GmMMP1 protein interacting with soybean mosaic virus protein and its gene, method for improving soybean resistance to soybean mosaic virus and application thereof

Abstract

The present invention relates to the field of genetic engineering technology, and specifically to a GmMMP1 protein that interacts with a soybean mosaic virus protein and a gene thereof, and in particular to a method and application for improving soybean resistance to soybean mosaic virus. GmMMP1 Gene, construction of plant overexpression vector and knockout vector and combined with soybean genetic transformation technology to obtain transgenic soybean, and confirmed soybean matrix metalloproteinase gene through plant disease resistance phenotype GmMMP1 It can improve soybean resistance to soybean mosaic virus and has been demonstrated in yeast system GmMMP1 It may interact with the 6K1 and HC-Pro proteins of soybean mosaic virus; it provides important genetic resources for breeding new soybean varieties with high resistance to soybean mosaic virus through molecular technology, and has broad application potential for enhancing soybean resistance to viral diseases.

Description

Technical field:

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a GmMMP1 protein interacting with a soybean mosaic virus protein and a gene thereof, and a method and application of improving soybean resistance to soybean mosaic virus. Background technology:

[0002] Soybean [Glycine max (L.) Merr.] is an important food crop and cash crop used as food, oil and feed, and plays an important role in people's lives. Soybean is a crop that is extremely susceptible to diseases. Among them, soybean mosaic virus (SMV), which is mainly transmitted by aphids, is the most pernicious viral disease. Because it is difficult to prevent and control, it is also called "plant cancer." SMV occurs year-round in soybean producing areas in my country. Infected soybeans usually show adverse phenomena such as mosaic, wrinkled leaves, apical necrosis and plant dwarfing, which ultimately affect soybean yields, and even produce no yields in severe cases. Because viruses often react with other adverse traits, and SMV strains continue to evolve and reproduce in different environments, it is difficult to obtain stable disease-resistant soybean varieties through conventional breeding methods. At present, domestic and foreign researchers have discovered and reported multiple SMV resistance gene loci using different research groups and technical methods. However, the identification of disease resistance functions and research on the mechanism of action of candidate genes under relevant resistance loci are still relatively slow. Therefore, discovering soybean SMV resistance genes, clarifying their disease resistance functions and exploring their mechanisms of action can lay an important theoretical foundation and effective genetic resources for breeding new soybean varieties (lines) with high resistance to SMV through molecular breeding technology. Summary of the invention:

[0003] In view of the deficiencies in the prior art, the present invention provides a GmMMP1 protein that interacts with soybean mosaic virus protein and its gene, and a method and application for improving soybean resistance to soybean mosaic virus.

[0004] Specifically, the present invention provides a soybean matrix metalloproteinase gene GmMMP1 , the soybean matrix metalloproteinase gene GmMMP1 The nucleotide sequence is shown in SEQ ID No.1.

[0005] The present invention also provides the soybean matrix metalloproteinase gene GmMMP1 The amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0006] The present invention also provides the use of the GmMMP1 protein that interacts with soybean mosaic virus protein in anti-virus.

[0007] The present invention also provides a soybean matrix metalloproteinase gene GmMMP1A method for improving soybean resistance to soybean mosaic virus, the method comprising the following steps:

[0008] (1) Clone the gene shown in SEQ ID No. 1 GmMMP1 Gene;

[0009] (2) Constructing a plant expression vector pCAMBIA3301-GmMMP1; the basic expression vector of the plant expression vector pCAMBIA3301-GmMMP1 is the pCAMBIA3301 expression vector, and the plant expression vector pCAMBIA3301-GmMMP1 includes the expression vector shown in SEQ ID No.1 GmMMP1 Gene sequence;

[0010] (3) Agrobacterium-mediated soybean stable genetic transformation method was used to cultivate and detect transgenic overexpression soybean plants.

[0011] Furthermore, the method for cloning the GmMMP1 gene shown in SEQ ID No. 1 in step (1) is: extracting total RNA from the leaves of Williams 82 soybean, reverse transcribing it into the first strand of cDNA as a PCR amplification template, and GmMMP1 Design cloning primers based on gene sequence, perform PCR amplification using high-fidelity enzyme, gel recovery and purification to obtain amplified GmMMP1 Gene fragments;

[0012] The cloning primers are:

[0013] Forward primer: 5-'ACTCTTGACCATGGTAGATCTGATGAAACCGTACCTACGTGCAA-3',

[0014] Reverse primer: 5-'GTCATCCTTGTAATCACTAGTATACAAAAGGAGCAATACGTAAGC-3'.

