Use of immunogenic protein FvXynC and protein combination in plant disease resistance

By using the immune-inducing protein FvXynC and its protein combination with FvGH43A, the plant immune system is activated, solving the problems of drug resistance and environmental pollution caused by chemical pesticides in the control of Fusarium diseases, and achieving broad-spectrum disease resistance and synergistic effects.

CN121737206BActive Publication Date: 2026-05-01SHANDONG AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANDONG AGRICULTURAL UNIVERSITY
Filing Date
2026-02-27
Publication Date
2026-05-01

AI Technical Summary

Technical Problem

In existing technologies, the use of chemical pesticides to control Fusarium diseases has problems such as increased resistance, environmental pollution, and decreased control efficacy. Furthermore, the effect of single immune-inducing proteins on plant disease control is limited.

Method used

The immune-inducing protein FvXynC and its protein combination with FvGH43A were used to enhance plant disease resistance through exogenous application or overexpression in plants. High-purity FvXynC protein was prepared using a yeast eukaryotic expression system and AKTA high-efficiency protein purification technology to activate the plant immune system.

Benefits of technology

It significantly enhances plant resistance to Fusarium, covering a variety of plant diseases, including corn ear rot and stem rot, wheat stem base rot, etc., achieving a dual breakthrough of broad-spectrum disease resistance and eco-friendliness. Moreover, the protein combination synergistically enhances corn resistance to Fusarium verticillatum.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121737206B_ABST
    Figure CN121737206B_ABST
Patent Text Reader

Abstract

The application discloses application of an immune elicitor protein FvXynC and a protein combination in plant disease resistance, and belongs to the technical field of plant immune elicitors. A new immune elicitor protein FvXynC is found from F. pseudograminearum, and the immune elicitor protein has the core functions of activating plant immune response and improving plant resistance to F. pseudograminearum, can be used as an efficient plant immune inducer, provides a new technical path for plant disease resistance improvement and green plant disease control, and has important agricultural application value. The FvXynC and the immune elicitor protein FvGH43A are compounded, so that the resistance level of corn to F. pseudograminearum can be synergistically improved, and the problem that the plant disease control effect of a single immune elicitor protein is limited is solved.
Need to check novelty before this filing date? Find Prior Art

Description

Application of an immune-inducing protein FvXynC and protein assemblies in plant disease resistance Technical Field

[0001] This invention relates to the field of plant immune induction technology, specifically to the application of an immune induction protein and protein combination in plant disease resistance. Background Technology

[0002] Fusarium verticillioides is a pathogenic fungus that seriously harms maize production. Diseases such as stalk rot, ear rot, and root rot caused by Fusarium verticillioides often lead to significant yield reductions and quality declines. Furthermore, it produces fumonisins, threatening human health and causing various diseases including cancer, stunted growth, and neurological disorders. Currently, chemical control is the main method for controlling Fusarium diseases in crops. However, long-term reliance on and improper use of chemical pesticides have led to increasing resistance in Fusarium, significantly reduced field control effectiveness, excessive pesticide residues in crops, and a series of subsequent problems such as environmental pollution.

[0003] In recent years, green control technologies centered on biological control have attracted much attention due to their numerous advantages, including environmental friendliness, safety, durability, and sustainability. Among these, plant immune inducers have become a key direction in the development of next-generation green pesticides. Plant immune inducers can activate the plant's innate immune system, thereby significantly enhancing disease resistance, but they themselves do not possess fungicidal activity. Therefore, they greatly reduce the development of pathogen resistance and achieve a dual breakthrough of broad-spectrum disease resistance and eco-friendliness. However, the types of immune inducers currently reported for controlling Fusarium solani in maize are limited; and the control efficacy of single immune inducers against plant diseases still needs further improvement. Summary of the Invention

[0004] In view of the above-mentioned prior art, the purpose of this invention is to provide an application of the immune-inducing protein FvXynC and protein combination in plant disease resistance.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A first aspect of the present invention provides the application of the immune-inducing protein FvXynC in plant disease resistance; said immune-inducing protein FvXynC is a protein as shown in (A1) or (A2) below:

[0007] (A1) A protein consisting of the amino acid sequence shown in SEQ ID NO.1 of the sequence listing;

[0008] (A2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1).

