Application of a strain of Methylobacterium extorquens and its microbial inoculum

Abstract

The present invention discloses the application of a strain of Methylobacterium extorquens E26 in microbial inoculants, belonging to the field of microorganisms. The present invention relates to a strain of Methylobacterium extorquens E26, which is deposited in the Guangdong Microbial Culture Collection Center (GDMCC), and the deposit number is GDMCC No: 62943. The methylobacterium of the present invention is a Gram-negative bacterium that can use methanol as the sole carbon source for growth, does not produce spores, and has a relatively high relative abundance in the phyllosphere and rhizosphere, that is, a strain that can colonize both the phyllosphere and rhizosphere at the same time. The Methylobacterium extorquens E26 has excellent IAA secretion ability and ACC deaminase activity; and the microbial inoculant product of the methylobacterium can not only effectively promote the germination of plant seeds, improve the yield and fruit quality, but also can be effectively used in the prevention and control of anthracnose and leaf blight, and has important agricultural value and economic value.

Description

[0001] Related Applications

[0002] This application claims the priority of the patent application No. 202211415600.5 filed on November 12, 2022, and the entire disclosure of this patent application is incorporated herein by reference in its entirety. Technical Field

[0003] The present invention belongs to the field of microorganisms, relates to a strain of Methylobacterium extorquens, and specifically relates to the application of a strain of Methylobacterium extorquens in a microbial inoculant. Background Art

[0004] One-carbon organic compounds widely exist in nature. Methylotrophic bacteria are a type of microorganisms that can utilize non-C-C bond low-carbon compounds (such as methane, methanol, formaldehyde, etc.). Since most of these bacteria are rod-shaped, they are also called Methylobacterium. Bacillus methylotrophicus is a type of bacillus or coccus that can form spores and belongs to the biocontrol bacteria of the genus Bacillus. It belongs to the spore-forming Gram-positive bacteria. This type of bacteria is easy to culture and ferment, and in existing reports, the antagonistic mechanisms of this type of Bacillus with antibacterial peptides, proteases, and cellulases are the most common.

[0005] Methylobacterium is significantly different from Bacillus methylotrophicus. Methylobacterium is a Gram-negative bacterium that can use one-carbon compounds as a carbon source for growth (see the research progress of the metabolic network pathway and metabolic engineering transformation of methylotrophic bacteria, Yang Jing, et al., Bioprocess, Vol. 15, No. 6); it is the most common bacterial genus in the phyllosphere of plants; compared with Bacillus methylotrophicus, Methylobacterium does not produce spores and is Gram-negative.

[0006] Most of the Methylobacterium in the prior art are isolated from plant leaves and usually belong to phyllosphere bacteria, which have good colonization ability on leaves, that is, they have a relatively high abundance in the phyllosphere of plants. However, the phyllosphere is a special biological environment, and the structure and composition of the phyllosphere microbial community will be affected by multiple factors such as the environment and the host to a certain extent; for example, the phyllosphere environment usually has extreme environmental conditions such as high temperature, drought, and ultraviolet rays; in comparison, the rhizosphere environment is another important environment that needs to be considered.

[0007] For crops, their rhizosphere is in direct contact with the soil, allowing them to grow and survive rapidly in the soil and form an inherent microbial circle. The rhizosphere, as an ecosystem, plays a very important role in the operation of the microbial circle. Microorganisms colonizing the rhizosphere, root surface, or bound to the roots of plants can promote plant growth in a beneficial way. However, the premise for the growth-promoting effect of the rhizosphere is that the microorganisms can efficiently colonize the root surface of plants, and through beneficial active substances of microorganisms such as IAA, they can directly act on the plant roots. However, no Methylobacterium strains with high abundances in both the phyllosphere and rhizosphere of plants have been found yet.

[0008] Ethylene is a plant hormone produced by plants after converting methionine to 1-aminocyclopropane-1-carboxylic acid (ACC) through S-adenosylmethionine. It affects processes such as senescence, flowering, fruiting, and regulates fruit ripening. However, among the currently existing 52 Methylobacterium species, only limited strains, such as Methylobacterium oryzae CBMB20, have been found to have ACC deaminase activity.

[0009] Existing Methylobacterium is usually used for the control of fungal diseases. However, in actual field crop diseases, bacterial diseases and fungal diseases are the two major soil-borne diseases with the highest proportions in field crop diseases. Methylobacterium used for the control of fungal diseases and bacterial diseases has important commercial value for development into commercial products.

[0010] However, until now, no bacterial strains with high abundances in both the phyllosphere and rhizosphere of plants have been found in Methylobacterium; nor have Methylobacterium strains been found that can fix nitrogen in root nodules, secrete auxin (IAA) to promote plant growth regulation, and simultaneously have ACC deaminase activity to promote plant growth and effectively control fungal diseases and bacterial diseases in the field.

[0011] For the above reasons, compared with methylotrophic Bacillus, Methylobacterium is more difficult to isolate, culture, ferment, and develop into beneficial microbial inoculant products suitable for field crops. In fact, there are very few Methylobacterium developed as microbial agricultural products on the market currently. Screening out Methylobacterium torquescens strains with strong colonization abilities in both the phyllosphere and rhizosphere of plants from Methylobacterium and developing them into microbial fertilizer and microbial pesticide inoculant products, making full use of the carbon source in the phyllosphere, promoting crop growth, and being able to control crop bacterial diseases and fungal diseases, is of great significance for promoting the green agriculture and low-carbon circular agricultural industry.

[0012] In addition, since the strains of the present invention have excellent colonization ability in both the phyllosphere and rhizosphere, the products of the present invention can be used simultaneously for the prevention and control of crop diseases on leaves and fruits and seed coating; the methylobacterium of the present invention can be mixed with commercially available seed coating agents without losing its activity, can promote the health of seeds at the seedling stage, thereby achieving the purpose of increasing production and improving product quality, and can also maintain a good ecological environment while preventing and controlling bacterial and fungal diseases of crops and solving the problem of pesticide residues. The methylobacterium of the present invention is of great significance for the product development of microbial agriculture. Summary of the Invention

[0013] In view of the above problems, the object of the present invention is to provide the application of a strain of Methylobacterium extorquens E26 in microbial agents.

[0014] To achieve the above object, the technical solution adopted by the present invention is: Methylobacterium extorquens, deposited with the Guangdong Provincial Microbial Culture Collection Center (GDMCC), the deposit address is the 5th floor of Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou, Guangdong Province, and the deposit number is GDMCC No: 62943, and the deposit date is November 4, 2022.

[0015] The technical solution adopted by the present invention is: Bacillus velezensis, deposited with the Guangdong Provincial Microbial Culture Collection Center (GDMCC), the deposit address is the 5th floor of Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou, Guangdong Province, and the deposit number is GDMCC No: 61434, and the deposit date is January 15, 2021.

[0016] The Methylobacterium extorquens is named Methylobacterium extorquens E26; the 16S determination result of the Methylobacterium extorquens E26 is as shown in Sequence Listing SEQ ID NO.1, and the mxaF gene determination result is as shown in Sequence Listing SEQ ID NO.2. After testing, the Methylobacterium extorquens E26 of the present invention is a dual-excellent strain that can colonize both the leaf surface and rhizosphere, and has excellent IAA auxin secretion ability and ACC deaminase activity.

[0017] The present invention also claims to protect a Methylobacterium extorquens product, which is prepared from the Methylobacterium extorquens and includes a Methylobacterium extorquens fermentation broth and a Methylobacterium extorquens powder.

[0018] The present invention also claims to protect a microbial composition, which includes the Methylobacterium extorquens and / or the product described above.

[0019] Further, the composition also includes excipients.