[0015] Furthermore, in step (2), the plant expression vector pCAMBIA3301- GmMMP1 Build it by following these steps:

[0016] The expression vector pCAMBIA3301 plasmid was double-digested with restriction enzymes Spe I and Bgl II;

[0017] The double-digested plasmid is connected to the amplified GmMMP1 The gene fragments were connected and transformed into competent E. coli DH5α cells. The plant expression vector pCAMBIA3301-GmMMP1 was obtained after PCR identification of the bacterial solution.

[0018] Furthermore, the specific steps in step (3) are:

[0019] The plant expression vector pCAMBIA3301-GmMMP1 constructed in step (2) was transformed into Agrobacterium EHA105 competent cells. After PCR identification of the Agrobacterium bacterial solution, regenerated plants were obtained by Agrobacterium-mediated stable genetic transformation of soybeans. The plants were transferred to the screening medium for subculture 3-4 times, and the target band was amplified by PCR identification using Bar test strips and transgenic specific primers. GmMMP1 After harvesting individual plants, repeated sowing is performed to obtain the T2 generation GmMMP1 Plants, T2 generation GmMMP1 Plant PCR identification and identification of disease resistance of soybean mutants;

[0020] The transgenic specific primers are:

[0021] Forward primer: 5-'GCCCAGCTATCTGTCACTTT-3',

[0022] Reverse primer: 5-'TCGTCCTTATAATACTCAAAC-3'.

[0023] Specifically, the specific steps of identifying the disease resistance of the mutant soybean are:

[0024] Agrobacterium-mediated GmMMP1 Directed knockout of the gene, designing knockout target identification primers, extracting genomic DNA of the regenerated plant, and performing PCR identification and sequencing analysis of the target to obtain soybean mutant strains;

[0025] For the T2 generation GmMMP1 The plants and the soybean mutant strains are inoculated with soybean mosaic virus and their disease resistance is identified;

[0026] The knockout target identification primers are:

[0027] Forward primer: 5-'CGCTGGTTCCCAAACAGAAA-3',

[0028] Reverse primer: 5-'CCTTTCGTTGCTGTGATGAC-3'.

[0029] Soybean matrix metalloproteinase gene GmMMP1 The method for improving soybean resistance to soybean mosaic virus is used in genetic engineering to improve soybean resistance to soybean mosaic virus.

[0030] Compared with the prior art, the present invention has the following beneficial technical effects:

[0031] Soybean matrix metalloproteinase gene GmMMP1 It is a new functional gene identified and discovered by the present invention that can positively regulate soybean resistance to mosaic virus disease. The study found that compared with the wild-type soybean receptor material, the transgenic GmMMP1 The SMV resistance of soybeans with overexpressed gene was significantly enhanced. GmMMP1 Soybean plants with the gene showed reduced SMV resistance, confirming that the gene can effectively improve soybean resistance to SMV. GmMMP1 A one-to-one yeast experiment between the protein and 10 functional proteins of the viral genome preliminarily proved that GmMMP1 can interact with the 6K1 and HC-pro proteins of SMV. It is speculated that GmMMP1 may activate the plant immune system by interacting with viral functional proteins, thereby ultimately improving the plant's resistance to SMV.

[0032] In summary, the present invention cloned and identified GmMMP1 The gene can provide an effective theoretical basis and genetic resources for accelerating the efficiency of SMV disease resistance breeding through molecular technology. Description of the drawings:

[0033] Figure 1 For the present invention GmMMP1 PCR identification of transformed Escherichia coli.

[0034] Figure 2 This is the subcellular localization of the GmMMP1 protein of the present invention in tobacco leaves.

[0035] Figure 3 This is the PCR identification result of the transgenic overexpression soybean T2 generation plant of the present invention.

[0036] Figure 4 It is the gene expression level of the transgenic overexpressed soybean T2 generation plants of the present invention.

[0037] Figure 5 This is the PCR identification result of the knockout transgenic T2 plant of the present invention.

[0038] Figure 6 It is the gene expression level of the T2 generation knockout plants of the present invention.

[0039] Figure 7 This is the SMV phenotype identification of the overexpression and knockout soybean lines of the present invention.

[0040] Figure 8 The overexpression and knockout soybean strains of the present invention are CP Gene expression levels.

[0041] Fig. 9 This is the yeast one-to-one verification result of the 10 functional proteins of GmMMP1 and SMV of the present invention. Specific implementation method:

[0042] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0043] The experimental methods in the following examples are all conventional experimental methods unless otherwise specified. The pharmaceutical reagents used in the following examples are all purchased from conventional biochemical reagent companies unless otherwise specified. In addition, the pCAMBIA3301 plant expression vector, CRISPR / Cas9 gene editing vector, yeast pGADT7 and pGBKT7 vectors, Escherichia coli DH5α, Agrobacterium EHA105 and Y2H GOLD yeast competent cells are available to the public from Hainan University.

