A high-affinity D-protein inhibitor targeting the D5 domain of tropomyosin receptor kinase and its use

Abstract

The present invention relates to a high-affinity D-protein inhibitor for the D5 domain of tropomyosin receptor kinase and its use, wherein the D-protein inhibitor is selected from the following: (i) a protein having a sequence of SEQ ID No.: 1; (ii) various mutants of (i). The D-protein inhibitor of the present application can significantly inhibit NGF-induced cell proliferation and inhibit downstream PI3K-Akt and ERK / p38MAP signaling pathways, thereby reducing various hazards caused by NGF overload or overexpression of TrkA. Therefore, it has great application prospects in the treatment of persistent pain and cancer with overexpression of TrkA.

Description

Technical Field

[0001] The present application relates to a tropomyosin receptor kinase A protein inhibitor, and in particular to a high-affinity D-protein inhibitor targeting the tropomyosin receptor kinase D5 domain and its use. Background Art

[0002] Tropomyosin receptor kinase A (TrkA) is a receptor with tyrosine kinase activity located on the cell membrane, and its natural ligand is nerve growth factor (NGF). When NGF binds to the extracellular D5 domain of TrkA, TrkA will homodimerize and induce its intracellular kinase domain to recruit various cytoplasmic adaptors, thereby activating the phosphatidylinositol kinase-protein kinase B (PI3K-Akt) and extracellular regulated protein kinase / mitogenic protein kinase p38 subtype (ERK / p38-MAP kinase) signaling pathways, and ultimately promote cell proliferation. However, NGF overload will continuously activate downstream signaling pathways and produce persistent pain. Therefore, the NGF-TrkA pathway is an effective analgesic target.

[0003] In addition, overexpressed TrkA is widely distributed in a variety of cancers, including breast cancer, lung cancer, neuroblastoma, and skin cancer. Overexpression of TrkA was detected in 20% of breast cancer biopsies, and excessive TrkA can significantly enhance the tumorigenic properties of breast cancer cells. Therefore, it is also considered a potential ideal target for the treatment of breast cancer.

[0004] Tanezumab, a non-opioid analgesic recently launched by Pfizer and Eli Lilly, can effectively relieve moderate to severe chronic pain in bones and joints by selectively binding to and inhibiting nerve growth factor NGF. However, tanezumab is a monoclonal antibody with a large size, weak tissue penetration, and is easily degraded by proteases and has a short half-life.

[0005] Therefore, further development of TrkA protein inhibitors is needed to provide potential highly active and stable drug candidates for the treatment of breast cancer and chronic pain. Summary of the invention

[0006] Technical Purpose

[0007] The technical purpose of the present invention is to provide a class of high-affinity D-protein inhibitors for the D5 domain of tropomyosin receptor kinase, which can reduce NGF overload or TrkA overexpression by inhibiting the phosphorylation of protein kinase B (AKT) and extracellular regulated protein kinase (ERK), and can thus be used to prepare related drugs.

[0008] Another technical purpose of the present invention is to provide a pharmaceutical composition comprising the above-mentioned D-protein inhibitor.

[0009] Another technical purpose of the present invention is to provide the use of the above-mentioned D-protein inhibitor in the preparation of medicines.

[0010] In one aspect, the present invention provides a class of high affinity D-protein inhibitors against the tropomyosin receptor kinase D5 domain (TrkA-D5 domain) selected from the following:

[0011] (i) a protein having a sequence of SEQ ID No.: 1;

[0012] (ii) Mutants of (i) include the following two situations:

[0013] Scenario 1:

[0014] According to the design model ( Figure 8 ), any one or more of the amino acids at positions 17, 21, 25, 36, 38, 39, 40, 42, 43, 46, 47, 50, 54, 58, 61, 65 in the sequence SEQ ID No.: 1 are replaced by respective similar amino acids to obtain a protein having the same function, wherein the same function means that the replaced amino acid sequence has the same function of binding to the TrkA-D5 domain as the unsubstituted amino acid sequence; or

[0015] Scenario 2:

[0016] The mutant of the protein of sequence SEQ ID No.: 1 except for the above situation 1 has a sequence identity of more than 80%, more than 85%, more than 90%, preferably more than 92%, more preferably more than 95% with SEQ ID No.: 1.