[0009] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0010] In the above applications, the plant disease resistance refers to resistance to plant diseases caused by Fusarium; specifically, it includes typical disease types such as corn ear rot and stem rot, wheat stem base rot, tobacco Fusarium root rot, wilt of solanaceous plants, and wheat scab.

[0011] In the above applications, plant disease resistance is enhanced by exogenously applying the immune-inducing protein FvXynC or by overexpressing the gene encoding the immune-inducing protein FvXynC in plants.

[0012] Preferably, the concentration of the exogenously applied immune-inducing protein FvXynC is 1 μM-500 μM.

[0013] Preferably, the gene encoding the immune-inducing protein FvXynC is a nucleic acid molecule as shown in i) or ii) below:

[0014] i) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.2;

[0015] ii) Nucleic acid molecules other than those in i) that encode the amino acid sequence shown in SEQ ID NO.1.

[0016] Furthermore, the overexpression of the gene encoding the immune-inducing protein FvXynC was achieved by introducing the following substances into the plant:

[0017] C1) An expression cassette containing the gene encoding the immune-inducing protein FvXynC;

[0018] C2) A recombinant vector containing the gene encoding the immune-inducing protein FvXynC, or a recombinant vector containing the expression cassette described in C1);

[0019] C3) Recombinant microorganisms containing the gene encoding the immune-inducing protein FvXynC, or recombinant microorganisms containing the expression cassette described in C1), or recombinant microorganisms containing the recombinant vector described in C2).

[0020] This invention screened a novel immune-inducing protein from the standard strain Fv7600 of *Fusarium verticillioides*, and named it FvXynC. The immune-inducing protein FvXynC of this invention possesses highly efficient and broad-spectrum plant immune activation potential, capable of inducing programmed cell death in various plants, triggering reactive oxygen species bursts, and promoting the expression of resistance genes, thereby significantly enhancing plant disease resistance.

[0021] In a second aspect, the present invention provides a protein combination composed of the aforementioned immune-inducing protein FvXynC and immune-inducing protein FvGH43A;

[0022] The amino acid sequence of the immune-inducing protein FvGH43A is shown in SEQ ID NO.3.

[0023] In some preferred embodiments of the present invention, the protein combination is composed of equal volumes of 1 μM immune-inducing protein FvXynC and 1 μM immune-inducing protein FvGH43A.

[0024] A third aspect of the invention provides the use of the above-described protein combination in (1) or (2) as follows:

[0025] (1) Enhance plant disease resistance;

[0026] (2) Prepare immune inducers to enhance plant disease resistance.

[0027] In the above applications, the plant disease resistance refers to resistance to plant diseases caused by Fusarium; specifically, it includes typical disease types such as corn ear rot and stem rot, wheat stem base rot, tobacco Fusarium root rot, wilt of solanaceous plants, and wheat scab.

[0028] In some preferred embodiments of the present invention, the plant disease resistance is resistance to plant diseases caused by Fusarium verticillatum.

[0029] The beneficial effects of this invention are:

[0030] (1) This invention has discovered a new immune-inducing protein FvXynC from Fusarium oxysporum. This immune-inducing protein FvXynC has the core function of activating plant immune response and enhancing plant resistance to Fusarium. It can be used as a highly efficient plant immune-inducing factor, providing a new technical path for improving plant disease resistance and green control of plant diseases, and has important agricultural application value.

[0031] To achieve the large-scale preparation of the immune-inducing protein FvXynC, this invention utilizes a yeast eukaryotic expression system combined with AKTA high-efficiency protein purification technology to successfully obtain high-purity recombinant FvXynC protein. Experimental verification shows that this purified protein can effectively activate the immune systems of maize and tobacco, significantly enhancing maize's resistance to Fusarium. Its disease resistance spectrum clearly covers a variety of important plant diseases caused by Fusarium, including maize ear rot and stem rot, wheat stem base rot, tobacco Fusarium root rot, solanaceous plant wilt, and wheat scab.

[0032] (2) The combination of the immune-inducing protein FvXynC and the immune-inducing protein FvGH43A of the present invention can synergistically enhance the resistance level of maize to Fusarium verticillatum, achieving a 1+1>2 effect; and solves the problem that the control effect of a single immune-inducing protein on plant diseases is limited. Attached Figure Description

[0033] Figure 1: Electrophoresis diagram of FvXynC protein.

