate of 0.2℃ / s.

[0066] 5. Ligate the oligo dimer obtained in step 4 with the CRISPR / CAS9 vector (a component in the CRISPR / CAS9 vector construction kit) to obtain the recombinant plasmid CRISPR / CAS9-CsSHI1.

[0067] The ligation system consisted of 10 μL of oligo dimer, 2 μL of CRISPR / CAS9 vector, 1 μL of LsaI EnzymeMix (a component in the CRISPR / CAS9 vector construction kit), and ddH2O.

[0068] The connection procedure is: let stand at 20℃ for 1 hour.

[0069] The recombinant plasmid CRISPR / CAS9-CsSHI1 was sequenced. Sequencing results showed that the recombinant plasmid CRISPR / CAS9-CsSHI1 was obtained by inserting the DNA double-stranded molecule shown in SEQ ID No: 4 into the recognition site of the restriction endonuclease Bsal in the CRISPR / CAS9 vector.

[0070] SEQ ID No: 4 is:

[0071] 5'-AAGGCGATTAAGTTGGGTAACGCCCAGGGTTTTCCCAGTCACGACGTTGTAAA ACGACGGCCAGTGCCAAGCTTCATTCGGAGTTTTTGTATCTTGTTTCATAGTTTGTCCCAGGATTAGAATGATTAGGCATCGAACCTTCAAGAATTTGATTGAATAAAACATCTTCATTCTTAAGATATGAAGATAATCTTCAAAAGGCCCCTGGGAATCTGAAAGAAGAGAAGCAGGCCCATTTATATGGGAAAGAACAATAGTATTTCT TATATAGGCCCATTTAAGTTGAAAACAATCTTCAAAAGTCCCACATCGCTTAGATAAGAAAACGAAGCTGAGTTTATATACAGCTAGAGTCGAAGTAGTGATTGCCGACTCGATGGGTAGAACCAGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT-3'

[0072] A schematic diagram of the recombinant plasmid CRISPR / CAS9-CsSHI1, along with the positional relationship of the target site, Oligo F, and Oligo R, can be found in [link to diagram]. Figure 1 .

[0073] II. Obtaining the csshi1 homozygous mutant

[0074] Because cucumbers are diploid plants, when Cas9 begins to edit specific genes, both alleles on the two homologous chromosomes within the same cell can be edited, producing the same or different types of mutations. Therefore, two alleles in a plant are considered two gene editing events. A homozygous mutant is one where the CsSHI1 gene on both homologous chromosomes of the plant has the same mutation. A biallelic mutant is one where the CsSHI1 gene on both homologous chromosomes of the plant has been mutated, but in different forms. A heterozygous mutant is one where the CsSHI1 gene on one of the two homologous chromosomes of the plant has been mutated, while the CsSHI1 gene on the other homologous chromosome has not been mutated. A wild-type is one where the CsSHI1 gene on neither of the two homologous chromosomes of the plant has been mutated.

[0075] 1. Preparation of Agrobacterium infection solution

[0076] (1) The recombinant plasmid CRISPR / CAS9-CsSHI1 was transformed into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium.

[0077] (2) A single clone of recombinant Agrobacterium was inoculated into 2 ml of YEB liquid medium containing 50 mg / L kanamycin and 70 mg / L Rif, and cultured overnight at 28°C with shaking at 200 rpm to obtain culture solution 1. 2 ml of culture solution 1 was inoculated into 50 ml of YEB liquid medium containing 50 mg / L kanamycin and 70 mg / L Rif, and cultured at 28°C with shaking at 200 rpm to obtain OD. 600nm 2. The culture solution is 0.6-0.8.

[0078] (3) Take the culture medium obtained in step (2), centrifuge at 5000 rpm for 5 minutes, and collect the bacterial cells; wash the bacterial cells with 1 / 2 MS liquid medium, and then dilute with 1 / 2 MS liquid medium to obtain OD. 600nm The concentration of Agrobacterium is approximately 0.2.

[0079] 2. Recombinant Agrobacterium was transformed into cucumber inbred line 9930 (hereinafter referred to as cucumber). After differentiation and rooting, T0 generation transgenic cucumbers were obtained. The specific steps are as follows:

[0080] (1) Select plump and intact cucumber seeds, peel them, disinfect them in 70% (v / v) ethanol aqueous solution for 30s, then sterilize them in 2.0% sodium hypochlorite solution for 15min, rinse them several times with sterile water, and finally sow them on MS solid medium and culture them at 28℃ for 2-3 days until the cotyledons break open.

[0081] (2) After completing step (1), take the cucumber seed, cut off the growing point and hypocotyl, cut off the upper half (1 / 2-1 / 3) of both cotyledons, and leave the lower half as the explant.