[0017] In a specific embodiment, in the above (ii), the mutant of (i) has a sequence shown in any one of SEQ ID No.: 2-241 ( Fig. 9 ).

[0018] In another aspect, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of the above-mentioned D-protein inhibitor and a pharmaceutically acceptable excipient.

[0019] On the other hand, the present invention provides the above-mentioned D-protein inhibitor or the above-mentioned pharmaceutical composition, which is used for analgesia or cancer treatment, or for inhibiting NGF-induced cell proliferation, or for inhibiting NGF-induced downstream phosphorylation signals.

[0020] On the other hand, the present invention provides the use of the above-mentioned D-protein inhibitor, or the above-mentioned pharmaceutical composition in the preparation of a drug for analgesia or cancer treatment, or in the preparation of an agent for inhibiting NGF-induced cell proliferation, or in the preparation of an agent for inhibiting NGF-induced downstream phosphorylation signals.

[0021] On the other hand, the present invention provides a method for analgesia or cancer treatment, a method for inhibiting NGF-induced cell proliferation or a method for inhibiting NGF-induced downstream phosphorylation signals, the method comprising administering a D-protein inhibitor according to the present invention or the above-mentioned pharmaceutical composition to a subject in need thereof.

[0022] In specific embodiments, said analgesia comprises treating or ameliorating persistent pain perception.

[0023] In a specific embodiment, the above D-protein inhibitor, or the above pharmaceutical composition can be used to inhibit NGF-induced cell proliferation by inhibiting PI3K-Akt and ERK / p38 MAP kinase signaling pathways.

[0024] In a specific embodiment, the cancer includes but is not limited to breast cancer, lung cancer, neuroblastoma and skin cancer. Preferably, the cancer is breast cancer.

[0025] In a specific embodiment, the above-mentioned D-protein inhibitor, or the above-mentioned pharmaceutical composition can be used to inhibit the downstream phosphorylation signal induced by NGF.

[0026] Beneficial effects of the present invention:

[0027] The D-protein inhibitor of the present application exhibits high affinity to the D5 domain of tropomyosin receptor kinase. Experimental verification shows that it can significantly inhibit NGF-induced cell proliferation and inhibit downstream PI3K-Akt and ERK / p38 MAP signaling pathways, thereby reducing the various hazards caused by NGF overload or TrkA overexpression. Therefore, it has great application prospects in the treatment of persistent pain and cancers with overexpression of TrkA (including breast cancer, lung cancer, neuroblastoma, and skin cancer). BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 : HPLC chart (A) and mass spectrum (B) of D-57445-evo synthesized in Example 1.

[0029] Figure 2 : SEC graph (A) and SDS-PAGE electrophoresis graph (B) of the renatured D-57445-evo of Example 2.

[0030] Figure 3 : CD spectrum of D-57445-evo measured in Example 3.

[0031] Figure 4 : The affinity measurement result of D-57445-evo and L-TrkA D5 domain measured in Example 3 is shown in FIG.

[0032] Figure 5 : Experimental results of the resistance of L-57445-evo and D-57445-evo to protease degradation as determined in Test Example 1.

[0033] Figure 6 : The result of the test in Example 2 showing that D-57445-evo inhibits NGF-induced TF-1 cell proliferation.

[0034] Figure 7 : The result of testing Example 3 that D-57445-evo inhibits NGF-induced downstream phosphorylation signals.

[0035] Figure 8 : Figures analyzed by Pymol2.5 software in Example 4, wherein Figure A is the design model. The lower part is TrkA-D5, and the protein containing the helical structure on the upper side is D-57445-evo (the top is its amino acid sequence), wherein the amino acids at the interaction interface are marked in pink; Figure B is an enlarged view of the boxed area in Figure A showing the amino acid side chains.

[0036] Fig. 9 : The result of screening for inhibitors with high affinity to TrkA-D5 in Example 5 is shown in FIG. DETAILED DESCRIPTION

[0037] The following examples are only used to illustrate the technical solutions of the present invention and are not to be construed as limiting the present invention.

[0038] the term

[0039] The "D-protein inhibitor" in the present application means that the protein inhibitor is composed entirely of D-amino acids except for achiral glycine.

