Ecdoin synthetic strain and its construction method and application

Abstract

The invention discloses an ectoine synthetic strain and a construction method and application thereof. The strain is synthesized by knocking out a gene crr Overexpression in host bacteria ectABC Gene clusters and lysC Gene acquisition; the host bacteria is Escherichia coli ( Escherichia coli )MG1655; crr The nucleotide sequence of the gene is as shown in SEQ ID NO: 1; ectABC The nucleotide sequence of the gene cluster is shown in SEQ ID NO: 2; lysC The nucleotide sequence of the gene is shown in SEQ ID NO: 3. The strain of the present invention can efficiently synthesize ectoine by optimizing the metabolic pathway, fundamentally reducing the production cost of ectoine, and can achieve a yield of 115g / L and a yield of 0.45g / g glucose, which is close to the highest yield reported in the prior art and greatly improves the yield.

Description

Technical Field

[0001] The present invention belongs to the technical field of synthetic biology and relates to an ectoine synthetic strain and a construction method and application thereof. Background Art

[0002] Ecdoin, also known as tetrahydropyrimidine, is a derivative of cyclic amino acids and an important compatible solute. Ecdoin is the most widely used compatible solute in salt-tolerant microorganisms and can help organisms resist the stress of high osmotic pressure. Among the known compatible solutes, such as trehalose, glutamic acid and betaine, Ecdoin has a strong cell protection ability.

[0003] Because of its long-lasting moisturizing effect, it is widely used in the fields of cosmetics, medicine, etc. Ecdoin is a more effective long-lasting moisturizer than glycerin. It can reduce the damage of ultraviolet and visible light to cells in many ways. It can protect the skin from oxidative damage and fight skin aging. It is also an excellent biofunctional stabilizer, skin protectant and potential drug. Due to its wide application in the fields of cosmetics, medicine, etc., the annual demand for Ecdoin is about 15,000 tons, the market size is billions of dollars, and the retail price is about 1,000 US dollars per kilogram.

[0004] At present, in the fermentation process of Ecdoin, there are two paths of using wild bacteria fermentation and engineered bacteria. Wild bacteria fermentation generally requires a high-salt environment, which corrodes the fermentation equipment more seriously and has a low yield. The engineered bacteria based on Escherichia coli and Corynebacterium glutamicum have higher production potential, but it is also necessary to further improve the yield to reduce production costs. At the same time, the existing high-yield Ecdoin strains have a lower yield (less than 0.3g / g glucose), which also leads to higher production costs. Therefore, there is a need for a synthetic strain of Ecdoin that can produce high yields of Ecdoin and has a higher yield and a fermentation method. The present invention is implemented in Escherichia coli MG1655, and the yield is effectively improved by knocking out the branch, and the expression amount is moderate, and the modified pCDFduet is used to carry out multi-plasmid simultaneous overexpression to reduce the burden of a single plasmid and increase carbon flow. Finally, a strain of Ecdoin production strain and a fermentation method thereof are obtained, which has a higher yield and production rate, and reaches the highest yield reported in the current high-yield strain. Summary of the invention

[0005] The first object of the present invention is to provide an ectoine synthetic strain.

[0006] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0007] A synthetic strain of ectoine is obtained by knocking out the crr gene in a host bacterium, overexpressing the ectABC gene cluster and overexpressing the lysC (C1055T) gene using another plasmid with a moderate expression amount; the host bacterium is Escherichia coli MG1655; the nucleotide sequence of the crr gene is shown in SEQ ID NO: 1; the nucleotide sequence of the ectABC gene cluster is shown in SEQ ID NO: 2; the other plasmid is a pCDFduet plasmid in which the promoter is replaced by a trc promoter; the lysC gene comes from Escherichia coli MG1655, has an anti-feedback inhibition mutation (C1055T), and its nucleotide sequence is shown in SEQ ID NO: 3.

[0008] The second object of the present invention is to provide a method for constructing the above-mentioned strain, comprising:

[0009] The crr gene in Escherichia coli MG1655 was knocked out using Crispr-Cas9 technology;

[0010] Amplify the gene sequence of the ectABC gene cluster, insert it into the vector plasmid by enzyme digestion and one-step cloning to obtain the expression plasmid;

[0011] Amplify the lysC gene sequence, mutate it by enzyme digestion and clone, and insert it into another vector plasmid to obtain an expression plasmid;

[0012] The expression plasmids are introduced into the host bacteria respectively to obtain the ectoine synthetic strain.