[0034] Figure 2: FvXynC inoculation in Experiment 1 induced programmed cell death in tobacco cells.

[0035] Figure 3: Inoculation with FvXynC in Experiment 1 induced programmed cell death in various plants; in the figure, A: corn, B: pepper, C: cotton, D: soybean, E: sweet potato, F: tomato.

[0036] Figure 4: The reactive oxygen species burst in corn after inoculation with FvXynC in Experiment Example 1.

[0037] Figure 5: Upregulation of maize defense genes after inoculation with FvXynC in Experiment 1.

[0038] Figure 6: Phenotypic photographs of maize after inoculation with FvXynC and protein combination in Experiment Example 2; In the figure, AE represent treatment group A to treatment group E, respectively.

[0039] Figure 7: Disease incidence of maize after inoculation with FvXynC and protein combination in Experiment 2; In the figure, AE represent treatment group A to treatment group E respectively.

[0040] Figure 8: Disease index of maize after inoculation with FvXynC and protein combination in Experiment 2; In the figure, AE represent treatment group A to treatment group E respectively. Detailed Implementation

[0041] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0042] As mentioned earlier, the types of immune-inducing proteins that can be used to control Fusarium moniliforme disease in maize are currently limited; and the control efficacy of single immune-inducing proteins against plant diseases still needs to be further improved.

[0043] In view of this, based on the transcriptome data of *Fusarium verticillioides* during the early stage of maize infection, this invention screened a gene with significantly increased expression levels, speculating that it may play an important role in the interaction between the pathogen and maize, and is a key candidate gene, named FvXynC. RNA was extracted from the hyphae of the standard strain Fv7600 of *Fusarium verticillioides*, and cDNA was obtained by reverse transcription. PCR amplification yielded a complete 1011 bp fragment. After confirming the correct gene sequence through sequencing, it was ligated into the yeast eukaryotic expression vector pPIC9K to obtain the eukaryotic expression plasmid pPIC9K / FvXynC. The eukaryotic expression plasmid pPIC9K / FvXynC was transformed into competent cells of *Pichia pastoris* strain GS115 by electroporation transformation. After G418 resistance selection, an engineered *Pichia pastoris* strain containing the eukaryotic expression plasmid pPIC9K / FvXynC was obtained. A large amount of purified recombinant protein FvXynC was obtained using a yeast eukaryotic expression system combined with the AKTA high-efficiency protein purification system.

[0044] This invention validated the plant immune-inducing activity of FvXynC protein through a multi-dimensional experimental system, fully demonstrating its core potential as a highly efficient and broad-spectrum plant immune activator, providing a novel solution for green control of crop diseases. In the specific implementation, tobacco was first used as a model plant for validation, with purified FvXynC protein at gradient concentrations ranging from 1 to 500 μM inoculated onto tobacco leaves. Experimental results showed that the protein possesses extremely strong immune-activating activity: even at a low concentration of 1 μM, it could rapidly induce clear and regular necrotic spots at the inoculation site of tobacco leaves within a short time. This phenotype is a typical feature of programmed cell death in plant immune responses, directly proving that FvXynC protein can efficiently trigger early immune responses in plants. To clarify its broad-spectrum immune-inducing activity, 10 μM FvXynC protein was further inoculated onto the leaves of six important crops: corn, pepper, cotton, soybean, sweet potato, and tomato. The results showed that the protein stably induced programmed cell death in all tested plants, with consistent and distinct necrotic spot phenotypes, unaffected by differences in plant families and genera, confirming its excellent cross-species immune activation ability. To further elucidate the immune activation mechanism, the reactive oxygen species (ROS) burst in maize leaves was detected using a luminol (HRP) chemiluminescence assay. Treatment with 1 μM FvXynC protein rapidly initiated an ROS burst response, with significantly higher luminescence signal intensity than the control group. The ROS burst is a key early event for plants to recognize exogenous signals and initiate basal immunity, further supporting the evidence that FvXynC protein can effectively activate plant innate immune pathways. Molecular-level analysis revealed that in maize leaves treated with 1 μM FvXynC protein, key defense-related genes ZmLOX4, ZmLOX5, ZmPAL1, and ZmPR-1 showed significant upregulation shortly after treatment. These genes are involved in core immune pathways such as jasmonic acid synthesis, phenylpropane metabolism, ROS scavenging, and the synthesis of disease-related proteins, respectively, confirming at the molecular level that FvXynC protein can rapidly activate plant immune signal transduction. Potted plant efficacy trials further validated its practical value: maize plants pretreated with 1 μM FvXynC protein showed a significant reduction in disease severity after inoculation with Fusarium oxysporum. In conclusion, FvXynC protein can rapidly and broadly activate multiple plant immune systems at low concentrations, significantly enhancing crop resistance to important pathogens such as Fusarium oxysporum, and possesses broad application prospects as a novel broad-spectrum crop immune activator.