[0040] The "same type of amino acids" in this application refers to the amino acids that are substituted under normal physiological conditions and belong to the same category as the replacing amino acids according to the classification of amino acid side chain groups, for example, non-polar amino acids (L, V, M, I, A, F, P), polar uncharged amino acids (S, T, Q, N, C, G), polar negatively charged amino acids (E, D), polar positively charged amino acids (K, R, H), and aromatic amino acids (F, Y, W).

[0041] Example 1: Chemical Synthesis of D-57445-evo

[0042] D-57445-evo was prepared by standard Fmoc solid phase peptide synthesis (Fmoc SPPS) and automatically synthesized by Liberty blue microwave peptide synthesizer (CEM Corporation).

[0043] Reagents and Materials:

[0044] The Rink Amide AM resin used in the experiment (loading capacity of 0.27 mmol / g or 0.55 mmol / g) was purchased from Tianjin Nankai Hecheng Technology Co., Ltd.

[0045] The amino acid derivatives used in the experiments were purchased from Jiangsu Shenlang Biotechnology Co., Ltd. (Nantong, China).

[0046] N,N-dimethylformamide (DMF), triisopropylsilane (TIPS), trifluoroacetic acid (TFA) and thioanisole were purchased from J&K Scientific Ltd. (Beijing).

[0047] N,N-Diisopropylcarbodiimide (DIC) and ethyl cyanoglyoxylate-2-oxime (Oxyma) were purchased from Shanghai Titan Technology Co., Ltd.

[0048] 1,2-Ethanedithiol (EDT) was purchased from TCI Development Co., Ltd (Shanghai, China).

[0049] Piperidine was purchased from Sinopharm Chemical Reagent Co., Ltd., ether was purchased from Modern Oriental (Beijing) Technology Development Co., Ltd., and acetonitrile was purchased from Mallinckrodt Baker, Inc.

[0050] Synthesis steps:

[0051] First, Rink Amide AM resin was stirred at 90°C for 1 minute in DMF in the presence of 10% piperidine and 0.1M Oxyma to remove the Fmoc protecting group (deprotection). Then, the resin was washed 3 times with DMF (cleaning). Subsequently, the resin (0.25mmol) with the Fmoc protecting group removed, 4 equivalents of amino acid with Fmoc protecting group (0.2mM, 5ml, dissolved in DMF), 4 equivalents of Oxyma (1mM, 1ml, dissolved in DMF), 4 equivalents of DIC (0.5mM, 2ml, dissolved in DMF), were mixed and coupled under microwave heating at 90°C for 2 minutes (coupling). Finally, the resin was washed 3 times with DMF (cleaning). The standard synthesis procedure of "deprotection-cleaning-coupling-cleaning" was completed once. Each amino acid added was carried out according to the standard synthesis procedure. After the last amino acid completed the standard procedure, "deprotection-cleaning" was carried out again to end the synthesis procedure.

[0052] At the end of the program, the peptide was cut out from the resin by cleavage with TFA cleavage solution (TFA / TIPS / thioanisole / water / EDT=82.5:5:5:5:2.5, volume ratio) for 3 hours. It was concentrated using nitrogen. After precipitation with ice ether, centrifugation and decanting the supernatant were repeated 3 times. The resulting precipitate is a crude peptide, which will then be preliminarily purified by RP-HPLC (reverse phase high performance liquid chromatography) to obtain the primary purification of the target peptide. Reverse phase HPLC was performed on a Shimadzu Prominence HPLC. The mobile phase of pump A was acetonitrile (0.1% TFA) and the mobile phase of pump B was deionized water (0.1% TFA).

[0053] The primary purified product was then further purified by HPLC (the mobile phase of pump A was acetonitrile (0.1% TFA), and the mobile phase of pump B was deionized water (0.1% TFA)) to obtain a secondary purified product.

[0054] The secondary purified product after HPLC purification was dissolved in water containing 50% acetonitrile and 0.1% TFA, filtered with a 0.22 μm filter, and the filtrate was freeze-dried to obtain pure protein powder D-57445-evo (SEQ ID No.: 1). The HPLC and mass spectrometry results of D-57445-evo are as follows: Figure 1 As shown, the mass spectrometry experimental results of D-57445-evo are consistent with the theoretical values, indicating that D-57445-evo was successfully prepared.