[0044] The following is explained in conjunction with specific embodiments:

[0045] Embodiment 1: GmMMP1 Gene cloning and construction of plant expression vector

[0046] Williams 82, a soybean reference genome variety, was selected as the gene cloning material, and total RNA from plant leaves was extracted and reverse transcribed into the first strand of cDNA as a PCR amplification template. Cloning primers were designed according to the gene coding region sequence, and PCR amplification of the target gene was performed using TOYOBO brand KOD-Plus-Neo high-fidelity enzyme. The reaction system is shown in Table 1, the reaction procedure is shown in Table 2, and the product was purified using the gel recovery kit of Novozyme brand.

[0047] Table 1 PCR reaction system 20 uL:

[0048]

[0049] Table 2 PCR reaction program (30 cycles):

[0050] Pre-denaturation 98 °C 3 min Denaturation 98 °C 10 s Annealing 55°C 5 s Extension 68 °C 15 s Final extension 68 °C 10 min

[0051] The restriction enzymes Spe I and Bgl II were used to double-digest the plant expression vector pCAMBIA3301 plasmid, and then the digested plasmid was connected to the purified PCR product by homologous ligase. The ligated product was transformed into Escherichia coli DH5α competent cells. After culturing at 37°C for 14-18 h, a single clone was picked and identified by bacterial liquid PCR. The corresponding bacterial liquid with the correct PCR band size was selected for first-generation sequencing verification. GmMMP1 PCR identification of transformed E. coli Figure 1 As shown, the construction of the recombinant plasmid pCAMBIA3301-GmMMP1 was finally completed. The recombinant plasmid was further transformed into Agrobacterium EHA105 competent cells, and a single clone was picked and identified by PCR of Agrobacterium bacterial solution. The reaction system and procedure were the same as above, and the bacterial solution with correct PCR was retained for subsequent soybean genetic transformation work.

[0052] The cloning primers are:

[0053] Forward primer: 5-'ACTCTTGACCATGGTAGATCTGATGAAACCGTACCTACGTGCAA-3',

[0054] Reverse primer: 5-'GTCATCCTTGTAATCACTAGTATACAAAAGGAGCAATACGTAAGC-3'.

[0055] Example 2: Transfer GmMMP1 Obtaining Gene Overexpression Soybean

[0056] To clarify the function of this gene, the soybean stable genetic transformation method mediated by Agrobacterium tumefaciens was used to obtain regenerated plants and conduct transgenic molecular identification. Specifically, the Dongnong 50 seeds without lesions and uniform in size were sterilized, then soaked in sterile water, and rinsed with sterile water 2-3 times after germination for 20 hours. The rinsed seeds were cut into two, the hypocotyl was retained 3-4mm, peeled, the buds were removed, and 6-8 cuts were made along the cotyledon node. At the same time, the prepared pCAMBIA3301-GmMMP1 Agrobacterium solution and the cut soybeans were placed in a triangular flask for co-cultivation for 30 minutes, and the excess bacterial solution was absorbed and placed on the co-cultivation medium. After 3-4 days of dark culture, it was transferred to the recovery medium. After one week of normal culture, it was transferred to the screening medium for 2 screenings and then moved to the stem elongation stage. Replace the elongation medium every 2 weeks, and continue subculturing 3-4 times. When the stem length in the elongation medium is greater than 3 cm, it can be transferred from the callus to the rooting medium. After about 10-14 days, when the roots are long and the plant is in good condition, it can be trained at room temperature. After 3-4 days of training, transfer the regenerated seedlings to the shade and moist soil, and conduct positive identification of the regenerated seedlings after the plants grow well.

[0057] Through Bar test strip detection and PCR identification using transgenic specific primers, the T0 generation plants with the target band successfully amplified were harvested individually. Then, T1 generation plants were sown and identified. After the individual plants were harvested, T2 generation plants were sown and PCR identification and expression level determination were performed on T2 generation plants. The results showed that PCR amplification using gene-specific primers and agarose electrophoresis showed that the target band was consistent with expectations; further, the results of fluorescent quantitative PCR showed that the gene expression level of the overexpressed plants was significantly higher than that of the wild type (CK), indicating that GmMMP1 The gene has been transferred into Dongnong 50 and successfully overexpressed. The PCR identification results of the T2 generation of transgenic overexpressed soybean plants are as follows: Figure 3 The gene expression levels of transgenic overexpressed soybean T2 plants are as follows: Figure 4 The T2 generation transgenic soybeans obtained can be used for subsequent phenotypic disease resistance identification.