[0082] (3) After completing step (2), infect the explants with the Agrobacterium infection solution prepared in step 1 for 15 min; after the infection is completed, use sterile filter paper to absorb the excess Agrobacterium infection solution, and inoculate the explants with their backs facing down on the differentiation medium and incubate them in the dark at 28°C for 2 days.

[0083] (4) After completing step (3), place the explants in the resistance differentiation medium and culture them at 28°C with alternating light and dark conditions (16 hours of light / 8 hours of darkness; light intensity is about 2000 lx) for 15-20 days to obtain resistant shoots about 1.0-1.5 cm long.

[0084] (5) After completing step (4), cut off the resistant buds and place them in a rooting medium containing 100 mg / L kanamycin. Induce rooting by alternating light and dark culture at 28°C (16 hours of light / 8 hours of darkness; light intensity of approximately 2000 lx). After the root system has developed well, transplant the cucumber plants into flowerpots filled with sterile soil and cover them with plastic wrap to retain moisture. Cultivate them in an artificial climate chamber for 1 week. Then, move them to a greenhouse and allow them to adapt for 3-5 days. After that, manage them as usual to obtain the T0 generation of transgenic cucumbers.

[0085] 3. Using genomic DNA from T0 generation transgenic cucumber leaves as templates, PCR amplification was performed using primer pairs F (5'-CCAACCCCTTTTACTCCACCA-3') and R (5'-TCCTCCTCATCCTCAGGACC-3') (reaction program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 15 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 7 min), yielding the corresponding PCR amplification products. The PCR amplification products were then sequenced. The sequencing results were compared with the CsSHI1 gene Cas9 target sequence (SEQ ID No: 2, positions 214 to 825 from the 5' end), and mutation types were identified.

[0086] 4. Self-pollinate the heterozygous mutants obtained in step 3. The resulting seeds are T1 generation seeds, and the plants grown from the T1 generation seeds are T1 generation plants.

[0087] 5. Using genomic DNA from leaves of the T1 generation plants as templates, PCR amplification was performed using primer pairs consisting of primer F: 5'-CCAACCCCTTTTACTCCACCA-3' and primer R: 5'-TCCTCCTCATCCTCAGGACC-3' (reaction program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 15 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 7 min), yielding the corresponding PCR amplification products. The PCR amplification products were then sequenced. The sequencing results were compared with the Cas9 target sequence of the CsSHI1 gene (SEQ ID No: 2, positions 214 to 825 from the 5' end), and mutation types were identified.

[0088] The results showed that one homozygous mutant strain was obtained, named csshi1 homozygous mutant strain. The mutation types of the CsSHI1 gene and CsSHI1 protein in cucumber inbred line 9930 and the csshi1 homozygous mutant strain are shown in [reference needed]. Figure 2 (9930 is a partial sequence of cucumber inbred line 9930, and csshi1 is a partial sequence of csshi1 homozygous mutant). The CsSHI1 gene on both homologous chromosomes of the csshi1 homozygous mutant has the same mutation, specifically a deletion of 5 nucleotides "CGATG" in the CsSHI1 gene on both homologous chromosomes (i.e., deletion at positions 62-66 from the 5' end of SEQ ID No: 1), which causes a frameshift, premature termination of the encoded protein, and loss of function of the CsSHI1 protein.

[0089] III. Identification of cold resistance in homozygous mutant strains of csshi1

[0090] The experiment was repeated three times and the average value was taken. The steps for each repetition were as follows:

[0091] 1. Sow the cucumber seeds to be tested (seeds of the homozygous mutant csshi1 or cucumber inbred line 9930) in flowerpots filled with nutrient soil, and culture them at 25℃ with alternating light and dark conditions (16h light culture / 8h dark culture) to obtain cucumber seedlings to be tested when they have grown to 4 true leaves, i.e. cucumber seedlings to be tested before cold treatment.

[0092] To ensure that the experimental conditions were as consistent as possible, the weight of the nutrient soil in each flowerpot was the same, and the number of cucumber seedlings with 4 true leaves in each flowerpot was also the same.

[0093] 2. After completing step 1, take the cucumber seedlings to be tested before cold treatment and culture them at 6℃ with alternating light and dark conditions (16h light culture / 8h dark culture) for 13 days to obtain the cucumber seedlings to be tested after cold treatment.

[0094] 3. After completing step 2, take the cucumber seedlings to be tested after cold treatment and culture them at 25℃ with alternating light and dark conditions (16h light culture / 8h dark culture) for 8 days to obtain the recovered cucumber seedlings to be tested.