[0055] Example 2: D-57445-evo refolding

[0056] D-57445-evo lyophilized powder was dissolved in an aqueous solution containing 20mM Tris-HCl and 6M guanidine hydrochloride (Gdn-HCl) at pH 8.5, at which the final protein concentration was 0.1mg / ml. The 0.1mg / ml protein solution was transferred to a dialysis bag (molecular weight cutoff of 3500Da) and dialyzed in a buffer containing 20mM Tris-HCl and 150mM NaCl at pH 8.5. The dialyzate was kept in a cold room at 4°C overnight, and after 12h, the solution in the dialysis bag was centrifuged at 12000r.pm for 10min. The supernatant was concentrated to 1-2ml and purified by size exclusion chromatography (SEC) (Superdex 75Increase 10 / 300GL column, Cytiva Life Sciences), and the SEC eluent was an aqueous solution containing 20mM Tris-HCl and 150mM NaCl at pH 8.5. Figure 2 A shows the SEC chromatography elution results.

[0057] Further, the components corresponding to the elution peak were subjected to SDS-PAGE electrophoresis experiment, and the results are shown in Figure 2The results showed that D-57445-evo was successfully renatured and reached electrophoretic purity.

[0058] Example 3: D-57445-evo circular dichroism (CD) and affinity determination (OCTET)

[0059] The concentration of D-57445-evo after renaturation and purification in Example 2 was adjusted to 0.3 mg / ml, and its secondary structure was determined by circular dichroism spectrometry. Figure 3 . Figure 3 The results showed that it formed the expected secondary structure including α-helix.

[0060] At the same time, the D-57445-evo protein was diluted to different concentrations and used for affinity determination using OCTET RED96e (ForteBio). The determination method is as follows: PBST buffer (water containing 1.44g / L Na2HPO4, 0.24g / L KH2PO4, 125mM NaCl, 0.02% TWEEN20, and adjusted to pH 7.4 with hydrochloric acid) was used as the base solution in the experiment. L-TrkA has D-biotin at its N-terminus, and a loading solution with a concentration of 10μg / ml of L-TrkA was prepared with PBST; a blocking solution containing 10μg / ml biotin was prepared with PBST; and a binding assay solution containing different concentrations (50nM, 25nM, 10nM, 5nM and 2nM) of D-57445-evo was prepared with PBST. The probes were streptavidin-coated biosensors (SA Sartorius), and the program settings were as follows (the program settings were sequential, i.e., the probes were immersed in the following solutions in turn and the signal intensity was recorded by the instrument, and the signal intensity unit was nanometers (nm):

[0061] -Baseline measurement: PBST buffer (60 seconds)

[0062] - Sample loading: PBST buffer containing L-TrkA (stop when the signal height reaches 1.8nm)

[0063] - Blocking: PBST buffer containing D-biotin (60 seconds)

[0064] -Baseline measurement 2: PBST buffer (60 seconds)

[0065] -Binding assay: PBST buffer containing different concentrations of D-57445-evo (600 sec)

[0066] - Dissociation: PBST buffer (600 sec).

[0067] Results Figure 4 , Figure 4The results showed that D-protein inhibitors can bind to the D5 domain of L-TrkA with high affinity, K D It is 1.73nM.

[0068] Comparative Example 1: Expression and purification of L-57445-evo:

[0069] L-57445-evo is composed entirely of L-amino acids except for achiral glycine, and its amino acid sequence is SEQ ID No.: 1 and its nucleotide sequence is SEQ ID No.: 242.

[0070] The preparation method is protein expression in Escherichia coli, and the expression vector is pET28b. To facilitate subsequent purification, in actual operation, a His-tag and a TEV restriction site are added before the coding sequence of L-57445-evo. Its amino acid sequence is GSSHHHHHHSSGENLYFQGS (SEQ ID No.: 243), and the corresponding nucleotide coding sequence is GGCAGCAGCCATCATCATCATCATCATAGCAGCGGCGAAAACCTGTATTTTCAAGGCAGC (SEQ ID No.: 244).