[0058] The transgene-specific primers are:

[0059] Forward primer: 5-'GCCCAGCTATCTGTCACTTT-3',

[0060] Reverse primer: 5-'TCGTCCTTATAATACTCAAAC-3'.

[0061] Embodiment 3: GmMMP1 Obtaining gene knockout mutants

[0062] based on GmMMP1 The gene sequence was designed to knock out the target site, constructed on the CRISPR / Cas9 vector, and the Agrobacterium-mediated method described in Scheme 3 was used to GmMMP1 The target genes were knocked out. The knockout target identification primers were designed, the genomic DNA of the regenerated plants was extracted, and the target was identified by PCR and sequenced. Finally, 7 soybean mutant lines were obtained, such as Figure 5 Further gene expression detection was performed and it was found that compared with the wild type, gene expression in the knockout strain was significantly downregulated, such as Figure 6 The knockout lines with effective frameshift editing and significantly reduced gene expression in T2 were used for subsequent phenotypic disease resistance identification.

[0063] The primers for knockout target identification are:

[0064] Forward primer: 5-'CGCTGGTTCCCAAACAGAAA-3',

[0065] Reverse primer: 5-'CCTTTCGTTGCTGTGATGAC-3'.

[0066] Example 4: Transgenic overexpression and identification of disease resistance of soybean mutants

[0067] The above T2 generation overexpression was obtained by friction inoculation method. GmMMP1 Plants (OE#1 and OE#2) and knockout plants (KO#1 and KO#2) were inoculated with SMV and their resistance was identified by phenotypic observation and RNA level analysis. The results showed that when the wild-type soybean leaves began to show symptoms such as vesicles, the transgenic GmMMP1 The leaves of the plants showed no disease symptoms, but the leaves of the knockout soybeans showed obvious signs of disease such as shrinkage and vesicles. Figure 7 In addition, according to the viral coat protein gene CP Design quantitative primers and CP The gene expression level was measured, and the results showed that the expression level of the CP gene in the overexpressed soybean was significantly reduced compared with the wild type, while in the knockout plants, CP The gene expression increased significantly Figure 8 Therefore, the present invention confirms that soybean matrix metalloproteinase gene GmMMP1 It can enhance soybean resistance to SMV.

[0068] The quantitative primers are:

[0069] Forward primer: 5-'GTGGGTGATGATGGATGG - 3',

[0070] Reverse primer: 5-'TGCCCTGTTTGGTGTTTT - 3'.

[0071] Example 5: Subcellular localization of GmMMP1 protein

[0072] according to GmMMP1 The CDS region sequence of the gene was obtained, and the 15 bp sequences on the left and right sides of the Nco I restriction site of the pCAMBIA1302 vector were selected as homology arms. Subcellular localization primers were designed to construct the GmMMP1-GFP fusion expression vector and transform Agrobacterium tumefaciens GV3101 (pSoup-p19). The localization of the protein in the cell was observed under a laser confocal microscope using tobacco transient expression. The results are shown in Figure 2 It was preliminarily determined that GmMMP1 protein was mainly located in the cytoplasm and cell membrane.

[0073] Subcellular localization primers are:

[0074] Forward primer: 5-'CGGGGGACTCTTGACATGAAACCGTACCTACGTGCAA - 3',

[0075] Reverse primer: 5-'GTCAGATCTACCATGTATACAAAAGGAGCAATACGTAAGC-3'.

[0076] Embodiment 6: GmMMP1 Verification of interaction with SMV functional proteins

[0077] In order to clarify the possible disease resistance mechanism of this gene, we first designed and constructed the yeast recombinant plasmid pGBKT7-GmMMP1, and constructed the 10 functional proteins of SMV on the pGADT7 vector. GmMMP1 The interaction relationship with each functional protein of SMV. Specifically, the plasmids of each recombinant vector were extracted respectively, and pGBKT7-GmMMP1 was co-transfected with pGADT7-SMV-10 functional protein plasmids into Y2H GOLD yeast competent cells, first coated on SD / -Leu-Trp solid plates, cultured at 28-30℃ for about 2 days, single clones were picked and dissolved in 0.9% NaCl, 2 ul was taken and spotted on SD / -Leu-Trp-His-Ade / X-α-gal solid plates, cultured at 28-30℃ for about 3 days, and the colonies were observed to turn blue. The results showed that Fig. 9 In the yeast system, GmMMP1 protein may interact with 6K1 and HC-Pro proteins of SMV.