[0020] Auxiliary materials mainly refer to materials not derived from the said Methylobacterium torques, such as the auxiliaries used when preparing seed coatings for the said Methylobacterium torques, or the auxiliaries with functions such as solubilization promotion, thickening, or the medicaments with prevention and control functions, or the hormones or drugs with functions of regulating plant growth, or other microorganisms and microbial metabolites, etc. Those skilled in the art of the present invention can select corresponding auxiliary materials according to the type, use or effect of the preparation to be prepared, all of which are within the protection scope of the present invention.

[0021] Preferably, the composition further comprises other prevention and control medicaments and / or growth promoters, such as insect control seed coating agents;

[0022] As a preferred embodiment of the present invention, the microbial composition is a seed coating agent, a coating agent or a seed dressing agent; the seed coating agent, the coating agent or the seed dressing agent comprises: (1) the said Methylobacterium torques and / or the said product, and / or (2) at least one of an insect control seed coating agent or a water-soluble film-forming agent, an adhesive;

[0023] Preferably, the insect control seed coating agent is thiamethoxam;

[0024] More preferably, the insect control seed coating agent is 35% thiamethoxam;

[0025] Preferably, the seed coating agent, the coating agent or the seed dressing agent makes the number of coating bacteria on the coated seeds greater than 1×10 4 seed / CFU; more preferably, the number of coating bacteria is 1.2X 10 4 seed / CFU.

[0026] The present invention also claims the use of the said Methylobacterium torques, the said Methylobacterium torques product, and the said microbial composition as a plant growth regulator.

[0027] As a preferred embodiment of the present invention, the functions of the plant growth regulator include at least one of promoting crop growth, promoting seed germination, increasing crop yield, and improving the quality of crop products;

[0028] Preferably, the promotion of crop growth includes promoting the growth of leaf area, promoting root growth, and increasing the root nodule rate; the increase in crop yield includes increasing the weight of crop products; the improvement of crop product quality includes increasing the protein content and / or fat content.

[0029] As a preferred embodiment of the present invention, the target objects of the plant growth regulator are corn, soybean and cucumber; preferably, the function of the plant growth regulator is to promote the germination of corn or soybean seeds and the growth of corn, soybean and cucumber.

[0030] After testing, after coating and dressing seeds with the fermentation broth of Methylobacterium of the present invention, the growth of corn seeds is more vigorous, and the growth indexes are significantly higher than those of corn seeds treated with non-coated or blank-coated seeds. The relative emergence rate of soybean seeds is higher, the soybean yield is significantly increased, and the contents of soybean protein and fat also increase to a certain extent. This indicates that the fermentation broth of Methylobacterium of the present invention can not only promote the germination and growth of soybean seeds, but also has the potential to improve the quality of soybeans.

[0031] The present invention also claims the use of the above-mentioned Methylobacterium thiocyanatum, the above-mentioned Methylobacterium thiocyanatum product, and the above-mentioned microbial composition in the prevention and control of crop diseases.

[0032] Preferably, the prevention and control of crop diseases include fungal diseases and / or bacterial diseases;

[0033] Preferably, the fungal diseases include diseases caused by Colletotrichum chrysophilum; the bacterial diseases include diseases caused by Xanthomonas oryzae.

[0034] Preferably, the crop diseases include fungal anthracnose diseases and / or bacterial bacterial blight diseases.

[0035] As a preferred embodiment of the present invention, the crops are peppers and rice.

[0036] As a preferred embodiment of the present invention, when the above-mentioned Methylobacterium thiocyanatum, the above-mentioned Methylobacterium thiocyanatum product, and the above-mentioned microbial composition are used for regulating plant growth and preventing and controlling crop diseases, they are applied through soil application and / or foliar application.

[0037] The advantages of the present invention are as follows:

[0038] The present invention discloses the use of a strain of Methylobacterium torquatum and its products as a plant growth regulator. The Methylobacterium torquatum E26 is deposited in the Guangdong Microbial Culture Collection Center (GDMCC), and the deposit number is GDMCC No: 62943. The Methylobacterium torquatum E26 and M173 of the present invention are both excellent strains that can colonize both the leaf surface and the rhizosphere, and have relatively high abundances in the phyllosphere and rhizosphere of plants. The Bacillus velezensis of the present invention can colonize well on the leaves; and the Methylobacterium torquatum E26 has excellent IAA secretion ability, ACC deaminase activity, and amino acid production ability, which have significance for the growth, flowering, fruiting of plants, improving crop quality, and controlling pathogenic bacteria. The experiments of the present invention prove that the mixed bacterium agent of the Methylobacterium torquatum E26 or E26 and M173 can be directly applied to plants, which can not only promote the germination of plant seeds and plant growth, but also effectively increase the yield, improve the fruit quality and quality. In addition, the mixed bacterium agent of the Methylobacterium torquatum E26, E26 and M173 can also be effectively used to control crop diseases, especially in the control of anthracnose and leaf blight, and can prepare corresponding plant growth regulators and plant disease control agents, which can reduce the use of pesticides and solve the problem of pesticide residues, and have important agricultural value and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Schematic diagram of the colonization ability of the Methylobacterium torquatum E26 of the present invention in the phyllosphere;

[0040] Figure 2 Results of the IAA auxin test experiment;

[0041] Figure 3 Results of the ACC deaminase ability test experiment;

[0042] Figure 4 Plate culture diagram of the Methylobacterium torquatum E26 of the present invention;

[0043] Figure 5 Morphological diagram of the cells of the Methylobacterium torquatum E26 of the present invention;

[0044] Figure 6 Phylogenetic tree diagram of the Methylobacterium torquatum E26 of the present invention;

[0045] Figure 7 Results of the growth of soybean roots under different treatments in the E26 experiment;

[0046] Figure 8 Results of anthracnose of pepper fruits under different treatments in the E26 experiment;

[0047] Figure 9 Results of rice bacterial blight under different treatments in the E26 experiment;

[0048] Figure 10 Growth results of cucumber seedlings with different treatments in Experiment E26.

[0049] Figure 11 Disease incidence results of rice bacterial blight leaves under different treatments with the mixed bacterium agent of E26 and M173 in the disease control experiment

[0050] Figure 12 Dry weight increase results of the mixed bacterium agent of E26 and M173 in the maize growth promotion experiment

[0051] Figure 13 Comparison of maize potted plant growth at different dilution multiples of the mixed bacterium agent of E26 and M173 in the maize growth promotion experiment Detailed implementation manners

[0052] To better illustrate the objectives, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0053] For information on Bacillus velezensis M173 involved in this embodiment, refer to CN114196602A; Bacillus velezensis M173 involved in the present invention includes all information disclosed in CN114196602A.

[0054] The technical solution adopted by the present invention is: Bacillus velezensis, deposited in the Guangdong Provincial Microbial Culture Collection Center (GDMCC), with the deposit address being the 5th floor of Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou, Guangdong Province, and the deposit number being GDMCC No: 61434, and the deposit date being January 15, 2021.

[0055] Example 1 Isolation and screening of Methylobacterium strains

[0056] Samples were collected from the leaves of kidney beans in the farmland in Haizhou District, Lianyungang City.

[0057] Take 1 g of kidney bean leaves, add them to 100 mL of sterilized Tween water with a concentration of 0.1%, use a handheld crusher to break the leaves, and take the leaf liquid for gradient dilution to 10 -2 、10 -3 concentrations, and culture them in AMS solid inorganic salt medium, and pick monoclonal colonies to obtain more than 1000 Methylobacterium strains in total.

