KASP primer set for wheat scab resistance detection and its application

By developing KASP primer sets and fluorescence detection technology, the problem of low screening efficiency for wheat scab resistance was solved, enabling rapid and accurate breeding selection and improving breeding efficiency.

CN118064633BActive Publication Date: 2026-05-26JIANGSU ACAD OF AGRI SCI

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JIANGSU ACAD OF AGRI SCI
Filing Date
2024-04-03
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently screening and breeding wheat varieties resistant to Fusarium head blight. Chemical control leads to increased costs and environmental pollution, while traditional molecular marker methods are inefficient and cannot quickly detect wheat resistance to Fusarium head blight.

Method used

A primer set based on competitive allele-specific PCR (KASP) markers was developed to detect Fusarium head blight resistance in wheat samples. The genotype of the samples was determined by fluorescence detection, providing a rapid and accurate molecular marker-assisted selection method.

Benefits of technology

This technology enables rapid detection and breeding selection of wheat resistance to Fusarium head blight, improving breeding efficiency, reducing field experiments, and increasing the efficiency of screening disease-resistant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118064633B_ABST
    Figure CN118064633B_ABST
Patent Text Reader

Abstract

This invention discloses a KASP primer set related to wheat scab resistance and its application, belonging to the field of crop breeding; the primer set contains specific primers with nucleotide sequences as shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 respectively; this KASP primer set can target molecular markers located on wheat chromosome 3A. Kfhb-3A Genotyping was performed, and experiments showed that wheat samples with the SNP locus genotype T exhibited statistically superior resistance to Fusarium head blight compared to wheat samples with the genotype C. This KSAP primer set can be used for marker-assisted selection breeding to improve the efficiency of Fusarium head blight resistance breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of wheat breeding, and in particular to a KASP marker associated with wheat scab resistance and its application. Background Technology

[0002] Fusarium head blight (FHB) is a global wheat spike disease caused by Fusarium spp., resulting not only in yield loss but also in the serious health risks posed by its fungal toxins. With global warming and changes in farming systems and practices, FHB is spreading to the Huang-Huai, Northern, Southwestern, and Northwestern wheat-growing regions, with increasing frequency of major epidemics. Changing farming systems and cultivation techniques is insufficient to address the infection and spread of FHB. While chemical control has achieved some success in controlling large-scale outbreaks and epidemics, it inevitably increases costs and causes environmental pollution. Therefore, developing resistant varieties has become the primary approach to mitigating the damage caused by FHB.

[0003] Extensive research has been conducted both domestically and internationally on the genetics of resistance to Fusarium head blight, identifying multiple resistance QTLs and naming eight resistance genes. Two loci, Fhb1 and Fhb7, have been successfully cloned. Fhb1 is currently recognized as the most stable and potent resistance locus, and it has been the most widely and successfully used in wheat resistance breeding (Zhang X, Rouse MN, Nava IC, Yue J, Anderson JA. 2016. Development and Verification of Wheat Germplasm Containing Both Sr2 and Fhb1. Molecular Breeding, 36, 85; Zhang Hongjun, Su Zhenqi, Bai Guihua, Zhang Xu, Ma Hongxiang, Li Teng, Deng Yun, Mai Chunyan, Yu Liqiang, Liu Hongwei, Yang Li, Li Hongjie, Zhou Yang. 2018. Using fhb1 gene functional markers to improve the resistance of wheat varieties to Fusarium head blight in the Huang-Huai winter wheat region. Acta Agronomica Sinica, 44, 505-511). The wheat-thinopyrum ponticum Fhb7 substitution line has been used by several breeding institutions both domestically and internationally. By introducing Fhb7 into different wheat varieties through molecular marker selection, the offspring lines showed significantly improved resistance to Fusarium head blight (Li X, Li D, Xuan Y, He Z, Zhao L, Hao Y, Ge W, Xu S, Hou B, Wang B, Guo J, Liu W, Li M, Han Y, Bo C, Bao Y, Qi Z, Xu SS, Bai G, Wang H, Kong L. 2023. Elimination of the Yellow Pigment Gene Psy-E2 Tightly Linked to the Fusarium Head Blight Resistance Gene Fhb7 from Thinopyrum ponticum. The Crop Journal, 11, 957-962; Li Zhengling, Zhang Yu, Han Liupeng, Wang Yongxia, Fang Yuhui, Hu Lin, Xu Weigang. 2022. Optimization of wheat scab resistance breeding technology system in southern Huang-Huai wheat region. Henan Agricultural Sciences, 51, 28-36. To meet production needs, new scab resistance genes urgently need to be discovered.