[0013] As a preferred embodiment, the vector plasmid for inserting the ectABC gene cluster is pTrc99a.

[0014] As a preferred embodiment, the vector plasmid for inserting the lysC gene is selected from pCDFtrc, which is a pCDFduet plasmid with a modified trc promoter. The pCDFduet plasmid and the pTrc99a plasmid are amplified using the following two pairs of primers, respectively, and connected using one-step cloning to obtain the plasmid pCDFtrc:

[0015] pCDF KF: 5'-CTGAAACCTCAGGCATTTGAG-3'

[0016] pCDF KR: 5'-ATTTCCTAATGCAGGAGTCGC-3'

[0017] trcP2-F:

[0018] 5'-GCGACTCCTGCATTAGGAAATGTTGACAATTAATCATCCGGCTC-3'

[0019] trcP2-R:

[0020] 5'-CTCAAATGCCTGAGGTTTCAGGTCTCATGAGCGGATACATATTTG-3'

[0021] As a preferred embodiment, the following primers are used to amplify the ectABC gene cluster gene sequence:

[0022] ectAF:

[0023] 5'-CATGGAATTCGAGCTCGGTACCATGAGCACGCCAATAATAACC-3'

[0024] ectCR: 5'-CAGGTCGACTCTAGAGGATCCCTCACCAGTAGGTGCGGCG-3'.

[0025] As a preferred embodiment, the following two pairs of primers are used to amplify the lysC gene cluster gene sequence respectively:

[0026] eclysC P1A-F:

[0027] 5'-TGGAATTCGAGCTCGGTACCTGACACGAGGTAGTTATGTC-3'

[0028] ectOv-eclysC P1-R:5'-TCAAGGATTAATGCCACGCT-3'

[0029] ectOv-eclysC P2-F: 5'-AGCGTGGCATTAATCCTTGA-3'

[0030] eclysC P2-R: 5'-CAGGTCGACTCTAGAGGATCCCTGTTACTCAAACAAATTACTATGCAG-3'.

[0031] The third object of the present invention is to provide the application of the above-mentioned strain in the fermentation production of ectoine.

[0032] As a preferred embodiment, the fermentation medium for strain fermentation consists of: 20-30 g / L carbon source, 6 g / L nitrogen source, 1 g / L sodium citrate dihydrate, 2 g / L potassium dihydrogen phosphate, 1.2 g / L magnesium sulfate, 0.1 g / L iron sulfate, and 0.1 g / L manganese sulfate.

[0033] The carbon source is at least one of glucose, fructose or glycerol, the nitrogen source is ammonium chloride or ammonium sulfate, the culture medium does not contain an organic nitrogen source, the price is low and it is conducive to product separation.

[0034] As a preferred embodiment, when fermenting in a fermenter, the carbon source is added by feeding to maintain the carbon source concentration at 1-5 g / L.

[0035] As a preferred embodiment, when fermenting in a fermenter, the inducer IPTG is added when the OD reaches 5-8, and the final concentration is 0.1 mmol.

[0036] As a preferred embodiment, the method of using the strain to ferment and produce ectoine is as follows:

[0037] Streak the ectoine synthetic strain onto solid LB medium and culture at 35-39° C. for 8-16 h;

[0038] Pick the cultured bacteria, inoculate into liquid LB medium, and culture at 35-39°C for 8-16 hours to obtain seed liquid;

[0039] The seed liquid is inoculated into the fermentation medium, and ampicillin, streptomycin and IPTG inducers are added, and the fermentation culture is carried out at 35-39°C for 36-100 hours.

[0040] The amount of ampicillin added is 50-100 mg / L, the amount of streptomycin added is 30-50 mg / L, and the amount of IPTG inducer added is 0.05-0.2 mol / L

[0041] In the present invention, the promoter of the pCDFduet plasmid is replaced by the trc promoter, so that it can be co-expressed with the plasmid ptrc99a in MG1655 and can reach an appropriate expression level. The present invention combines the knockout of crr with the overexpression of lysC to construct an Escherichia coli that can efficiently produce ectoine, and can obtain the highest yield and the highest yield on a culture medium with inorganic nitrogen source ammonium chloride as the only nitrogen source.