[0058] The formula of AMS solid inorganic salt medium is as follows: 700 mg of dipotassium hydrogen phosphate anhydrous, 540 mg of potassium dihydrogen phosphate anhydrous, 1 g of magnesium sulfate heptahydrate, 500 mg of ammonium chloride anhydrous, 200 mg of calcium chloride dehydrated, 4 mg of ferric sulfate heptahydrate, 100 μg of zinc sulfate heptahydrate, 30 μg of manganese chloride tetrahydrate, 300 μg of boric acid anhydrous, 200 μg of cobalt chloride hexahydrate, 10 μg of copper chloride dehydrated, 20 μg of nickel chloride hexahydrate, 60 μg of sodium molybdate dehydrated, 15 g of agar, make up the volume to 1 L with water, and add 5 mL of methanol filtered through a 0.22 μm filter membrane after high-temperature sterilization.

[0059] I. Colonization ability test

[0060] Most Methylobacterium strains are isolated from plant leaves. This is because the methanol produced during photosynthesis in leaves provides nutrients for the growth of Methylobacterium. Thus, the strong colonization ability of Methylobacterium on leaf surfaces is one of its important characteristics. However, the phyllosphere is a special biological environment, and the structure and composition of the phyllosphere microbial community are to some extent affected by multiple factors such as the environment and the host; for example, the phyllosphere environment usually has extreme environmental conditions such as high temperature, drought, and ultraviolet radiation; in comparison, the rhizosphere environment is another important environment that needs to be considered.

[0061] For crops, their rhizospheres are in direct contact with the soil, and they can grow and survive quickly in the soil and form an inherent microbial circle; the rhizosphere, as an ecosystem, plays a very important role in the operation of the microbial circle. Microorganisms colonizing the rhizosphere, root surface, or combined with the roots can play a beneficial role in promoting plant growth. However, the premise of the growth-promoting effect of the rhizosphere is that the microorganisms can efficiently colonize the plant root surface, and through beneficial active substances of the microorganisms such as IAA, etc., they can directly act on the plant roots. In this application, a large number of strains were screened, and Methylobacterium strains with high abundances in both the phyllosphere and rhizosphere of plants were measured.

[0062] 1. Test method:

[0063] (1) Prepare fermentation broths of different Methylobacterium strains, and the process is as follows:

[0064] ① Inoculate the original Methylobacterium strain on a culture dish for activation, and then inoculate it on a test tube slant for standby;

[0065] ② Inoculate the strain in the test tube into a 250 mL shake flask containing 100 mL of AGPS medium, and culture it at a constant temperature of 28 °C with shaking until the logarithmic phase;

[0066] ③ Use a spectrophotometer to measure the concentration of the bacterial solution in the shake flask until the concentration of the bacterial solution reaches 10 9 cfu / mL, and thus obtain the Methylobacterium fermentation broth.

[0067] The formulation of the AGPS medium is as follows: 700 mg of dipotassium hydrogen phosphate anhydrous, 540 mg of potassium dihydrogen phosphate anhydrous, 1 g of magnesium sulfate heptahydrate, 500 mg of ammonium chloride anhydrous, 200 mg of calcium chloride dehydrated, 4 mg of ferric sulfate heptahydrate, 100 μg of zinc sulfate heptahydrate, 30 μg of manganese chloride tetrahydrate, 300 μg of boric acid anhydrous, 200 μg of cobalt chloride hexahydrate, 10 μg of copper chloride dehydrated, 20 μg of nickel chloride hexahydrate, 60 μg of sodium molybdate dehydrated, 10 g of glycerol, 10 g of peptone, add water to 1 L, and sterilize at high temperature.

[0068] (2) Soak the corn seeds in the strain fermentation broth, air dry and wait for them to germinate, and let them grow in the medium. At 15 days, detect the colonization of the strains on the leaf surface and rhizosphere respectively.

[0069] 2. Test results:

[0070] The test results of each test strain are shown in Table 1 (only showing some representative results).

[0071] Table 1 Number of colonized bacteria on the leaf surface and rhizosphere of PPFM

[0072]

[0073] From the test results in Table 1, it can be seen that some strains cannot colonize on both the leaf surface and rhizosphere, some strains can only colonize on the leaves, some strains can colonize on both the leaves and rhizosphere, and the strain E26 of this application is a double-excellent strain that can colonize on both the leaf surface and rhizosphere. The abundance of the tip bacteria of the Methylobacterium torulosum E26 involved in the present invention is 5.47E+04 CFU / cm 2 , and the abundance of the root tip bacteria is 2.33E+04 CFU / cm 2 , so the colonization ability of Methylobacterium torulosum E26 on the leaf surface ( Figure 1 ) and rhizosphere is the best among the screened Methylobacterium strains.

[0074] II. Test on the ability to secrete IAA auxin

[0075] (1) Qualitative test on the ability to secrete IAA auxin: IAA indoleacetic acid is essential for plants and is also the first plant hormone discovered, which has functions such as promoting root growth. Further test the secretion of IAA auxin by the strains through the IAA qualitative test (colorimetric method).

[0076] IAA test method: Inoculate the PPFM bacteria into 2 mL of LB medium containing L-tryptophan, and culture at 30 °C and 180 rpm for 48 hr. Take 50 μL of the bacterial suspension and drop it on a white ceramic plate, and at the same time add 200 μL of Salkowski colorimetric solution (1:4); use 50 μL of 50 mg / L IAA as a positive control. Place the white ceramic plate in the dark at room temperature for 30 minutes and then observe. (Preparation of Salkowski reagent colorimetric solution: 250 mL H 2 O, 150 mL H 2 SO 4 and 7.5 mL of 5M FeCl 3 .6H 2 O).

[0077] The test results are as Figure 2 shown: It can be seen from Figure 2 that after the fermentation broth of strain E26 reacts with the Salkowski colorimetric solution, the color shown is the darkest, and the ability of E26 to secrete IAA is significantly higher than that of other strains.

[0078] III. ACC deaminase ability test

[0079] Ethylene is a plant hormone produced by plants when methionine is converted to 1-aminocyclopropane-1-carboxylic acid (ACC) through S-adenosylmethionine. It affects processes such as senescence, flowering, fruiting, and regulation of fruit ripening. When encountering abiotic stress, the ethylene in plants will be at a relatively high level, and ethylene can be synthesized through ACC (1-aminocyclopropane-1-carboxylic acid). Strains with ACC deaminase activity can decompose ACC into ammonia and α-ketobutyric acid, thus reducing ethylene synthesis. Although there are more than fifty species of Methylobacterium, the strains with ACC deaminase activity are extremely rare. The present invention screens strains with ACC deaminase activity from multiple strains of Methylobacterium.

[0080] Test method for ACC deaminase ability:

[0081] Inoculate a single colony into 5 mL of fermentation medium, and culture at 28 °C and 120 rpm for 24 hrs. After fermentation, centrifuge the bacterial cells at 3000 g for 5 min, wash twice with 0.1M Tris-HCL (pH 7.5), and inoculate 1 mL of the bacterial suspension re-dissolved in 0.1M Tris-HCL (pH 7.5) onto the ADF medium (containing 3 mM ACC as the sole nitrogen source). The positive control is the NDF medium, and the negative control is the nitrogen-free (DF) medium.

[0082] DF salt medium (1L): MnSO 4 ·7H 2 O 0.2 g, KH 2 PO4 4.0 g of Na 2 HPO 4 6.0 g of citric acid, 2.0 g of glucose, 2.0 g of sodium gluconate, 0.1 mL each of the solutions of Component 1 and Component 2, H 2 O 1000 mL, pH 7.2. (Formulation of Component 1: CuSO 4 ·5H 2 O 78.22 mg, MoO 3 10 mg, H 3 BO 3 10 mg, ZnSO 4 ·7H 2 O 124.6 mg, MnSO 4 ·H 2 O 11.9 mg, dissolved in 100 mL of sterile distilled water above. Formulation of Component 2: FeSO 4 ·7H 2 O 100 mg, dissolved in 10 mL of sterilized distilled water and shaken well. Note: Both Component 1 and Component 2 are stored at -4°C for future use.)