[0045] To further enhance the immune-inducing effect of FvXynC protein, this invention combines FvXynC protein with FvGH43A, an immune-inducing protein discovered in previous studies by the inventors. It was found that the two can synergistically enhance the resistance of maize to Fusarium wilt.

[0046] To enable those skilled in the art to more clearly understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments. The experimental materials used in the embodiments of this invention are all conventional experimental materials in the art and can be purchased through commercial channels. Wherein:

[0047] The *F. verticillioides* used in this embodiment of the invention is the standard strain Fv7600 of *F. verticillioides*.

[0048] The immune-inducing protein FvGH43A used in this invention has the amino acid sequence shown in SEQ ID NO.3; it can be obtained by exogenous expression in eukaryotes or prokaryotes; or it can be prepared by existing chemical synthesis techniques.

[0049] The culture medium and its components used in the embodiments of this invention are as follows:

[0050] MD medium: 13.4 g / L yeast basic nitrogen source (purchased from Sigma-Aldrich, USA, catalog number Y1250); 0.4 mg / L biotin; 20 g / L glucose.

[0051] YPD medium: 1% (w / v) yeast extract, 2% (w / v) peptone, 2% (w / v) glucose, 2% (w / v) agar powder; all are mass / volume ratios, in g / 100 mL.

[0052] BMGY medium: yeast extract: 1.0 g, peptone: 2.0 g, YNB: 1.34 g, 0.1 mol / L pH 7.4 phosphate buffer, glycerol: 1.0 mL, add distilled water to 100 mL.

[0053] BMMY medium: yeast extract: 1.0 g, peptone: 2.0 g, YNB: 1.34 g, 0.1 mol / L pH 7.4 phosphate buffer, after high-temperature sterilization, add 1 mL of methanol to every 100 mL of medium.

[0054] Example 1: Preparation of immune-inducing protein FvXynC

[0055] 1. Construction of recombinant expression vectors:

[0056] RNA was extracted from the hyphae of the standard strain Fv7600 of *Fusarium verticillatum*, and specific primers for the FvXynC gene were designed as follows:

[0057] FvXynC-F: CCGGAATTCAACCCCGTTCCTGAT; (SEQ ID NO.4)

[0058] FvXynC-R:TTGCGGCCGCTTAGTGGTGGTGGTGGTGGTGGCGGCGGTTAATGGT. (SEQ ID NO.5)

[0059] The amplification product with EcoRI and NotI restriction sites at both ends was obtained by RT-PCR amplification. The amplification product was then ligated into the double-digested yeast expression vector pPIC9K to obtain the yeast expression plasmid pPIC9K / FvXynC carrying the target gene.

[0060] The yeast expression plasmid pPIC9K / FvXynC was transformed into E. coli competent cells T1 and cultured at 28°C for 12 h. Single colonies were picked and cultured in 1 mL of LB broth containing 50 μg / mL kanamycin at 37°C with shaking for 6 h. 1.5 μL of the bacterial culture was used as a template for PCR verification and sequencing of the product. The sequence was correct, and the recombinant expression vector (pPIC9K / FvXynC) carrying the target gene was obtained.

[0061] 2. Construction of engineered yeast strains:

[0062] 20 μL of *E. coli* culture containing the recombinant expression vector (pPIC9K / FvXynC) was added to 20 mL of LB broth containing 50 μg / mL kanamycin and cultured at 37°C with shaking for 12 h. The plasmid was extracted and its concentration determined according to the instructions of the plasmid mini-prep kit. Linearized restriction endonucleases PmeI and AP were selected, and the reaction was carried out according to the restriction endonuclease kit instructions to prepare the linearized expression vector.

[0063] The linearized expression vector was electroporated into competent yeast cells, and the yeast strain was constructed by screening and sequencing verification.