[0042] The present invention has the following beneficial effects:

[0043] (1) The present invention constructs an Escherichia coli that can efficiently produce ectoine, and the Escherichia coli can obtain the highest yield and the highest yield on a culture medium with inorganic nitrogen source ammonium chloride as the only nitrogen source. In addition, the culture medium does not contain an organic nitrogen source, which is beneficial to reducing costs and purifying the product.

[0044] (2) The present invention uses an optimized fermentation medium for feed-batch fermentation, which can achieve a maximum ectoine production of 115 g / L, with a yield of about 0.45 g / g glucose, providing favorable conditions for the industrial synthesis of ectoine by the strain. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 It is the fermentation result of Example 13. DETAILED DESCRIPTION

[0046] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and specific implementation methods.

[0047] The detection method of Ecdoin in the embodiment is as follows:

[0048] Take 2mL of sample every 4-12h, take a part and dilute to the appropriate multiple, use spectrophotometer to detect the absorbance at 600nm to reflect the amount of bacteria. The remaining samples are centrifuged at 12000rpm for 2min, the supernatant is aspirated, and a part of it is detected by biosensor analyzer to detect the remaining sugar concentration; a part is diluted to the appropriate multiple and filtered with a 0.22 micron pore size filter membrane, and added to a liquid sample bottle, and detected by high performance liquid chromatography (HPLC): liquid chromatography uses a C18 column, and the mobile phase is 20% acetonitrile and 80% water. The concentration of ectoine is calculated by comparing the peak area with that of the standard sample.

[0049] The chemical transformation method in the embodiment is as follows: 10 μL of the obtained plasmid is added to 100 μL of the chemical competent cells of Escherichia coli MG1655 made or purchased on ice and mixed, placed in a 42°C water bath for heat shock for 45 seconds after standing for 30 minutes, then cooled on ice for 2 minutes, added with 800 μL LB medium (5g / L yeast powder, 10g / L peptone, 10g / L sodium chloride. Sterilized at 115°C for 20 minutes), and placed in a 37°C shaker for recovery for 1 hour. Take 100 μL and apply it to a LB solid plate with corresponding antibiotics preheated in a 37°C incubator (5g / L yeast powder, 10g / L peptone, 10g / L sodium chloride, 15g / L agar. Sterilized at 115°C for 20 minutes), placed in a 37°C incubator for overnight growth, and screened and sequenced the positive strains obtained.

[0050] Yield calculation method: yield (g / L) / glucose consumption (g / L).

[0051] Example 1

[0052] The method for constructing the ectoine synthetic strain of the present invention is as follows:

[0053] 1. Knock out the crr gene using Crispr-Cas9 technology. Use the following two pairs of primers ty-1 and ty-2, and use E. coli MG1655 as a template for PCR to obtain fragments of homologous sequences:

[0054] ty-1F:gaattctctagagtcgacctgcagtaaagcgtttgacgagtca

[0055] ty-1R:cgatgggcgccatttttcataagcagtaaattgggccgc

[0056] ty-2F:gcggcccaatttactgcttatgaaaaatggcgcccatcg

[0057] ty-2R: ataacagggtaatagatctaagcttattggcgatattgatagcgg.

[0058] The plasmid pTarget was linearized by restriction enzyme digestion with HindIII and PstI to obtain the vector. The ClonExpress II One Step Cloning Kit from Novezan was used to connect the linearized plasmid with the fragment obtained by PCR amplification by one-step cloning according to the instructions to obtain pTarget-t. The following primers N20-F / R were used to perform PCR on pTarget-t, and the plasmids were connected by one-step cloning to obtain the pTarget-crr plasmid:

[0059] N20-F: TGGAGATAACAACCGGAGTCgttttagagctagaaatagcaag

[0060] N20-R: GACTCCGGTTGTTATCTCCAactagtattatacctaggactg.