[0071] The expression strain was Lemo (DE3), and LB medium and 0.2 mM IPTG were used as inducers for overnight expression at 18°C. Each liter of cells was collected into 30 ml TBS buffer 1 (containing 20 mM Tris-HCl, 150 mM NaCl, pH 8.0), and lysed by ultrasonic disruption. The lysed mixture was centrifuged at 13000 rpm for 20 min, and the supernatant was passed through 1 ml Ni Sepharose 6 Fast Flow resin (Cytiva Life Sciences). The resin was washed with 30 ml TBS buffer 2 (containing 20 mM Tris-HCl, 150 mM NaCl, 30 mM imidazole, pH 8.0), and then eluted with 5 ml TBS buffer 3 (containing 20 mM Tris-HCl, 150 mM NaCl, 300 mM imidazole, pH 8.0). The eluate was concentrated to 1 ml and then analyzed by size exclusion chromatography (Superdex75Increase 10 / 300GL The protein was purified by HPLC-PCR (50 μg / mL) and ELISA (50 μg / mL) to obtain L-57445-evo.

[0072] Test Example 1: Evaluation of the Anti-degradation Ability of D-57445-evo

[0073] In this example, trypsin (Genom) and pepsin (Aladin) were used to degrade L- and D-57445-evo.

[0074] The protease was mixed with the target protein, the final concentration of trypsin was 2.2 mg / ml, the reaction buffer was Hank's Balanced Salt Solution with 0.02% EDTA; the final concentration of pepsin was 0.22 mg / ml, the reaction buffer was 0.1 M Glycine, pH 2.5; the final concentration of L-57445-evo (prepared in Comparative Example 1 above) and D-57445-evo was 0.2 mg / ml. The mixture was incubated at 37°C for 6 and 20 hours respectively. After incubation, SDS-PAGE was used for identification, and the results are shown in Figure 5 (The first and second lanes from the left are respectively the L-type and D-type 57445-evo which have not been treated with any protease).

[0075] Figure 5 The results showed that the L-type protein was almost completely degraded, while D-57445-evo had a strong resistance to degradation and was almost not degraded, providing a basis for extending the half-life of the drug.

[0076] Test Example 2: Effect of D-57445-evo on NGF-induced cell proliferation

[0077] TF-1 cells were seeded in 96-well plates, 3000 cells per well, and the basal medium was 1640 medium containing 2% FBS. The cells were incubated with different concentrations of NGF (0, 100 ng / ml) and D-57445-evo (0, 50 nM, 100 nM, 120 nM, 150 nM, 180 nM, 200 nM) at 37°C, 5% CO2 for 48 h. The cell proliferation effect was detected by detecting ATP levels (ApoSENSOR TM Cell Viability Assay Kit (BioVision)) was used for evaluation, and the results are shown in Figure 6 .

[0078] Figure 6 The results showed that D-57445-evo had no effect on cell proliferation when NGF was not added, indicating that D-57445-evo had no toxic effect on the cells; D-57445-evo had a significant inhibitory effect on cell proliferation induced by NGF, and showed a concentration-dependent trend. Under the condition of 100ng / ml NGF, the IC 50 It is 124.6nM.

[0079] Test Example 3: Effect of D-57445-evo on downstream PI3K-Akt and ERK / p38 MAP kinase signaling pathways

[0080] After 4 hours of starvation, TF-1 cells were incubated with different concentrations of D-57445-evo or a mixture of different concentrations of D-57445-evo and 100 ng / ml NGF at 37°C for 10 minutes. The cells were collected and lysed, and Western blot was performed to detect the phosphorylation levels of ERK and AKT. The specific steps of the detection are as follows: subject the cell lysates of different groups to SDS-PAGE, cut the gel according to the molecular weight of the protein to be detected, transfer the protein on the gel to a PVDF membrane, block the membrane with a blocking solution (PBS containing 5% skimmed milk powder), incubate with primary antibodies (Akt (Ser473) Antibody Duet Catalog No. 8200, MAPK (Erk1 / 2) (Thr202 / Tyr204) Antibody Duet Catalog No. 8201, CST) and secondary antibodies (HRP Goat Anti-Rabbit IgG (H+L) (AS014), Abclonal), and then perform chemiluminescence color development.