[0083] ADF medium: Dissolve ACC in ultrapure water, filter-sterilize it with a bacterial filter, and add it to the DF salt medium that does not contain (NH 4 ) 2 SO 4 and has been pre-sterilized, pH 7.2. The final concentration of ACC added is 3.0 mmol / L. NDF medium: DF medium + 0.2% (NH 4 ) 2 SO 4 .

[0084] The test results are as Figure 3 shown (only showing some representative results). ACC is added to the ADF treatment group, there is no nitrogen source in the negative control group (DF), and ammonium sulfate is added as the nitrogen source to the positive control group (NDF) to exclude false positives.

[0085] It can be Figure 3 seen that only the Methylobacterium extorquens strains E26 and E07 of the present invention have ACC deaminase activity, indicating that strains E26 and E07 have stress resistance ability.

[0086] IV. Identification of Methylobacterium extorquens E26

[0087] The colonies of the isolated Methylobacterium extorquens E26 are opaque pink, circular in shape, protruding upward, with neat edges and are dry (as Figure 4 ). Observe its bacterial morphology under a high-power microscope as Figure 5 .

[0088] The sequences of this strain were amplified for the 16S sequence fragment and the mxaF gene respectively. The amplification primers and sequencing primers are as follows:

[0089] 16S sequence:

[0090] 27F: 5'-AGAGTTTGATCCTGGCTCAG-3';

[0091] 1492R: 5'-GGTTACCTTGTTACGACTT-3').

[0092] mxaF gene:

[0093] mxaF-f(f1003) 5'-GCGGCACCAACTGGGGCTGGT-3';

[0094] mxaF-r(r1561) 5'-GGGCAGCATGAAGGGCTCCC-3'.

[0095] The 16S determination result is shown in Sequence Listing SEQ ID NO.1, and the mxaF gene determination result is shown in Sequence Listing SEQ ID NO.2.

[0096] Through the 16S rRNA sequence homology analysis and phylogenetic analysis, and by BLAST homology alignment, we determined that the closest genus and species of this strain is Methylobacterium. Through the maxF sequence homology analysis and phylogenetic analysis, this Methylobacterium is Methylobacterium extorquens.

[0097] SEQ ID NO.1:

[0098]

[0099] SEQ ID NO.2:

[0100] ACGCCTACGATCCGGGCACGAACCTGATCTACTTCGGCACCGGCAACCCGGCGCCGTGGAACGAGACCATGCGTCCGGGCGACAACAAGTGGACGATGACGATCTTCGGCCGCGATGCCGATACGGGTGAAGCCAAGTTCGGCTACCAGAAGACCCCGCACGACGAGTGGGACTATGCCGGCGTCAACGTCATGATGCTCTCCGAGCAGAAGGACAAGGACGGCAAGGCCCGCAAGCTGCTGACCCACCCGGACCGCAACGGCATCGTCTACACGCTCGACCGGACCGACGGCGCGCTCGTCTCGGCGAACAAGCTCGACGACACGGTCAACGTGTTCAAGTCGGTGGATCTCAAGACGGGCCAGCCGGTGCGCGATCCCGAATACGGCACCCGGATGGACCACCTCGCCAAGGACATCTGCCCCTCGGCGATGGGTTACCACAACCAGGGTCACGACTCGTACGATCCGAAGCGTGAACTGTTCTTCATGGGCATCAACCACATCTGCATGGATT。

[0101] The sequences of Methylobacterium were obtained from the GenBank database, combined with the sequences of standard model bacteria in the NCBI database, and cluster analysis and phylogenetic tree construction were performed using the maximum likelihood method with MEGA 10.2.6 software. The constructed phylogenetic tree is as Figure 6 .

[0102] The isolated Methylobacterium extorquens E26 was deposited in the Guangdong Provincial Culture Collection of Microorganisms (GDMCC), with the deposit address being the 5th floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Guangdong Province. The deposit number is GDMCC No: 62943, and the deposit date is November 4, 2022.

[0103] Example 2 Effect of Methylobacterium extorquens E26 Seed Dressing on Soybean Seeds (Field Experiment)

[0104] Test time: May 5, 2020 to October 16, 2020

[0105] Test site: Experimental plot of Heihe Branch of Heilongjiang Academy of Agricultural Sciences, No. 345 Huancheng West Road, Aihui District, Heihe City, Heilongjiang Province

[0106] Soil conditions: The previous crop was sorghum, and the soil type was meadow dark brown soil; the application rate of nitrogen, phosphorus and potassium (N-P 2 O 5 -K 2 O) per mu was 1.3 - 2 - 3.3 kg, that is, 1.12 kg of urea, 4.35 kg of diammonium phosphate and 5.5 kg of potassium chloride per mu.

[0107] Using Heihe 52 soybean as the experimental material, three different treatment methods were used for seed dressing of soybeans (refer to Table 2). Among them, the control group was uncoated soybean seeds; the blank coating group was to coat the adjuvant on the soybean seeds; the Rhodococcus tropicus E26 treatment group was to coat the adjuvant and the fermentation broth of Rhodococcus tropicus E26 (the number of bacteria was 1 billion CFU / mL) on the soybean seeds. The adjuvant contains a water-soluble film-forming agent and an adhesive, which are mixed in a mass ratio of 5:2, dissolved in water to make the concentration of the water-soluble film-forming agent reach 0.05 g / mL and the concentration of the adhesive reach 0.02 g / mL, that is, the film-forming adjuvant is obtained.

[0108] Table 2 Treatment and dosage of microbial seed dressing agent products for soybean yield efficacy test

[0109]

[0110] The experiment adopted a randomized block design, with 6 rows, 20 m in length, 0.60 cm in row spacing, and the plot area was 72 m 2 , with 3 replicates for each treatment, and a protection row was set around the experiment. On May 4, 2020, the seeds were dressed with the microbial agent, and sown on May 5, 2020. The chemical fertilizers were applied once in spring in the form of seed fertilizers. Before the emergence of soybean seedlings, a mixture of 2,4-D, acetochlor and metribuzin was used for pre-emergence soil treatment according to the recommended dosage. At the V3 stage of soybean, bentazone, chlorimuron-ethyl and clethodim were used for post-emergence foliar treatment. The emergence rate of soybeans was investigated during the experiment and the growth status was recorded. Monitor and quantify the growth of soybeans at each stage, and the results are shown in Tables 3 - 5 and Figure 7 as shown.

[0111] Investigation of emergence rate: 30 days after the emergence of soybeans, 5-point sampling was adopted, and the average number of soybean plants with a length of 1.67 m (i.e., 1 m 2 ) was taken at each point. Based on the average number of emerged plants in the control group, the relative emergence rate of soybeans was calculated. The calculation method is: average number of emerged plants in the treatment group / average number of emerged plants in the control group × 100%.

[0112] Table 3 Emergence rate of soybeans treated with microbial seed dressing agent 30 days after sowing

[0113]

[0114] Note: Lowercase letters indicate the 5% significance level, and uppercase letters indicate the 1% significance level.

[0115] As can be seen from Table 3, the Methylobacterium thiocyanatum E26 of the present invention does not harm soybean seeds, can promote the germination of soybean seeds, and can improve the emergence rate of soybeans through the treatment with Methylobacterium thiocyanatum E26.

[0116] The investigation of soybean growth indicators can be reflected by plant height, pod number, and grain number: At the mature stage of soybeans (September 28th), 2 m is taken from each plot 2 for yield measurement. From each point, 10 plants are taken to investigate plant height, pod number, and grain number.

[0117] Furthermore, calculate the yield and 100-seed weight of soybeans: After the soybeans are harvested, they are dried, winnowed, and 100 intact and mature soybean grains are randomly selected and weighed (grams). Weigh two sets of 100 grains and take the average; the plot yield is the average yield of the sampling points.