[0061] The plasmid pCas was introduced into Escherichia coli MG1655 by chemical transformation, and the culture was induced by adding arabinose, and then chemically competent cells were prepared by adding calcium chloride. The plasmid pTarget-crr was introduced into the chemical competent cells with plasmid pCas by chemical transformation. Then, the successfully knocked-out strains were screened by PCR and gene sequencing, and the plasmid pCas and pTarget-crr were eliminated by adding IPTG and culturing at 37 degrees to obtain the chassis strain MG1655Δcrr with crr knocked out.

[0062] Select restriction sites KpnI and BamHI, and use KpnI and BamHI endonucleases to linearize the pTrc99a plasmid according to the instructions. Use the following primers to perform PCR amplification on the strain Halomonas sp. or the sequence obtained by gene synthesis (sequence SEQ ID NO: 2) to obtain the ectoin synthesis gene cluster ectABC:

[0063] ect: 5'-CATGGAATTCGAGCTCGGTACCATGAGCACGCCAATAATAACC-3'

[0064] ectCR: 5'-CAGGTCGACTCTAGAGGATCCCTCACCAGTAGGTGCGGCG-3'

[0065] The linearized plasmid and the fragment amplified by PCR were connected by one-step cloning to obtain the plasmid pTrc99a-ectABC. The plasmid pTrc99a-ectABC was introduced into the modified Escherichia coli by chemical transformation. After confirming that the gene sequence was correct, the engineered strain used for fermentation was obtained and named Fect2.

[0066] Use the following two pairs of primers to amplify the pCDFduet plasmid and the pTrc99a plasmid, respectively, to obtain the linearized pCDFduet plasmid and the fragment containing the trc promoter:

[0067] pCDF KF: 5'-CTGAAACCTCAGGCATTTGAG-3'

[0068] pCDF KR: 5'-ATTTCCTAATGCAGGAGTCGC-3'

[0069] trcP2-F:

[0070] 5'-GCGACTCCTGCATTAGGAAATGTTGACAATTAATCATCCGGCTC-3'

[0071] trcP2-R:

[0072] 5'-CTCAAATGCCTGAGGTTTCAGGTCTCATGAGCGGATACATATTTG-3'.

[0073] The linearized plasmid was connected to the fragment obtained by PCR amplification using a one-step cloning method to obtain the plasmid pCDFtrc. Then, the following two pairs of primers were used to amplify E. coli MG1655 to obtain the first half and second half fragments containing the lysC gene:

[0074] eclysC P1A-F:

[0075] 5'-TGGAATTCGAGCTCGGTACCTGACACGAGGTAGTTATGTC-3'

[0076] ectOv-eclysC P1-R:5'-TCAAGGATTAATGCCACGCT-3'

[0077] ectOv-eclysC P2-F: 5'-AGCGTGGCATTAATCCTTGA-3'

[0078] eclysC P2-R: 5'-CAGGTCGACTCTAGAGGATCCCTGTTACTCAAACAAATTACTATGCAG-3'.

[0079] The plasmid pCDFtrc linearized by KpnI and BamHI endonucleases according to the instructions was connected with the fragment amplified by PCR using a one-step cloning method to obtain the plasmid pCDFtrc-eclysC*. The plasmid was transformed into the strain Fect2 by chemical transformation to obtain Fect3.

[0080] Example 2

[0081] In this embodiment, the strain is fermented and cultured, and the steps are as follows:

[0082] (1) Plate culture: The strain Fect3 was inoculated into LB solid medium (5 g / L yeast powder, 10 g / L peptone, 10 g / L sodium chloride, 15 g / L agar, sterilized at 115°C for 20 min) by streaking, cultured at 37°C for 12-18 h;

[0083] (2) Seed culture: Pick the strains from the plate or from the seed tube, inoculate them into a test tube containing 5 mL of LB medium, and culture them in a shaker at 37°C and 180 rpm for 12 h as the seed solution;

[0084] (3) Shake flask fermentation: The activated seed solution was inoculated into a shake flask with an inoculation volume of 1% (v / v). The fermentation medium was 20 g / L glucose, 6 g / L ammonium chloride, 1 g / L sodium citrate dihydrate, 2 g / L potassium dihydrogen phosphate, 1.2 g / L magnesium sulfate, 0.1 g / L iron sulfate, and 0.1 g / L manganese sulfate. The mixture was placed in a shaker at 37°C and fermented at 180 rpm for 48 h. IPTG 0.1 mmol / L was added at 4 h. Ammonia water was added every 12 h to adjust the pH to 7.