[0004] Single nucleotide polymorphism (SNP) markers, the third generation of molecular markers following restriction fragment length polymorphism (RFLP) and simple repeat sequence (SSR), possess advantages such as high density, strong representativeness, good genetic stability, and high automation, thus showing broad application potential in genetic research. Based on the accumulation of large amounts of sequencing data, microarray technology has developed rapidly, with the development of wheat microarrays such as Illumina iSelect 9k, Illumina iSelect 90k, and Affymetrix Axiom 660k, which are widely used in the construction of wheat genetic linkage maps, population structure, and linkage disequilibrium analysis. Kompetitive allele-specific PCR (KASP) markers are PCR techniques that use specific base matching at the primer ends to accurately biallelicly genotype SNPs and InDel sites in genomic DNA samples. Currently, they are widely used in marker-assisted selection in crops such as rice, wheat, and soybean.

[0005] The wheat-growing areas in the middle and lower reaches of the Yangtze River are traditionally areas prone to Fusarium head blight and are also the earliest regions in my country to carry out Fusarium head blight resistance breeding. Representative varieties such as Ningmai, Yangmai, and Zhenmai have high resistance to Fusarium head blight. Discovering Fusarium head blight resistance loci through correlation analysis is of great significance for carrying out Fusarium head blight resistance breeding. Summary of the Invention

[0006] To address the aforementioned issues, this application provides a KASP primer set and detection method for detecting wheat scab resistance, enabling rapid detection of wheat scab resistance in the middle and lower reaches of the Yangtze River wheat-growing region.

[0007] The above-mentioned objective is achieved through the following solution:

[0008] First, this application provides a KASP primer set for detecting wheat scab resistance, consisting of primer F1 with nucleotide sequence as shown in SEQ IN NO.1, primer F2 with nucleotide sequence as shown in SEQ IN NO.2, and universal primer R with nucleotide sequence as shown in SEQ IN NO.3.

[0009] Secondly, this application provides the application of the aforementioned KASP primer set in the detection of wheat scab resistance. Specifically, wheat samples are amplified by PCR using the aforementioned KASP primer set, and the amplification products are then subjected to fluorescence detection. Blue fluorescence represents the dominant allelic genotype T, and red fluorescence represents the non-dominant allelic genotype C. Therefore, wheat carrying the T genotype exhibits superior resistance to scab compared to wheat carrying the C alleloid. The wheat samples are preferably from wheat varieties grown in the middle and lower reaches of the Yangtze River, such as Ningmai 13, Ningmai 14, Yangmai 9, Yangmai 23, Yangmai 20, and Zhenmai 13.

[0010] Third, this application provides a wheat scab resistance detection kit. The kit comprises: 2.5 μL of 2×KASPMaster Mix and 0.07 μL of KASP Assay Mix;

[0011] Each 100 μL KASP Assay Mix contains: primer F112 μL (100 μM) with the nucleotide sequence shown in SEQ IN NO.1, primer F212 μL (100 μM) with the nucleotide sequence shown in SEQ IN NO.2, primer R30 μL (100 μM) with the nucleotide sequence shown in SEQ IN NO.3, and made up to 100 μL with ultrapure water.

[0012] Fourth, this application provides a method for detecting wheat scab resistance, the specific steps of which are as follows:

[0013] 1) Extract DNA from wheat samples;

[0014] 2) Using wheat sample DNA as a template, PCR amplification was performed to obtain the amplification product;

[0015] PCR amplification system: 2.5 μL of 2×KASP Master Mix, 0.07 μL of KASP Assay Mix, with a concentration of 20 ng / μL. –1 2.43 μL of template DNA; wherein, KASP Assay Mix is ​​prepared as follows: each 100 μL of KASPAssay Mix includes 12 μL (100 μM) of primer F1 with the nucleotide sequence shown in SEQ IN NO.1, 12 μL (100 μM) of primer F2 with the nucleotide sequence shown in SEQ IN NO.2, 30 μL (100 μM) of primer R with the nucleotide sequence shown in SEQ IN NO.3, and made up to 100 μL with ultrapure water.

[0016] PCR reaction procedure: Step 1: 94℃, 15min; Step 2: 94℃, 20s, 61~55℃, 1min, decrease by 0.6℃ for each cycle, for a total of 10 cycles; Step 3: 94℃, 20s, 55℃, 1min, for a total of 26 cycles.

[0017] 3) Perform fluorescence analysis on the amplification products. Blue fluorescence represents the dominant allelic variant genotype T, and red fluorescence represents the non-dominant allelic variant genotype C. It can be determined that wheat carrying the T genotype has better resistance to Fusarium head blight than wheat carrying the C allele.

[0018] In this application, the term "wheat region in the middle and lower reaches of the Yangtze River" is a conventional wheat zoning in this field, as disclosed in the literature "Cheng Shunhe. Wheat in Southern China. Nanjing: Jiangsu Science and Technology Press, 2012, pp23-26".