[0118] Table 4 Effect of Methylobacterium thiocyanatum E26 on soybean yield

[0119]

[0120] Note: Lowercase letters indicate the 5% significance level, and uppercase letters indicate the 1% significance level.

[0121] As can be seen from Table 4, the treatment with Methylobacterium thiocyanatum E26 has a promoting effect on soybean yield. The mu yield of soybeans in the control group (mu yield = square meter yield × 667) is 75.84 kg, which is much less than the mu yield (85.42 kg) of the treatment with Methylobacterium thiocyanatum E26; the yield increase rate of soybeans treated with Methylobacterium thiocyanatum E26 is 12.64%. Compared with the control group and the blank coating group, the Methylobacterium thiocyanatum of the present invention has a significant promoting effect on the yield increase of soybeans. And it can be found under the 100-seed weight index that the treatment with Methylobacterium thiocyanatum E26 has the potential to increase the weight of soybean seeds.

[0122] Test the quality of soybeans. Test method: The quality of soybeans is tested using a 7200 near-infrared grain analyzer, and 200 g is randomly taken from each plot for analysis.

[0123] Table 5 Effect of Methylobacterium thiocyanatum E26 treatment agent on soybean quality (protein, fat)

[0124]

[0125] As can be seen from Table 5, the treatment with Methylobacterium thiocyanatum E26 has the potential to increase the protein accumulation in soybeans. Compared with the control group, the contents of protein and fat in soybeans treated with Methylobacterium thiocyanatum E26 increase by about 1.8%.

[0126] Furthermore, throughFigure 7 It can be seen that the soybean roots treated with *Methylobacterium torulosum* E26 grow vigorously and produce more root nodules.

[0127] Example 3 Application of *Methylobacterium torulosum* E26 in increasing maize yield

[0128] Test object: Maize seeds (Zhengdan 958)

[0129] Test method: Select maize seeds of similar size and randomly divide them into 4 groups (Experimental Group 1, Experimental Group 2, Blank Seed Coating Agent Coating Group, and Control Group). The maize seeds in each group are mixed with the coating agent at a weight ratio of 1:60, air-dried to obtain coated maize seeds for use.

[0130] Experimental Group 1: Coated maize seeds with a coating agent formed by adding *Methylobacterium* MN29385 (the strain in the patent document CN108753660A) to 35% thiamethoxam seed coating agent; Experimental Group 2: Coated maize seeds with a coating agent formed by adding *Methylobacterium torulosum* E26 to 35% thiamethoxam seed coating agent; Blank Seed Coating Agent Group: Coated maize seeds with 35% thiamethoxam seed coating agent; Control Group: Uncoated maize seeds.

[0131] And the remaining coated maize seeds are planted in small plastic pots with a diameter of 10 cm (the soil used is a mixture of carbon soil and perlite in a volume ratio of 2:1, used after sterilization). Three seeds are planted in each pot, with a total of 30 plants. The greenhouse experiment is repeated three times and arranged in a randomized block design. At the 20th day of the maize seedling stage, the average plant height, average stem length, stem diameter, and average fresh weight of the plants are measured.

[0132] In addition, 10 coated maize seeds from each group are placed in a centrifuge tube containing 10 mL of sterile water and shaken for 2 - 3 min to make the strains on the maize seeds fall off into the sterile water, and then diluted to 10 -2 、10 -3 , and the diluted solution is spread on an AMS plate for counting to calculate the average number of bacteria per coated seed in each group.

[0133] The average number of bacteria per coated maize seed in each group and the experimental results after 20 days of planting are shown in Table 6.

[0134] Table 6 Average number of bacteria per coated maize seed in each treatment group and physiological indicators

[0135]

[0136] As can be seen from Table 6, the average number of bacteria per single seed tested after coating *Methylobacterium torulosum* E26 with the commercially available seed coating agent thiamethoxam is 1.20E+04 CFU / Seed, which is significantly higher than that of Experimental Group 1, indicating that *Methylobacterium torulosum* E26 can be compatible with the seed coating agent and adhere to the surface of maize seeds, and its adhesion ability is better than that of other bacteria.

[0137] From the physiological indexes 20 days after planting, it can be seen that there is no significant difference in the growth of the blank seed coating group using the commercially available thiamethoxam seed coating agent alone and the non-coated group (control group); the physiological indexes of corn seeds in experimental groups 1 and 2 are better than those of the control group and the blank seed coating group. Moreover, the stem length, plant height, stem diameter and fresh weight of the corn seeds coated with Methylobacterium thiocyanatum E26 are significantly higher than those of other groups, indicating that Methylobacterium thiocyanatum E26 has a good effect on promoting the growth of corn.

[0138] After Methylobacterium thiocyanatum E26 colonizes on the seed surface and is coated with the blank seed coating agent, it can significantly promote the growth of corn plants. Compared with the blank coating, the plant height increases by 21.50%, the stem diameter increases by 11.63%, the health of the seedling stage is strengthened, and the biomass (fresh weight) increases by 48.55%. It is speculated that the accumulation of sugar substances is increased, and there is an obvious potential for increasing production. Thus, it can be seen that the combination of Methylobacterium thiocyanatum E26 and the commercially available insect control seed coating agent has high application flexibility and value in the field of microbial seed coating technology.

[0139] Application in the control of anthracnose disease in Example 4

[0140] Select pepper fruits with uniform size, no pests and diseases, basically the same maturity, and no mechanical damage. After cleaning, wipe and disinfect them with 75% alcohol, and dry them for later use. Activate Colletotrichum chrysophilum through PDA medium and culture it at 28°C for 5 - 7 days for later use.

[0141] Randomly divide the peppers into 5 groups (refer to Table 7): control group, positive group and 3 experimental groups; spray equal amounts of solution on the fruit surfaces of each group. Among them, the control group is water, the positive group is a 1000-fold dilution of fluazinam, and the experimental groups are the fermentation broth of Methylobacterium thiocyanatum E26 diluted 1000-fold, 1500-fold or 2000-fold (the original concentration is: 1 billion CFU / mL).

[0142] After the treatment, dry the surface of the peppers, and then inoculate the pepper pathogens. Prick the pepper fruits with a sterile toothpick, punch out the same anthracnose pathogen cakes with a sterile puncher, inoculate them at the wound of the pepper fruits, wet the sterilized cotton and cover the anthracnose cakes, and add water to keep the cotton moist regularly. Wrap them with a fresh-keeping bag and store them in an incubator at 28°C and a humidity of 85%. First, treat them with 24 hours of darkness, then 12 hours of light and 12 hours of darkness, and culture for 5 days.

[0143] Set 3 replicates for each treatment, 5 fruits for each replicate, and 3 needles for each fruit. Record the disease incidence such as the diameter of the disease spots and conduct data analysis.

[0144] Disease index = 100×Σ (disease level × number of fruits at this level) / (total number of fruits × highest disease level).

[0145] Control effect (%) = ((Disease index of negative control group - Disease index of experimental group) / Disease index of negative control group) × 100%.

[0146] Disease level:

[0147] 0: No disease spots;

[0148] 1: 0.10 cm < Disease spot diameter ≤ 0.40 cm;

[0149] 3: 0.40 cm < Disease spot diameter ≤ 0.70 cm;

[0150] 5: 0.70 cm < Disease spot diameter ≤ 1.00 cm, no mold or a small amount of mold layer on the disease spot;

[0151] 7: 1.00 cm < Disease spot diameter ≤ 1.50 cm, more mold layer on the disease spot;

[0152] 9: Disease spot diameter > 1.50 cm, a large amount of mold layer on the disease spot.

[0153] The experimental results are shown in Table 7 and Figure 8 as follows.

[0154] From Figure 8 it can be seen that within the test range, treating pepper fruits with different concentrations of Methylobacterium can effectively control Colletotrichum capsici, and the control effect increases with the decrease of concentration.