[0085] Embodiment 3-5

[0086] Examples 3-5 are the results of shake flask fermentation of strains without knockout genes and introduction of ectABC, strain Fect2, and strains using the same method of Fect2 to knock out thrA, a similar substrate consumption pathway, to study the effect of gene knockout on the fermentation results (Examples 3-5 are fermentations of the same batch), and the results are shown in Table 1:

[0087] Table 1 Fermentation results of Examples 3-5

[0088]

[0089] It can be seen that knocking out crr can effectively improve the yield and productivity, while knocking out thrA will lead to a significant inhibition of strain growth.

[0090] Embodiment 6-8

[0091] Examples 6-8 are the results of shake flask fermentation of the strain without adding additional substrate, adding aspartic acid and adding diaminobutyric acid, respectively. The metabolic bottleneck of this strain was confirmed by adding additional substrate (Examples 6-8 are fermentations of the same batch), and the results are shown in Table 1:

[0092] Table 1 Fermentation results of Examples 3-5

[0093]

[0094] It can be seen that the additional addition of aspartic acid does not lead to an increase in yield, while the addition of diaminobutyric acid effectively increases the yield, indicating that the metabolic bottleneck is between aspartic acid and diaminobutyric acid.

[0095] Examples 9-17

[0096] Embodiment 9-17 studied the influence of overexpression of different genes in Escherichia coli MG1655 by the pCDFduet plasmid of further transformation on the fermentation of ectoin, and proved that the metabolic bottleneck was between aspartic acid and diaminobutyric acid before, and this further overexpressed the gene between the two to determine the metabolic bottleneck. Embodiment 9-15 is the shake flask fermentation result of the strain overexpressing different genes using the same overexpression method as Fect3. Wherein the overexpressed gene is cglysC from Corynebacterium glutamicum, eclysC from Escherichia coli, asd from Escherichia coli and ectB from Halomonas venusta. Wherein embodiment 11 is Fect3. Experimental example 16 is to use the same overexpression method as Fect3 to overexpress eclysC (anti-feedback mutation C1055T) using the pCDFduet plasmid that is not transformed, to prove the effect on plasmid transformation. Example 17 is an E. coli MG1655 containing ectABC but without crr knockout, which was overexpressed using the same plasmid as Fect3, to compare the effect of overexpressing lysC alone. The results are shown in Table 2:

[0097] Table 2 Fermentation results of Examples 9-16

[0098]

[0099] It can be seen that overexpression of eclysC with anti-feedback mutation can achieve the highest ectoine production, and the combination of crr knockout and overexpression of eclysC with anti-feedback mutation has the best effect.

[0100] Embodiment 18

[0101] Example 18 studied the production capacity of ectoine by the constructed strain Fect3 under conditions close to actual fermentation conditions, and conducted fermentation experiments in a fermenter to verify the yield under the conditions.

[0102] (1) Plate culture: Streak strain Fect3 onto LB solid medium and culture at 37°C for 12-18 h;

[0103] (2) Seed culture: Pick a spot from the plate containing the bacterial strain or take the bacterial strain from the seed tube, inoculate it into a test tube containing 5 mL of LB medium, place it in a shaking incubator at 37°C and culture it at 180 rpm for 12 h as the seed solution;

[0104] (3) Fermentation tank culture: The activated seed liquid was inoculated into the fermentation tank, the inoculation amount was 10% (v / v), the stirring speed was 600-800rpm, the dissolved oxygen was controlled at 40%, the fermentation was carried out at 37°C, and the pH was controlled to 7.0 with ammonia water. The fermentation medium was 6g / L ammonium chloride, 1g / L sodium citrate dihydrate, 2g / L potassium dihydrogen phosphate, 1.2g / L magnesium sulfate, 0.1g / L iron sulfate, and 0.1g / L manganese sulfate. At the beginning of fermentation, 0.1mg / L ampicillin and 0.05mg / L streptomycin were added. The initial glucose was 20g / L, and sugar was supplemented when the glucose was consumed, and the carbon source concentration was maintained at 3g / L. When OD600 reached 8, 0.1mmol / L IPTG was added. The fermentation lasted for 97h in total, and the maximum yield was reached after 97h of fermentation.