[0081] Figure 7 The results showed that in the absence of NGF, different concentrations of D-57445-evo had no effect on the phosphorylation levels of AKT and ERK in cells. However, in the presence of NGF, NGF can activate the PI3K-Akt and ERK / p38 MAP kinase signaling pathways, resulting in a significant increase in the phosphorylation levels of AKT and ERK. After the addition of D-57445-evo, the phosphorylation levels of AKT and ERK were significantly reduced, indicating that D-57445-evo can inhibit NGF-induced cell proliferation by inhibiting the PI3K-Akt and ERK / p38 MAP kinase signaling pathways.

[0082] Embodiment 4:

[0083] The design model was analyzed by Pymol2.5 software. Figure 8As shown in the figure, the lower part is TrkA-D5, and the protein with a helical structure on the upper part is D-57445-evo (the top is its amino acid sequence), in which the amino acids at the interaction interface are marked in pink; Figure B is an enlarged view of the amino acid side chains in the box area in Figure A. According to the design model, the amino acids marked in pink in D-57445-evo, namely the 17th, 21st, 25th, 36th, 38th, 39th, 40th, 42nd, 43rd, 46th, 47th, 50th, 54th, 58th, 61st, and 65th amino acids are believed to play an important role in binding to TrkA-D5, because the closest distance between the side chains of these amino acids and the side chains of the amino acids on TrkA-D5 is less than

[0084] Example 5: Screening of binding proteins using yeast display method

[0085] A protein library was established using an error-prone mutation kit and displayed on the surface of yeast cells by yeast display. About 10 million yeast cells were collected in PBSF (PBS containing 0.1% (w / v) bovine serum albumin, pH 7.4), and D-TrkA-D5 labeled with Biotin was added. The cells were incubated at room temperature for 30 minutes and centrifuged at 12,000 r.pm for 1 minute to remove the D-TrkA-D5 labeled with Biotin. The primary antibody (anti-cmyc-FITC antibody) was diluted 1:250 with PBSF, and PBSF with the primary antibody was added to the yeast cells. After incubation at room temperature for 30 minutes, the cells were centrifuged at 12,000 r.pm for 1 minute to remove the primary antibody. The secondary antibody (streptavidin–phycoerythrin, SAPE antibody) was diluted 1:100 with PBSF, and PBSF with the secondary antibody was added to the yeast cells. The cells were incubated at 4°C for 10 minutes and centrifuged at 12,000 r.pm for 1 minute to remove the secondary antibody. The cells were washed twice with PBS and sorted using flow cytometry. Fig. 9 shown.

[0086] from Fig. 9(Each blue dot in the figure represents a yeast cell. The more yeast cells there are in a certain area, the green or even red it will appear.) It can be seen that when TrkA-D5 is not added, the yeast cell clusters will not migrate upward; when TrkA-D5 is added at a pM (picomolar) concentration, the yeast cell clusters migrate significantly, indicating that they have a strong binding ability with TrkA-D5. Yeast cells that migrate upward in each round are sorted out, high-throughput sequencing is performed, and the sequencing results are statistically analyzed. The sequence types are ranked from high to low according to their proportion, among which SEQ ID No.: 1 has the highest proportion (51.98%), and the remaining sequences are taken from the top ten thousandth, that is, the following sequences SEQ ID No.: 2-241 (SEQ ID No.: 2 accounts for 8.95%; SEQ ID No.: 241 accounts for 0.01%).

[0087] This patent is funded by the National Natural Science Foundation Key Project 22137005 (Artificial Intelligence-Assisted Mirror Protein Peptide Drug Design and Directed Evolution).

Claims

1. A high affinity D-protein inhibitor targeting the D5 domain of tropomyosin receptor kinase, the sequence of which is SEQ ID No.: 1, The “D-protein inhibitor” refers to a protein inhibitor that is composed entirely of D-amino acids except for achiral glycine.

2. A pharmaceutical composition comprising a therapeutically effective amount of the D-protein inhibitor according to claim 1, and a pharmaceutically acceptable excipient.

3. Use of the D-protein inhibitor according to claim 1 or the pharmaceutical composition according to claim 2 in the preparation of a medicament for analgesia or treatment of breast cancer.

4. The use according to claim 3, wherein The analgesia includes treating or improving persistent pain sensation.

Images