[0019] This application marks the first detection of a Fusarium head blight resistance control locus on chromosome 3A, located within the physical region of 602.6-607.5 Mb, which the applicant has named Kfhb-3A. This locus contains a T / C allele, with the dominant allelic variant being T. This application further developed a KASP primer set for this locus for genotyping, showing that wheat carrying the T genotype exhibits superior Fusarium head blight resistance compared to wheat carrying the C allele. Laboratory testing using this KASP primer set reduces the need for field experiments and improves breeding selection efficiency. Attached Figure Description

[0020] Figure 1 The images show the control sites for Fusarium head blight resistance obtained in Example 1; where A and B are the test results from the Liuhe base and the Jiangsu Academy of Agricultural Sciences' internal experimental base, respectively.

[0021] Figure 2 The results of different KASP primer typing detection are shown in the example; where A and B are the amplification results of markers AX-110400652 and AX-110910847, respectively. Detailed Implementation

[0022] Example 1

[0023] 1. Materials and Methods

[0024] Table 2 of this embodiment uses 103 wheat varieties approved in the Yangtze River mid-lower reaches wheat region from 1972 to 2016 as materials (the wheat varieties are disclosed in the literature "Jiang, P., P. Zhang, L. Wu, Y. He, C. Li, H. Ma, et al. 2021. Linkage and association mapping and Kompetitive allele-specific PCR marker development for improving grain protein content in wheat. Theoretical and Applied Genetics 134:3563-3575", all of which are conventional wheat varieties in the field). During the 2017-2018 growing season, the materials were planted in two environments: the experimental base of Jiangsu Academy of Agricultural Sciences and the Liuhe base. They were planted in single-row plots with 60 seeds per row, a row length of 1.6m, a row spacing of 0.25m, and two replicates, with conventional cultivation and management.

[0025] Fusarium head blight resistance was assessed using a single-flower drip method: at the initial flowering stage, 10 panicles were inoculated from each line, with 10 μL of Fusarium head blight spore solution inoculated per panicle, resulting in a spore concentration of 1 × 10⁻⁶. 6 mL -1 After bagging and moisturizing for 72 hours, the plants continued to grow under misting conditions. The number of diseased spikelets and the total number of spikelets were investigated 21 days after inoculation. The diseased spikelet rate was calculated as an indicator of Fusarium head blight resistance using the following formula: Diseased spikelet rate = Number of diseased spikelets / Total number of spikelets × 100%. Simultaneously, the Fusarium head blight resistance of 185 high-generation wheat varieties (Table 4) planted at the institute's experimental base during the 2022–2023 growing season was investigated for subsequent validation. These materials were all wheat varieties from the middle and lower reaches of the Yangtze River, including Ningmai series (e.g., Ningmai 13, Ningmai 14), Yangmai series (Yangmai 9, Yangmai 23, Yangmai 20), and Zhenmai series (e.g., Zhenmai 13). Preliminary statistical processing of the phenotypic data was performed using EXCEL 2016, and t-tests were conducted using IBM SPSS 19.0.

[0026] Genomic DNA was extracted using the CTAB method (Porebski S, Bailey L, Baum B (1997) Modification of CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Molecular Biology Reporter 15:8-15). Genotypes were obtained using an Affymetrix 50K gene chip (Beijing Bio-Tech Co., Ltd., Beijing). Quality control of the genotype data was performed using TASSEL V5.2.13 software, deleting marker sites with a minimum gene frequency ≤5% and a deletion rate exceeding 10%.

[0027] Association analysis was conducted using the GAPIT software package in R (Lipka A, Tian F, Wang Q, Peiffer J, Li M, Bradbury P, Gore M, Buckler E, Zhang Z (2012) GAPIT: Genome Association and Prediction Integrated Tool. Bioinformatics 28:2397-2399). The BLINK (Bayesian-information and linkage-disequilibrium iteratively nested keyway) method was selected (Huang M, Liu X, Yao Z, Summers R, Zhang Z (2018) BLINK: A package for the next level of genome-wide association studies with both individuals and markers in the millions. GigaScience 8). Principal components were used as covariates to reduce the false positive rate, and the screening threshold was set to 1×10⁻⁶. -3 (See the document "Valluru, R., MP Reynolds, WJ Davies and S. Sukumaran. 2017. Phenotypic and genome-wide association analysis of spike ethylene in diverse wheatgenotypes under heat stress. New Phytologist 214:271-283").