[0155] Table 7 Experimental results of Colletotrichum capsici on pepper fruits

[0156] Treatment Disease index Relative control efficacy % Control group 45.61±11.54a - Methylobacterium thiocyanatum E26 - 1000x 20.12 ± 7.62bc 55.89％ Methylobacterium thiocyanatum E26 - 1500x 16.63 ± 5.37bc 63.54％ Methylobacterium thiocyanatum E26 - 2000x 11.58±0.58c 74.61％ (Positive group) Fluazinam - 1000x 11.88±0.79c 73.95％

[0157] From Table 7, it can be seen that after treatment with Methylobacterium nitroreducens E26, the growth of Colletotrichum capsici pathogen on pepper fruits can be effectively prevented. Using a dilution of 1000 - 2000 times dilution solution has an obvious control effect, and the control effect is between 63% and 74%, showing good potential for field control of Colletotrichum capsici on peppers. Within the test range, the lower the dilution concentration of Methylobacterium, the higher the relative control effect: the relative control effect obtained with a dilution of 2000 times dilution solution is significantly better than that of 1500 times dilution solution, and the relative control effect obtained with 1500 times dilution solution is better than that of 1000 times dilution solution; the control effect of 2000 times dilution solution is better than that of the positive control fluazinam.

[0158] Example 5 Application on rice leaf blight

[0159] Rice seedling raising: Plant the germinated rice seedlings in small buckets filled with high-quality soil, with 1 seedling planted in each pot. Only water is poured in the early stage, and 1 L of 0.1% NPK water-soluble fertilizer is irrigated in batches in the later stage to promote growth. Wait until the rice grows to the tillering stage with more leaves for inoculation operation.

[0160] Control group: The rice leaves were sprayed with clear water, and after the leaf surface was dried, pathogen inoculation was carried out.

[0161] Bismerthiazol: For the bismerthiazol treatment, 100 μM of the chemical agent was mixed with the pathogen solution, and after treatment at 28 °C for 2 h, rice was inoculated using the leaf clipping method.

[0162] Treatment with Methylobacterium thiocyanatum E26: The fermentation broth of Methylobacterium thiocyanatum E26 with a bacterial count of 1 billion CFU / mL was diluted to two multiples of 50 and 500 times respectively, and uniformly sprayed on the rice leaves at a dosage of 10 mL per plant. After the leaf surface was dried, pathogen inoculation was carried out.

[0163] Pathogen inoculation: The rice bacterial blight pathogen strain, Xanthomonas oryzae, was cultured in LB medium until the OD600 was approximately 2.0. The bacterial cells were collected by centrifugation and the OD600 was adjusted to 0.8. Then, the rice was inoculated using the leaf clipping method. For each treatment (refer to Table 8), 10 leaves were inoculated. After inoculation, the plants were continuously cultured. After 14 days, photos were taken and the lesion lengths were measured. The control effects of each group of treatments are as follows Figure 9 , and the statistical analysis results are shown in Table 8.

[0164] Table 8 Control effect of E26 on rice bacterial blight

[0165]

[0166] It can be Figure 9 seen that the treatment with Methylobacterium thiocyanatum E26 can effectively control rice bacterial blight, and within the test range, the effect improves with the increase in concentration.

[0167] As can be seen from Table 8, the 50-fold and 500-fold diluted solutions of the treatment with Methylobacterium thiocyanatum E26 have good control effects on rice bacterial blight, can significantly reduce the lesion length, and the control efficacy is above 60%, which is better than the chemical agent bismerthiazol.

[0168] Example 6 Application of Methylobacterium thiocyanatum E26 by rhizosphere irrigation in cucumber seedling stage

[0169] Indoor potted plants of cucumber seedlings were carried out using plastic pots with a diameter of 10 cm. When the cucumber seedlings grew to 7 days old, plants with consistent growth were selected for the experiment and randomly divided into two groups. Each treatment group had 18 seedlings (each treatment group had 6 pots of cucumber seedlings, and each pot had 3 seedlings), and each treatment was repeated three times. One group was watered with 50 mL of the fermentation broth of Methylobacterium thiocyanatum E26 per plant, and the bacterial count of this fermentation broth was 1.00E+08 CFU / mL; the other group was watered with an equal amount of clear water. Topdressing was carried out once 7 days after the first application, and the physiological index of the leaf area (leaf length * leaf width) of the first true leaf was measured 14 days after the second application. The results are shown in Table 9 and Figure 10 as follows.

[0170] Table 9 Growth promotion effect of Methylobacterium torquatum E26 on cucumber leaves

[0171] Treatment Average leaf area Water control 7.168±0.683 Treatment with Methylobacterium thiocyanatum E26 21.350±0.441

[0172] From Figure 10 it can be seen that Methylobacterium torquatum E26 promotes the growth of the above-ground part of cucumbers, and the leaf area of cucumber seedlings increases significantly after treatment with Methylobacterium torquatum E26.

[0173] From Table 9, it can be seen that after treatment with Methylobacterium torquatum E26, the average value of the leaf area of cucumber seedlings increases significantly compared with the clear water control group, and the growth rate is 197.85%. Promoting the growth of leaf area can achieve the purpose of increasing the photosynthetic efficiency of crops and promoting the accumulation of crop nutrients.

[0174] Example 7 Determination of the amino acid production ability of Methylobacterium torquatum E26

[0175] This application has confirmed through indoor pot experiments and field double experiments that Methylobacterium torquatum E26 has the effects of promoting crop growth, increasing crop yield, and improving crop product quality. Next, the reason for its above-mentioned effects is further explained by testing the amino acid production ability of Methylobacterium torquatum E26.

[0176] Amino acid determination method:

[0177] 1) Take 1 mL of the sample to be hydrolyzed, add 600 μL of 6 M hydrochloric acid, and hydrolyze at 110 °C for 16 h;

[0178] 2) After hydrolysis, perform rotary evaporation and concentration;

[0179] 3) Re-dissolve with 1 mL of methanol and filter through a 0.22 μm microporous filter membrane;

[0180] 4) Perform LC-QQQ quantitative analysis on the filtered sample, and calculate the amino acid content in the sample according to the amino acid standard curve. The results are shown in Table 10.

[0181] From the results in Table 10, it can be seen that Methylobacterium torquatum E26 has the ability to produce high yields of various amino acids such as tryptophan, L-aspartic acid, 2-aminobutyric acid, valine, alanine, arginine, and glutamic acid. Amino acids play a role in improving crop quality, enhancing crop metabolism, and promoting crop growth. For example, tryptophan, as a precursor for the synthesis of the endogenous hormone auxin indoleacetic acid IAA, can promote the growth of plant flowers and fruits; aspartic acid can improve the synthesis of nutritional compounds such as proteins in crops and provide nitrogen for plant growth during stress periods; glutamic acid can improve the resistance of plants in stress environments, etc. That is, the high amino acid production ability of E26 provides multiple guarantees for plant growth.

[0182] Table 10 Amino acid production capacity of Methylobacterium extorquens E26

[0183]

[0184] Example 8 Preparation of E26+M173 mixed inoculant

[0185] (1) Inoculate the activated single colony of M173 into LB liquid medium (formula: peptone 10 g, yeast extract 5 g, sodium chloride 5 g, glucose 1 g, add water to 1 L, sterilize at 121 °C for 20 min), ferment at 30 °C and 200 rpm for 24 h to obtain M173 seed liquid; then inoculate the seed liquid into the medium (formula: glucose 30 g, soy peptone 20 g, yeast extract 10 g, dipotassium hydrogen phosphate 2 g, magnesium sulfate 0.1 g, manganese sulfate 0.01 g, make up the volume to 1 L) according to the inoculation amount of 1% - 5% (v / v), culture at 37 °C and 200 rpm for 24 h - 48 h, and take the time when the number of bacteria in the fermentation broth is about 11 billion cfu / mL as the fermentation end point.