[0064] 3. Eukaryotic expression, isolation, and purification of FvXynC protein:

[0065] The constructed engineered yeast strain was streaked on YPD medium and cultured at 28°C for 2 days. After that, the activated engineered strain was picked and inoculated into BMGY medium and cultured with shaking at 28°C and 200 rpm for 24 h. After centrifugation at 4200 rpm, the bacterial culture was transferred to BMMY medium to start induction expression. 1 mL of methanol was added every 24 h for 7 consecutive days. After that, the supernatant crude enzyme solution was collected at 10°C and 8000 rpm for 20 min.

[0066] Add dried ammonium sulfate powder to the crude enzyme solution until saturated, then let it stand overnight at 4°C. Centrifuge at 10°C / 8000 rpm / 20 min, discard the supernatant, add 3 mL of PBS (pH=7.4) buffer, and after all the precipitated protein has dissolved, transfer it to a dialysis bag and dialyze in PBS buffer for 24 h. Centrifuge at 4°C / 8000 rpm / 15 min to collect the supernatant.

[0067] The protein was purified using an AKTA protein purification system equipped with a His Trap™ HP chromatography column to prepare FvXynC protein.

[0068] The molecular weight of FvXynC protein was detected by SDS-PAGE denaturing electrophoresis. The results are shown in Figure 1. There was only one independent protein band, which was clear, bright and of the expected size, confirming the correct expression of the protein.

[0069] The purified FvXynC protein was sequenced, and its amino acid sequence is shown in SEQ ID NO.1.

[0070] Example 2: Preparation of protein assemblies

[0071] The protein combination was prepared by mixing 1 μM of FvXynC protein prepared in Example 1 with 1 μM of immune-inducing protein FvGH43A in equal volumes.

[0072] Experimental Example 1: Investigation of the ability of FvXynC protein to activate plant immunity

[0073] 1. Test method:

[0074] (1) Detection of programmed cell death:

[0075] One-month-old tobacco plants were used as material, and purified FvXynC protein at concentrations ranging from 1 to 500 μM was inoculated into the leaves. A 10 μM PBS buffer (pH = 7.4) was provided as a blank control. Forty-eight hours after inoculation, the occurrence of programmed cell death (PCD) at the inoculation site was detected by trypan blue staining.

[0076] Six crops susceptible to Fusarium infection—corn, chili pepper, cotton, sweet potato, soybean, and tomato—were selected as test hosts. 10 μM FvXynC protein was inoculated into the leaves of each crop, with 10 μM PBS buffer (pH=7.4) used as a blank control. Leaf cell death was observed 48 hours after inoculation.

[0077] (2) Detection of reactive oxygen species bursts:

[0078] One-week-old healthy maize leaves were used as material. The fluorescence signal was detected using luminol (HRP) chemiluminescence assay via a Glomax20 / 20 luminescence detector (Promega). The specific procedures were as follows: First, sample pretreatment was performed: leaf discs were prepared from maize leaves using a 4 mm perforator, rinsed in 9 cm petri dishes, and then transferred to 96-well plates containing 200 μL of ultrapure water per well. The discs were soaked overnight to equilibrate the physiological state of the leaves. Next, the reaction solutions were prepared: the experimental group reaction solution consisted of 100 μL of 50 μM luminol reagent (Bio-Rad), 1 μL of 50 μg / mL horseradish peroxidase (HRP, Sigma), and 10 μL of 10 μM FvXynC protein; the control group reaction solution used 10 μL of 10 μM PBS buffer (pH=7.4) instead of FvXynC protein, with the remaining components consistent with the experimental group. During the detection process, each sample was tested in triplicate to ensure the reliability of the experimental results. After the reaction solution is prepared, it is quickly added to the corresponding well, and the fluorescence signal changes are monitored and recorded using a Glomax20 / 20 luminescence detector (Promega) to reflect the dynamics of reactive oxygen species production.

[0079] (3) Detection of resistance gene expression:

[0080] Using one-week-old healthy maize seedlings as the research subject, the specific procedures were as follows: 20 μL of 1 μM FvXynC protein was inoculated into maize leaves, and leaf samples were collected at two key time points: 0 h and 3 h post-inoculation. The collected samples were used for total RNA extraction, and the expression levels of target genes were subsequently detected using real-time quantitative PCR (RT-qPCR). The core maize defense genes ZmLOX4, ZmLOX5, ZmPAL1, and ZmPR-1 were selected as detection targets, and their specific primer design information is detailed in Table 1. Simultaneously, the ZmEF1a gene was used as an internal control for standardized calibration of gene expression levels to ensure the reliability of the detection results. The RT-qPCR reaction system and reaction conditions are shown in Tables 2-3.