[0078] It should be noted that, in this article, terms such as "comprises", "includes" or any other variations thereof are intended to cover non-exclusive inclusion, so that a process, method, article or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or apparatus.

[0079] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Soybean matrix metalloproteinase gene interacting with soybean mosaic virus protein GmMMP1 Application of protein in resistance to soybean mosaic virus; The soybean matrix metalloproteinase gene GmMMP1 The nucleotide sequence is shown in SEQ ID No. 1; The soybean matrix metalloproteinase gene GmMMP1 The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

2. A soybean matrix metalloproteinase gene GmMMP1 A method for improving soybean resistance to soybean mosaic virus, characterized in that: The method comprises the following steps: (1) Clone the gene shown in SEQ ID No. 1 GmMMP1 Gene; (2) Constructing a plant expression vector pCAMBIA3301-GmMMP1; the basic expression vector of the plant expression vector pCAMBIA3301-GmMMP1 is the pCAMBIA3301 expression vector, and the plant expression vector pCAMBIA3301-GmMMP1 includes the GmMMP1 Gene sequence; (3) Agrobacterium-mediated soybean stable genetic transformation method was used to cultivate and detect transgenic overexpression soybean plants.

3. The soybean matrix metalloproteinase gene according to claim 2 GmMMP1 A method for improving soybean resistance to soybean mosaic virus, characterized in that: The clone in step (1) is shown in SEQ ID No.1 GmMMP1 The gene method is as follows: extract total RNA from the leaves of Williams 82 soybean, reverse transcribe it into cDNA first strand as PCR amplification template, and GmMMP1 Design cloning primers based on gene sequence, perform PCR amplification using high-fidelity enzyme, gel recovery and purification to obtain amplified GmMMP1 Gene fragments; The cloning primers are: Forward primer: 5-'ACTCTTGACCATGGTAGATCTGATGAAACCGTACCTACGTGCAA-3', Reverse primer: 5-'GTCATCCTTGTAATCACTAGTATACAAAAGGAGCAATACGTAAGC-3'.

4. The soybean matrix metalloproteinase gene according to claim 3 GmMMP1 A method for improving soybean resistance to soybean mosaic virus, characterized in that: Step (2) The plant expression vector pCAMBIA3301-GmMMP1 is constructed by the following steps: The expression vector pCAMBIA3301 plasmid was double-digested with restriction enzymes Spe I and Bgl II; The double-digested plasmid is connected to the amplified GmMMP1 The gene fragments were connected and transformed into competent E. coli DH5α cells. The plant expression vector pCAMBIA3301-GmMMP1 was obtained after PCR identification of the bacterial solution.

5. The soybean matrix metalloproteinase gene according to claim 2 GmMMP1 A method for improving soybean resistance to soybean mosaic virus, characterized in that: The specific steps in step (3) are: The plant expression vector pCAMBIA3301-GmMMP1 constructed in step (2) was transformed into Agrobacterium EHA105 competent cells. After PCR identification of the Agrobacterium bacterial solution, regenerated plants were obtained by Agrobacterium-mediated stable genetic transformation of soybeans. The plants were transferred to the screening medium for subculture 3-4 times, and the target band was amplified by PCR identification using Bar test strips and transgenic specific primers. GmMMP1 After harvesting individual plants, repeated sowing is performed to obtain the T2 generation GmMMP1 Plants, T2 generation GmMMP1 Plant PCR identification and identification of disease resistance of soybean mutants; The transgenic specific primers are: Forward primer: 5-'GCCCAGCTATCTGTCACTTT-3', Reverse primer: 5-'TCGTCCTTATAATACTCAAAC-3'.

6. The soybean matrix metalloproteinase gene according to claim 5 GmMMP1 A method for improving soybean resistance to soybean mosaic virus, characterized in that: The specific steps of identifying the disease resistance of the mutant soybean are: Agrobacterium-mediated GmMMP1 Directed knockout of the gene, designing knockout target identification primers, extracting genomic DNA of the regenerated plant, and performing PCR identification and sequencing analysis of the target to obtain soybean mutant strains; For the T2 generation GmMMP1 The plants and the soybean mutant strains are inoculated with soybean mosaic virus and their disease resistance is identified; The knockout target identification primers are: Forward primer: 5-'CGCTGGTTCCCAAACAGAAA-3', Reverse primer: 5-'CCTTTCGTTGCTGTGATGAC-3'.

7. The soybean matrix metalloproteinase gene according to claim 2 GmMMP1 Methods for improving soybean resistance to soybean mosaic virus and applications of genetic engineering in soybean resistance to soybean mosaic virus.

Images