[0186] (2) Inoculate the activated E26 into AGPS liquid medium, culture at 30 °C and 200 rpm for 72 - 96 h until OD≥5.0 to obtain E26 seed liquid; then inoculate the seed liquid into the fermenter containing AGPS medium according to the inoculation amount of 5% (v / v), set the fermentation temperature at 30 °C, the aeration rate at 0.5 - 1.2 vvm, adjust the stirring speed (200 - 700 rpm) according to the dissolved oxygen DO value≥20%, and adjust the pH to about 7.0 with NaOH solution. During the fermentation process, according to the glycerol content in the medium, supplement the feeding medium (feeding medium formula: glycerol 400 g, ammonium sulfate 60 g, make up the volume to 1 L with water, sterilize and reserve) to control the glycerol content at 5 - 10 g / L, and take the time when OD≥35 and the viable bacteria count is about 5 billion cfu / mL in the fermenter as the fermentation end point.

[0187] (3) Mix the M173 fermentation broth in step (1) and the E26 fermentation broth in step (2) according to the volume ratio (V / V) of 8:2 to prepare the E26+M173 mixed inoculant. The ratio of the number of bacteria of M173 and E26 in the mixed inoculant is about 9:1, that is, the number of M173 bacteria in the E26+M173 mixed inoculant is about 9 billion cfu / mL, and the number of E26 bacteria is about 1 billion cfu / mL.

[0188] Example 8 Application of E26+M173 mixed inoculant in controlling rice bacterial blight on the leaf surface

[0189] Activation of pathogenic bacteria: Streak the rice bacterial blight pathogen strain Xanthomonas oryzae on PSA solid medium and incubate it in an inverted position in an incubator at 28°C for 3 - 5 days (solid culture). Pick single colonies from the plate and inoculate them into M210 rich medium, and shake culture at 28°C and 220 rpm for 15 hours (liquid culture) to obtain a bacterial solution with an OD value of 3.95. Adjust the bacterial solution to OD = 0.8 and set aside. (PSA solid medium: Each liter of medium contains 10 g of sucrose, 10 g of peptone, 1 g of sodium glutamate, and 15 g of agar. M210 rich medium: Each liter of medium contains 5 g of sucrose, 8 g of enzymatically hydrolyzed casein (sigma), 4 g of yeast extract, 0.3 g of magnesium sulfate heptahydrate, 3 g of dipotassium hydrogen phosphate anhydrous, pH 7.0.)

[0190] Rice seedling raising: Hydroponically culture rice seeds (Nipponbare) in a constant temperature incubator for one week. After the rice seeds germinate (the bud length is about 3 cm), transplant the rice seedlings into the greenhouse and pot-cultivate them using peat soil mixed with nutrient soil. Plant 2 seedlings per pot, with every 2 pots as one treatment, and repeat each treatment 2 times. Culture conditions: Light culture for 16 h at 30°C and dark culture for 8 h at 26°C. Before the rice grows to tillering, has more leaves, and forms ears, perform foliar spraying treatment, and it is appropriate that the leaf surface is covered with water droplets during spraying. A total of 7 treatment groups are set according to different spraying substances, and the foliar spraying substances for each treatment are shown in Table 11.

[0191] Table 11 Foliar spraying situation of each treatment group

[0192]

[0193]

[0194] Note: Mixed bacterium agent - 500× refers to the 500-fold dilution of the E26 + M173 mixed bacterium agent, and so on.

[0195] Inoculation of pathogenic bacteria: Two days after the foliar spraying treatment, use the leaf-cutting method to inoculate the rice leaf Xanthomonas pathogenic bacteria. During inoculation, dip the scissors into the pathogenic bacteria solution and cut the leaf 5 cm from the leaf tip. Inoculate 10 - 15 leaves per pot, and observe the length of the rice disease spots and record and take pictures after 15 days. The control effects of each treatment group are referred to as Figure 11 , and the statistical analysis results are shown in Table 12.

[0196] Table 12 Disease spot length of rice leaves and control effect on bacterial blight under different treatments

[0197]

[0198] As can be seen from the above table, the control effect of the E26+M173 mixed microbial agent against rice bacterial blight was 13.55% after being diluted 2,000 times, which was equivalent to that of the chemical agent thiodiazole copper (13.35%), and was much higher than that of the same type of microbial agent Bizhuan (Bacillus velezensis) at a 500-fold dilution (6.86%). In addition, when the dilution multiple of the E26+M173 mixed microbial agent was in the range of 500 to 1,500 times, its control effect against rice bacterial blight was between 29.03% and 39.67%. The control effect was the best when diluted 1,000 times, and the length of the leaf lesions on the rice leaves was significantly reduced.

[0199] Example 9 Application of the E26+M173 Mixed Microbial Agent in Promoting Maize Growth (Foliar Spraying)

[0200] Test object: Maize (Zhengdan 958)

[0201] Test method: Plant the germinated maize seedlings with uniform growth in small pots filled with high-quality soil, with 2 plants planted in each pot, and each treatment is repeated 3 times, for a total of 36 seedlings. According to the different spraying substances, it is divided into six treatments. The spraying substances of each treatment group are shown in Table 13. The first foliar spraying is carried out 16 days after planting the maize seedlings, and the second spraying is carried out after an interval of 7 days. The whole test period is sprayed 2 times in total, with the leaves evenly sprayed. If there is a drought situation during the test period, then irrigate with 0.01% NPK water-soluble fertilizer.

[0202] After the second spraying is completed, randomly select leaves to measure the colonization of leaf surface strains. One week later, harvest the seedlings and record the physiological data such as the plant height (plant height: the distance from the root neck to the growth point), stem diameter (measured based on the part below the first true leaf), and dry weight of the maize seedlings in each treatment group, and conduct data statistical analysis. Taking a 10% increase in biomass as the growth promotion standard. The growth promotion effects of each treatment on maize are as Figure 12 , and the statistical analysis results are shown in Table 14.

[0203] Table 13 Foliar Spraying Conditions of Each Treatment Group

[0204] Number Treatment Spray 1 Mixed bacterial agent - 500× 500 - fold dilution of E26 + M173 mixed bacterial agent 2 Mixed bacterial agent - 1000× 1000 - fold dilution of E26 + M173 mixed bacterial agent 3 Mixed bacterial agent - 2000× 2000 - fold dilution of E26 + M173 mixed bacterial agent 4 E26-1000× 1000 - fold dilution of E26 fermentation broth 5 10% PY03 - 1000× 1000 - fold dilution of 10% PY03 water - soluble fertilizer 6 CK Water

[0205] Note: Mixed microbial agent - 500× refers to the 500-fold dilution of the E26+M173 mixed microbial agent, and so on.

[0206] Table 14 Effects of Treatments on Maize Growth Indexes

[0207]

[0208] Note: Mixed bacteria refer to the E26+M173 mixed microbial agent, mixed bacteria - 500× refers to the 500-fold dilution of the E26+M173 mixed microbial agent, and so on.

[0209] Six treatment groups showed no significant differences in plant height, stem diameter, and dry weight per plant underground. However, the 1000-fold dilution of E26 exhibited better growth-promoting effects on above-ground and underground dry weights, with growth rates of 12.31% and 16.70% respectively for above-ground and underground dry weights.

[0210] For the treatment group with the E26+M173 mixed inoculant, the maize plants were leaf-sprayed at three concentrations of 500-fold, 1000-fold, and 2000-fold dilutions. The results showed that for the mixed inoculant at the 1000-fold dilution, the growth rates of above-ground and underground dry weights of maize were 33.53% and 15.50% respectively, which were significantly higher than those of the mixed inoculant at other dilution multiples. Moreover, the growth rate of above-ground dry weight at the 1000-fold dilution was also significantly higher than that of the E26 treatment group, while the underground dry weight rate was comparable to that of the E26 treatment group. This indicates that the combined use of E26 and M173 can further improve the growth-promoting effect of the inoculant, especially in enhancing the above-ground dry weight of the crop.