[0081] Table 1: List of Primers for Defense Gene Design

[0082]

[0083] Table 2: RT-qPCR reaction system

[0084]

[0085] Table 3: RT-qPCR amplification reaction conditions

[0086]

[0087] This study used quantitative real-time PCR to determine gene expression levels, with ZmEF1a selected as the internal reference gene. Simultaneously, 2... -ΔΔt The method was used to calculate the relative expression levels, and the expression level data of the resistance gene were obtained.

[0088] 2. Test Results:

[0089] (1) Results of programmed cell death detection:

[0090] Figure 2 shows the PCD (Potential Cell Death) detection results after inoculating tobacco leaves with FvXynC protein at concentrations ranging from 1 to 500 μM. The results indicate that the induction of PCD in tobacco cells by FvXynC protein is concentration-dependent: programmed cell death in tobacco cells can be successfully triggered even at a protein concentration as low as 1 μM. As the concentration gradient of FvXynC protein increases, the staining depth of trypan blue gradually increases, indicating that the degree of cell death intensifies with increasing protein concentration, thus confirming the concentration-dependent nature of its immune activation effect. Most importantly, this protein can effectively initiate a plant immune response at a low concentration of 1 μM, highlighting its highly efficient immune activation characteristics.

[0091] Figure 3 shows the PCD detection results of FvXynC protein inoculated on leaves of different plants. The results indicate that the immune activation effect of FvXynC protein is not limited by plant species and has a broad spectrum across families and genera, providing key experimental evidence for its development into a universal immune activator for multiple crops.

[0092] (2) Results of reactive oxygen species burst detection:

[0093] Figure 4 shows the results of detecting the reactive oxygen species (ROS) burst triggered by FvXynC protein in maize. Compared with the control group inoculated with 10 μM PBS buffer (pH=7.4), maize leaves treated with FvXynC protein showed a significant ROS burst within a short period of time, while the ROS level in the control group leaves did not fluctuate significantly. This result indicates that FvXynC protein can effectively induce early immune signal transduction in maize, thereby rapidly triggering the production of ROS, providing direct experimental evidence for its activation of the plant's basal immune response.

[0094] (3) Detection results of resistance gene expression:

[0095] Figure 5 shows the regulation of FvXynC protein on the expression of defense-related genes in maize. The results indicate that in maize leaves treated with 1 μM FvXynC protein, key defense-related genes ZmLOX4, ZmLOX5, ZmPAL1, and ZmPR-1 showed significant upregulation shortly after treatment. These genes are involved in core immune pathways such as jasmonic acid synthesis, phenylpropane metabolism, reactive oxygen species scavenging, and pathogenesis-related protein synthesis. This molecular-level evidence confirms that FvXynC protein can rapidly activate plant immune signal transduction.

[0096] Experimental Example 2: Investigation of the disease resistance of FvXynC protein and protein combinations in maize

[0097] 1. Test method:

[0098] Two-week-old maize plants with similar growth were used as the experimental subjects, and the following treatments were set up:

[0099] Treatment A: Use only 50 mL of clean water to irrigate the roots as a control;

[0100] Treatment B: Use 50 mL of Fusarium oxysporum Fv7600 spore suspension (spore concentration 1×10⁻⁶). 7 (cfu / mL) root irrigation;

[0101] Treatment C: Inoculate maize leaves with 20 μL of 1 μM FvGH43A protein. After 24 h, inoculate with 50 mL of Fusarium verticillatum Fv7600 spore suspension (spore concentration 1×10⁻⁶). 7 (cfu / mL) root irrigation;

[0102] Treatment D: Maize leaves were inoculated with 20 μL of 1 μM FvXynC protein. After 24 h, the maize leaves were inoculated with 50 mL of Fusarium verticillatum Fv7600 spore suspension (spore concentration of 1×10⁻⁶). 7 (cfu / mL) root irrigation;

[0103] Treatment E: Mix 10 μL of 1 μM FvXynC with 10 μL of 1 μM FvGH43A, and inoculate the entire mixture into maize leaves. After 24 h, inoculate with 50 mL of Fusarium verticillatum Fv7600 spore suspension (spore concentration 1×10⁻⁶). 7 (cfu / mL) root irrigation.