[0105] Table 5 Fermentation results of Example 18

[0106]

[0107] The results of Example 18 are as follows Figure 1 As shown, E. coli OD 600 The results show that the yield of ectoine is very high, and the yield is much higher than that of other high-yield strains of ectoine. The production efficiency is further improved, and considerable economic benefits can be brought to the industrial production of ectoine by engineered Escherichia coli.

[0108] SEQ ID NO: 1 Gene sequence of crr gene:

[0109] atgggtttgttcgataaactgaaatctctggtttccgacgacaagaaggataccggaactattgagatcattgctccgc

[0110] tctctggcgagatcgtcaatatcgaagacgtgccggatgtcgtttttgcggaaaaaatcgttggtgatggtattgctatc

[0111] aaaccaacgggtaacaaaatggtcgcgccagtagacggcaccattggtaaaatctttgaaaccaaccacgcattctc

[0112] tatcgaatctgatagcggcgttgaactgttcgtccacttcggtatcgacaccgttgaactgaaaggcgaaggcttcaa

[0113] gcgtattgctgaagaaggtcagcgcgtgaaagttggcgatactgtcattgaatttgatctgccgctgctggaagagaa

[0114] agccaagtctaccctgactccggttgttatctccaacatggacgaaatcaaagaactgatcaaactgtccggtagcgt

[0115] aaccgtgggtgaaaccccggttatccgcatcaagaagtaa

[0116] SEQ ID NO: 2 Gene sequence of the ectABC gene cluster:

[0117] atgagcacgccaataataccttttaccccttctgcagaccttgctcgcccaacagtcgctgatgctgtggttgggcatg

[0118] cgtctactccattattcattcgcaagccaaatgcagatgatggttggggcatctacgagttgataaaagcttgcccgcc

[0119] gcttgatgttaattctgcttatgcttatctactgctggcaacccagtttcgtgatacctgcgcggtggcgacaaatgaag

[0120] agggcgagatagttgggtttgtatcgggctatgtgaaagacaatgcgccggacacgtactttctatggcaggttgccg

[0121] ttggtgaaaaagcacgtggtactggcttggcacgccgtttagtcgaagccattatgtcgcgcccagaacttgataatg

[0122] tgcatcacctggaaacgacgatcacgcccgacaatcaggcctcttggggtctatttcgccgcctcgctgcccgttggc

[0123] aagccccgttaaacagccgtgaatatttctctaccgaacaactcggtggggagcatgatcctgaaaacctagttcgta

[0124] taggtccatttcaaacagacagcatgtaaccgtacgaaccagctcttgcccaatgcgcggctcttgcaagctggttac

[0125] gttttaaattggttaccgctgtttccgccagttcgtcccacgcttgactcaatgattttaaaaggaggtcgttaatgcag

[0126] acccaaacgcttgaacgcatggaatctaacgtacgtacttactcgcgctcattccccgttgtatttaccaaagcccaga

[0127] atgctcgtttaacggatgagaatggtcgtgagtatattgatttcctagccggtgccggcacgctcaattacggtcacaa

[0128] taacccacatctcaaacaggcaatgatcgactatctgtcaacagatggcattgttcatggcctggatatgtggaccgc

[0129] ggcaaagcgcgattacctagaaacccttgaagaagttatcttcaaaccgcgtggcttagactacaaggtacacctgc

[0130] cgggcccgaccggaactaacgcagtggaagcggccatccgtttggcccgtgttgctaaaggtcgccataacattgtg

[0131] acctttaccaacggcttccacggcgtcaccatgggagcactggcaaccacaggtaaccgcaaattccgcgaagcga

[0132] ccggcggcattcccacacaaggtgcaagctttttaccctttgacggttatatgggagagcatgcagatacgctggatt

[0133] acttcgaaaaattgcttaacgataaatctggcggcctcgatatacccgcgggtgttattgtcgaaaccgtgcaaggcg