[0211] Example 10 Determination of the Colonization Ability of the E26+M173 Mixed Inoculant

[0212] It has been fully verified above that the Methyobacterium torulosum E26 strain is an excellent strain that can colonize both the rhizosphere and leaves. Next, it is necessary to further explore the colonization ability of Bacillus velezensis M173 in leaves and the rhizosphere in order to further understand the industrial feasibility of the compound inoculant.

[0213] Based on the fact that Bacillus velezensis M173 was isolated from the rhizosphere soil of plants, its colonization ability in the plant rhizosphere is beyond doubt, and its colonization ability in leaves is determined as follows:

[0214] After the second leaf-spray of the maize seedlings in Example 9 was completed, the leaves of the maize seedlings treated with the 500-fold dilution of the E26+M173 mixed inoculant were cut in a rectangular shape to measure the area of each leaf. Then, the surface debris was washed clean with sterile water, and the leaves were crushed and diluted for plating. After culturing in LB medium for 24 h, the number of Bacillus velezensis bacteria (counted as the number of bacteria per unit area cfu / cm 2 was counted), and each treatment was repeated 3 times. The measurement results are shown in Table 15.

[0215] Subsequently, the 16S sequence fragment of the obtained Bacillus velezensis was determined (the amplification primer and sequencing primer were 27F: 5'-AGAGTTTGATCCTGGCTCAG-3' and 1492R: 5'-GGTTACCTTGTTACGACTT-3' respectively). The determination result was subjected to blast homology sequence alignment with the 16S sequence of the M173 strain (SEQ ID NO.1 in CN114196602A), and the alignment result was 99.93%, indicating that the Bacillus velezensis colonized on the leaves was the M173 strain of Bacillus velezensis.

[0216] Table 15 Number of Colonized Bacteria of Strain M173 on Leaves

[0217] Spray Measured component <![CDATA[Total bacterial count (cfu / cm 2 )]]> Mixed bacteria - 500× Leaf M173 <![CDATA[5.8*10 4 >

[0218] As can be seen from Table 15, the number of Bacillus velezensis M173 bacteria on the leaves of corn seedlings treated with a 500-fold dilution of the E26+M173 mixed bactericide was 5.8*10 4 cfu / cm 2 . That is, like E26, M173 has excellent colonization ability in both leaves and rhizosphere. Therefore, the E26+M173 mixed bactericide can effectively colonize in the rhizosphere and leaves, and its industrialization prospect is considerable.

[0219] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than limiting the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. Use of Methylobacterium extorquens in preparing seed coating agents, characterized in that, the preservation number of the Methylobacterium extorquens is GDMCC No: 62943.

2. The use according to claim 1, characterized in that, the seed coating agent includes: (1) the Methylobacterium extorquens described above and / or (2) at least one of insect control seed coating agents or water-soluble film-forming agents and adhesives.

3. The use according to claim 2, characterized in that, the insect control seed coating agent is thiamethoxam.

4. The use according to claim 3, characterized in that, the insect control seed coating agent is 35% thiamethoxam.

5. The use according to any one of claims 1-4, characterized in that, The seed coating agent makes the number of coated bacteria on the coated seeds greater than 1×10 4 CFU / seed.

6. The use according to claim 5, characterized in that, The number of coated bacteria is 1.2X 10 4 CFU / seed.

7. Use of Methylobacterium extorquens in preparing products for controlling plant fungal diseases and / or plant bacterial diseases, characterized in that, the preservation number of the Methylobacterium extorquens is GDMCC No: 62943.

8. Use of Methylobacterium extorquens in controlling crop diseases, characterized in that, the preservation number of the Methylobacterium extorquens is GDMCC No: 62943.

9. The use according to claim 8, characterized in that, the control of crop diseases includes fungal diseases and / or bacterial diseases.

10. The use according to claim 9, characterized in that, the fungal diseases include diseases caused by Coletotrichum chrysophilum; the bacterial diseases include diseases caused by Xanthomonas oryzae.

11. The use according to claim 9, wherein the crop diseases include fungal anthracnose diseases and / or bacterial bacterial blight diseases.

12. The use according to any one of claims 8-11, characterized in that, the crops are field crops or leafy vegetables or root and tuber crops or fruit trees.

13. The use according to claim 12, characterized in that, the crops are chili peppers, rice, potatoes, carrots, strawberries, grapes, citrus fruits, bananas, kiwifruits, pitayas, tomatoes, chili peppers, beans, ginger, pseudo-ginseng or ginseng.

14. The use according to any one of claims 7-11 or 13, characterized in that, by soil application and / or foliar application.

15. Use of Methylobacterium extorquens in regulating plant growth, characterized in that, the preservation number of the Methylobacterium extorquens is GDMCC No: 62943.

16. The use according to claim 15, characterized in that, the regulation of plant growth includes at least one of promoting crop growth, promoting seed germination, increasing crop yield, and improving crop product quality.

17. The use according to claim 16, characterized in that, The promoting of crop growth includes promoting the growth of leaf area, promoting root growth, and increasing the nodulation rate; the increasing of crop yield includes increasing the weight of crop products; the improving of crop output quality includes increasing the protein content and / or fat content.

18. The use according to claim 17, characterized in that the object of regulating plant growth is corn, soybean and cucumber.

19. The use according to claim 17, characterized in that the effect of regulating plant growth is to promote the germination of corn or soybean seeds and the growth of corn, soybean and cucumber.

20. A microbial composition, characterized in that the composition includes Methylobacterium extorquens and Bacillus velezensis; the composition also includes other control agents and / or growth promoters; wherein, the preservation number of the Methylobacterium extorquens is GDMCC No: 62943, and the viable count of the Methylobacterium extorquens accounts for at least 10% of the total viable count of the composite microbial composition.

21. The microbial composition according to claim 20, characterized in that the viable count of the Methylobacterium extorquens accounts for at least 20% of the total viable count of the composite microbial composition.

22. The microbial composition according to claim 20, characterized in that the volume ratio of the fermentation broth of Methylobacterium extorquens to Bacillus velezensis is 2:8 (V / V).

23. The microbial composition according to claim 20, characterized in that the preservation number of the Bacillus velezensis is GDMCC No.61434.

24. The microbial composition according to any one of claims 20-23, characterized in that the composition further includes at least one agriculturally or horticulturally acceptable carrier.

25. The microbial composition according to claim 24, characterized in that the carrier can improve the coating property of the strain on the seeds.

26. The microbial composition according to any one of claims 20-23, characterized in that the composition further includes one or more of insecticides, plant nutrients, fertilizers, herbicides, fungicides, nematicides, insecticides, acaricides, molluscicides.

27. The microbial composition according to any one of claims 20-23, characterized in that the composition is a seed coating agent, a coating agent or a seed dressing agent; the seed coating agent, the coating agent or the seed dressing agent includes: (1) the Methylobacterium extorquens described above and / or (2) at least one of an insect control seed coating agent or a water-soluble film-forming agent and an adhesive.

28. The microbial composition according to claim 27, characterized in that the insect control seed coating agent is thiamethoxam.

29. The microbial composition according to claim 28, characterized in that the insect control seed coating agent is 35% thiamethoxam.

30. The microbial composition according to claim 29, characterized in that The seed coating agent, film coating agent or seed dressing agent makes the number of coated bacteria on the coated seeds greater than 1×10 4 CFU / seed.

31. The microbial composition according to claim 30, characterized in that The number of coated bacteria is 1.2X 10 4 CFU / seed.

Images