[0095] 4. Observe the growth status of the cucumber seedlings before cold treatment, the cucumber seedlings after cold treatment, and the cucumber seedlings after recovery; and count the survival rate of the cucumber seedlings after recovery.

[0096] The growth status of the cucumber seedlings to be tested is shown in the figure. Figure 3 The rightmost figure shows the cucumber inbred line 9930 (9930 is the csshi1 homozygous mutant), the cucumber seedlings under test on day 0 of the 6℃ treatment before the cold treatment, the cucumber seedlings under test on day 13 of the 6℃ treatment after the cold treatment, and the cucumber seedlings under test on day 8 of the recovery treatment after recovery.

[0097] The statistical results of the survival rate of the recovered cucumber seedlings are shown in the figure. Figure 3 The middle left image (9930 is cucumber inbred line 9930, and csshi1 is csshi1 homozygous mutant).

[0098] The results showed that before cold treatment, there was no significant difference in growth status between the csshi1 homozygous mutant and cucumber inbred line 9930; after recovery, compared with cucumber inbred line 9930, the csshi1 homozygous mutant showed better growth status and a significantly increased survival rate (the survival rate of cucumber inbred line 9930 was 13.02%, while the survival rate of csshi1 homozygous mutant was 46.42%), exhibiting a cold-resistant phenotype. Therefore, the csshi1 homozygous mutant is a cold-resistant cucumber germplasm.

[0099] Therefore, it can be seen that the present invention can create cold-resistant cucumber germplasm through site-directed mutation.

[0100] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for breeding cold-tolerant cucumber by mutating the coding gene of CsSHI1 protein in a non-cold-tolerant cucumber variety. The amino acid sequence of the CsSHI1 protein is shown in SEQ ID No:

3. The mutation is that the nucleotides CGATG from 62-66 of SEQ ID No: 1 are deleted, and other nucleotide sequences of SEQ ID No: 1 are kept unchanged. CsSHI1 The gene mutation is that the nucleotides CGATG from 62-66 of SEQ ID No: 1 are deleted, and other nucleotide sequences of SEQ ID No: 1 are kept unchanged. CsSHI1 / -5bp The mutation is that the nucleotides CGATG from 62-66 of SEQ ID No: 1 are deleted, and other nucleotide sequences of SEQ ID No: 1 are kept unchanged. CsSHI1 / - 5bp The mutation is that the nucleotides CGATG from 62-66 of SEQ ID No: 1 are deleted, and other nucleotide sequences of SEQ ID No: 1 are kept unchanged.

2. The method of claim 1, wherein: The coding gene of CsSHI1 protein in the non-cold-tolerant cucumber variety is mutated by introducing a CRISPR / Cas9 system into the cucumber. The CRISPR / Cas9 system comprises a recombinant expression vector of a DNA molecule expressing a gRNA targeting the coding gene of the CsSHI1 protein.

3. The method of claim 2, wherein: The target sequence of the gRNA is shown in SEQ ID No: 1 from the 56th to the 78th from the 5' end. 4.Use of a substance of the coding gene of CsSHI1 protein in a non-cold-tolerant cucumber variety in breeding cold-tolerant cucumber. The amino acid sequence of the CsSHI1 protein is shown in SEQ ID No:

3. The mutation is that the nucleotides CGATG at positions 62-66 from the 5' end of SEQ ID No: 1 are deleted, and other nucleotide sequences of SEQ ID No: 1 are kept unchanged. CsSHI1 The gene mutation is that the nucleotides CGATG at positions 62-66 from the 5' end of SEQ ID No: 1 are deleted, and other nucleotide sequences of SEQ ID No: 1 are kept unchanged. CsSHI1 / -5bp ; the mutation is that the nucleotides CGATG at positions 62-66 from the 5' end of SEQ ID No: 1 are deleted, and other nucleotide sequences of SEQ ID No: 1 are kept unchanged. CsSHI1 / - 5bp is a DNA molecule obtained by deleting the nucleotides CGATG at positions 62-66 from the 5' 5. Use according to claim 4, characterized in that: The substance of the coding gene of CsSHI1 protein in the non-cold-tolerant cucumber variety is as follows B1) or B2): B1) a nucleic acid molecule inhibiting the expression of the coding gene of the CsSHI1 protein; B2) an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule of B1).

6. Use according to claim 5, characterized in that: B1) the nucleic acid molecule is a DNA molecule expressing a gRNA targeting the coding gene of the CsSHI1 protein or a gRNA targeting the coding gene of the CsSHI1 protein.

7. Use according to claim 6, characterized in that: The target sequence of the gRNA is shown in SEQ ID No: 1 from the 56th to the 78th from the 5' end.

Images