[0134] agggcggtattaacgtagcaggcctagagtggctcaagcgtctagaaagcatctgtcgcgcccatgatattctgttga

[0135] tcatcgacgacatccaggcaggctgtggccgcacgggcaagttctttagctttgaacacgcgggcatcacgcctgat

[0136] atcgtgacgaattcaaaatcactttctggattcggactgccatttgcccatgtattgatgcgtccagaacttgataaatg

[0137] gaagcctggtcagtacaacggcacgttccgtggcttcaacttggcgatggtgaccgccacggccgcacttaaaaaat

[0138] attggtccaacgatgtttttgagcgtgatgttcagcgcaaagcgcgtattgttgaagagcgtttccaaaagctagcggc

[0139] cttactcagcgagaacggcatgcctgccactgagcgtggacgtggcctcatgcgcggaattgatgttgtctcaggcga

[0140] tattgctgacaagatcaccagcaaagcatttgagcacggccttattattgagaccagcggccaagacggcgaagtcg

[0141] tcaaatgcctatgcccgctgaccatcagtgatgaggacttgttagaagcgctggatattctagaagcctctgtcaatgc

[0142] tgttatccaagcgtgatttagcgttaggctaattcagtagcatcaattcagcactgggccgcgttgattaatactaagt

[0143] gcctcataacggagcaattctatgatcgttcgtaaccttgaagaagcacgtaaaacagatcgtcttgtcaccgccgag

[0144] aatggcaactgggacagcacgcgtcttgttctagccaatgataatgcgggtttttcatttcatatcacccgtattttccc

[0145] aggcactgagacgcatattcattacaaaaatcactatgaagctgtgttttgctatgaaggagaaggcgaggtagaaa

[0146] ccttggccgatggcaaaatctggccgatcaaagcaggcgatatttatctgctggatcagcacgacgaacacctgttac

[0147] gcggtaaagaaaaaggcatgaccgttgcgtgtgtatttactcccgctatcactggcaacgaagtacaccaggaagat

[0148] ggctcatacgccgcacctactggtgag

[0149] SEQ ID NO: 3. Gene sequence of lysC resistant to feedback inhibition:

[0150] atgtctgaaattgttgtctccaaatttggcggtaccagcgtagctgattttgacgccatgaaccgcagcgctgatattgt

[0151] gctttctgatgccaacgtgcgtttagttgtcctctcggcttctgctggtatcactaatctgctggtcgctttagctgaagg

[0152] actggaacctggcgagcgattcgaaaaactcgacgctatccgcaacatccagtttgccattctggaacgtctgcgtta

[0153] cccgaacgttatccgtgaagagattgaacgtctgctggagaacattactgttctggcagaagcggcggcgctggcaa

[0154] cgtctccggcgctgacagatgagctggtcagccacggcgagctgatgtcgaccctgctgtttgttgagatcctgcgcg

[0155] aacgcgatgttcaggcacagtggtttgatgtacgtaaagtgatgcgtaccaacgaccgatttggtcgtgcagagcca

[0156] gatatagccgcgctggcggaactggccgcgctgcagctgctcccacgtctcaatgaaggcttagtgatcacccaggg

[0157] atttatcggtagcgaaaataaaggtcgtacaacgacgcttggccgtggaggcagcgattatacggcagccttgctgg

[0158] cggaggctttacacgcatctcgtgttgatatctggaccgacgtcccgggcatctacaccaccgatccacgcgtagtttc

[0159] cgcagcaaaacgcattgatgaaatcgcgtttgccgaagcggcagagatggcaacttttggtgcaaaagtactgcatc

[0160] cggcaacgttgctacccgcagtacgcagcgatatcccggtctttgtcggctccagcaaagacccacgcgcaggtggt

[0161] acgctggtgtgcaataaaactgaaaatccgccgctgttccgcgctctggcgcttcgtcgcaatcagactctgctcactt

[0162] tgcacagcctgaatatgctgcattctcgcggtttcctcgcggaagttttcggcatcctcgcgcggcataatatttcggta

[0163] gacttaatcaccacgtcagaagtgagcgtggcattaatccttgataccaccggttcaacctccactggcgatacgttg