[0104] Each treatment consisted of 30 corn plants, and the disease incidence was observed after 48 hours. Disease classification was performed according to existing techniques (“Research on Identification and Integrated Control Technology of Maize Stalk Rot Pathogen” [J]. Seed Science and Technology, 2025, 43(16):134-136.).

[0105] Grade 0 indicates no disease; Grade 1 indicates slight discoloration at the base of the stem; Grade 2 indicates lesions covering less than 1 / 4 of the stem base; Grade 3 indicates lesions covering 1 / 4 to 1 / 2 of the stem base; Grade 4 indicates lesions covering 1 / 2 to 3 / 4 of the stem base; Grade 5 indicates lesions covering more than 3 / 4 of the stem base or the plant has collapsed.

[0106] Calculate the incidence rate and disease index using the following formula:

[0107] Incidence rate (%) = (Number of infected plants ÷ Total number of plants) × 100%

[0108] Disease index = ∑(Number of diseased plants at each level × Corresponding level) ÷ (Total number of plants surveyed × Highest level) × 100

[0109] 2. Test Results:

[0110] Phenotypic photographs of maize in each treatment group after 48 h are shown in Figure 6, and statistical results of morbidity and disease index are shown in Figures 7-8. The results showed that the disease index of treatment group B was 90.20±3.65, the disease index of treatment group C was 68.43±3.37, the disease index of treatment group D was 62.57±2.65, and the disease index of treatment group E was 38.20±2.15. Compared with treatment group B, FvXynC, FvGH43A, and their mixture all significantly enhanced the resistance of maize to Fusarium. Moreover, the protein combination of FvXynC and FvGH43A significantly improved the disease resistance of maize than FvXynC or FvGH43A alone, indicating that the two have a synergistic effect.

[0111] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. The application of the immune-inducing protein FvXynC in improving plant disease resistance; characterized in that, The amino acid sequence of the immune-inducing protein FvXynC is shown in SEQ ID NO.1; the plant is maize; the disease resistance is resistance to diseases caused by Fusarium verticillatum.

2. The application according to claim 1, characterized in that, Plant disease resistance can be enhanced by exogenously applying the immune-inducing protein FvXynC or by overexpressing the gene encoding the immune-inducing protein FvXynC in plants.

3. The application according to claim 2, characterized in that, The concentration of exogenously applied immune-inducing protein FvXynC ranged from 1 μM to 500 μM.

4. The application according to claim 2, characterized in that, The gene encoding the immune-inducing protein FvXynC is a nucleic acid molecule as shown in either i) or ii): i) the nucleotide sequence of which is shown in SEQ ID NO.2; ii) a nucleic acid molecule other than i) that encodes the amino acid sequence shown in SEQ ID NO.

1.

5. The application according to claim 2, characterized in that, Overexpression of the gene encoding the immune-inducing protein FvXynC can be achieved by introducing the following substances into plants: C1) an expression cassette containing the gene encoding the immune-inducing protein FvXynC; C2) a recombinant vector containing the gene encoding the immune-inducing protein FvXynC, or a recombinant vector containing the expression cassette of C1); C3) a recombinant microorganism containing the gene encoding the immune-inducing protein FvXynC, or a recombinant microorganism containing the expression cassette of C1), or a recombinant microorganism containing the recombinant vector of C2).

6. The application of the protein combination in the following (1) or (2): (1) enhancing plant disease resistance; (2) preparing an immune inducer to enhance plant disease resistance; the protein combination is composed of equal volumes of 1 μM immune inducer protein FvXynC and 1 μM immune inducer protein FvGH43A; the amino acid sequence of the immune inducer protein FvXynC is shown in SEQ ID NO.1; the amino acid sequence of the immune inducer protein FvGH43A is shown in SEQ ID NO.3; the plant is maize; the disease resistance is resistance to diseases caused by Fusarium verticillatum.

Citation Information

Patent Citations

  • Animal feed compositions and uses thereof

    CN111492053A

  • Maize sheath surface paenibacillus polymyxa strain and application thereof

    CN112322555A