[0164] ctgacgcaatctctgctgatggagctttccgcactgtgtcgggtggaggtggaagaaggtctggcgctggtcgcgttg

[0165] attggcaatgacctgtcaaaagcctgcggcgttggcaaagaggtattcggcgtactggaaccgttcaacattcgcatg

[0166] atttgttatggcgcatccagccataacctgtgcttcctggtgcccggcgaagatgccgagcaggtggtgcaaaaactg

[0167] catagtaatttgtttgagtaa

Claims

1. An ectoine synthetic strain, characterized in that: By knocking out genes crr Overexpression in host bacteria ectABC Gene clusters and resistance to feedback inhibition lysC Gene acquisition; the host bacteria is Escherichia coli ( Escherichia coli )MG1655; ectABC The nucleotide sequence of the gene cluster is shown in SEQ ID NO:

2. lysC The nucleotide sequence of the gene is shown in SEQ ID NO: 3; ectABC The vector plasmid for gene cluster insertion was pTrc99a; lysC The vector plasmid for gene insertion is pCDFtrc plasmid; the pCDFtrc plasmid is a pCDFduet plasmid in which the T7 promoter is replaced with the trc promoter by a one-step PCR cloning method.

2. The method for constructing the strain according to claim 1, characterized in that: include: The Crispr-Cas9 technology was used to knock out the crr gene, and obtain the knockout chassis strain; Amplification ectABC The gene sequence of the gene cluster is inserted into the vector plasmid by enzyme digestion and one-step cloning to obtain the expression plasmid; Introducing the expression plasmid into the host bacteria; Amplification lysC The gene sequence of the gene cluster is inserted into the vector plasmid by enzyme digestion and one-step cloning to obtain another expression plasmid; The expression plasmid is introduced into the host bacteria to obtain the ectoine synthetic strain.

3. The construction method according to claim 2, characterized in that: The vector plasmids used are pTrc99a plasmid and pCDFtrc plasmid.

4. The construction method according to claim 3, characterized in that: The pCDFtrc plasmid is a pCDFduet plasmid in which the T7 promoter is replaced by the trc promoter by one-step PCR cloning.

5. The construction method according to claim 2, characterized in that: The following primers were used for amplification ectABC Gene cluster gene sequence: ectAF: 5'-CATGGAATTCGAGCTCGGTACCATGAGCACGCCAATAATACC-3' ectCR: 5'-CAGGTCGACTCTAGAGGATCCCTCACCAGTAGGTGCGGCG-3'.

6. The construction method according to claim 2, characterized in that: The following primers were used for amplification lysC Gene sequence: eclysC P1A-F: 5'-TGGAATTCGAGCTCGGTACCTGACACGAGGTAGTTATGTC-3' ectOv-eclysC P1-R:5'-TCAAGGATTAATGCCACGCT-3' ectOv-eclysC P2-F: 5'-AGCGTGGCATTAATCCTTGA-3' eclysC P2-R: 5'-CAGGTCGACTCTAGAGGATCCCTGTTACTCAAACAAATTACTATGCAG-3'.

7. Use of the strain described in claim 1 in the fermentation production of ectoine.

8. The use according to claim 7, characterized in that The fermentation medium composition of the strain fermentation is: carbon source 20-30g / L, nitrogen source 6g / L, sodium citrate dihydrate 1 g / L, potassium dihydrogen phosphate 2 g / L, magnesium sulfate 1.2 g / L, iron sulfate 0.1g / L, manganese sulfate 0.1 g / L.

9. The use according to claim 7, characterized in that: When using a fermenter for fermentation, the carbon source is added by feeding to maintain the carbon source concentration at 1-5 g / L.

10. The use according to claim 7, characterized in that: include: Streak the ectoine synthetic strain onto solid LB medium and culture at 35-39° C. for 8-16 h; Pick the cultured bacteria, inoculate into liquid LB medium, and culture at 35-39°C for 8-16 hours to obtain seed liquid; The seed liquid is inoculated into the fermentation medium, and ampicillin, streptomycin and IPTG inducers are added, and the fermentation culture is carried out at 35-39°C for 36-100 hours.

Images