[0028] KASP molecular markers were developed by designing PCR amplification primers based on SNP sites and flanking sequences. For each marker, two SNP-specific primers (F1 / F2) and one universal primer (R) were designed. The F1 primer was tailed with a specific sequence GAAGGTGACCAAGTTCATGCT (SEQ IN NO. 7) that binds to FAM fluorescence, and the F2 primer was tailed with a specific sequence GAAGGTCGGAGTCAACGGATT (SEQ IN NO. 8) that binds to HEX fluorescence. KASP primers were designed using Polymarker (http: / / www.polymarker.info / ) and synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0029] The total KASP reaction volume was 5 μL, containing 2.5 μL of 2×KASP Master Mix, 0.07 μL of KASP Assay Mix (primer mixing working solution), and a concentration of 20 ng / μL. –1 2.43 μL of template DNA.

[0030] Each 100 μL KASP Assay Mix contains: 12 μL (100 μM) each of SNP-specific primers (F1 / F2), 30 μL of universal primer (R) (100 μM), and 46 μL of ultrapure water.

[0031] The KASP reaction procedure was as follows: Step 1: 94℃, 15 min; Step 2: 94℃, 20 s, 61–55℃, 1 min, decreasing the temperature by 0.6℃ per cycle, for a total of 10 cycles; Step 3: 94℃, 20 s, 55℃, 1 min, for a total of 26 cycles. PCR was performed using a Hydrocycler PCR machine purchased from LGC. 16 The PCR was performed in a water bath PCR instrument. The PCR results were analyzed using a KASP fluorescence analyzer (LGC Pherastar plus model).

[0032] 2. Results and Analysis

[0033] 2.1 Association analysis detected a Fusarium head blight resistance control site on chromosome 3A, located within the physical region of 602.6-607.5 Mb. Figure 1 The applicant named it Kfhb-3A.

[0034] 2.2KASP tag development

[0035] To better utilize the Kfhb-3A site for breeding, this embodiment developed a KASP marker suitable for high-throughput genotyping based on its region marker sequence.

[0036] First, two SNP markers with low homology were selected from its marker region for primer design (Table 1). After amplification verification, AX-110910847 failed to be successfully genotyped, while AX-110400652 showed good amplification results. Figure 2 (where blue represents the dominant allelic variant T, red represents the non-dominant allelic variant C, and black is the blank control). Figure 2 The typing results were completely consistent with the genotype chip results (Table 2), proving that the KASP primer AX-110400652 can be applied to the breeding selection of Kfhb-3A.

[0037] Table 1

[0038]

[0039] Table 2

[0040]

[0041]

[0042] 2.3 The AX-110400652 primer set was used for wheat scab resistance detection.

[0043] Further genotyping of 185 high-generation wheat lines was performed using the successfully developed KASP marker, and statistical analysis was conducted in conjunction with phenotypic data (Table 3). It was found that the marker plays a significant role in the selection of Fusarium head blight resistance. The disease spikelet rate of materials carrying the T dominant allele was significantly lower than that of materials carrying the C non-dominant allele. Therefore, it is believed that wheat carrying the T genotype has better Fusarium head blight resistance than wheat carrying the C allele.

[0044] The specific genotype and phenotypic values ​​of the tested materials are shown in Table 4.

[0045] Table 3

[0046]

[0047] Note: The numbers in parentheses represent the quantity of material carrying the corresponding allelic variation.

[0048] Table 4

[0049]

[0050]

[0051]

[0052]

[0053]

[0054] The above examples demonstrate that the KASP primer set AX-110400652 can be used for marker-assisted selection in Fusarium head blight resistance breeding, predicting wheat Fusarium head blight resistance and improving breeding selection efficiency.

Claims

1. Application of KASP primer set in wheat scab resistance detection, characterized in that, The application refers to using the KASP primer set to perform PCR amplification on wheat samples, and then detecting the fluorescence of the amplification products. If blue fluorescence appears, it indicates that the wheat sample carries the T allele; if red fluorescence appears, it indicates that the wheat sample carries the C allele. Wheat carrying the T gene has better resistance to Fusarium head blight than wheat carrying the C gene. The KASP primer set consists of primers F1, F2, and R, whose nucleotide sequences are shown in SEQ ID NO.1-SEQ ID NO.3 in sequence.

2. A method for detecting wheat scab resistance, characterized in that, The specific steps are as follows: 1) Extract DNA from wheat samples; 2) Using wheat sample DNA as a template and KASP primer set as primers, PCR amplification was performed to obtain the amplification product; The KASP primer set consists of primers F1, F2, and R, whose nucleotide sequences are shown sequentially as SEQ ID NO.1-SEQ ID NO.3; 3) Perform fluorescence analysis on the amplification products: If blue fluorescence appears, it indicates that the wheat sample carries the T allele; If red fluorescence appears, it indicates that the wheat sample carries the C allele; wheat carrying the T gene has better resistance to Fusarium head blight than wheat carrying the C gene.

3. The method for detecting wheat scab resistance according to claim 2, characterized in that, The PCR amplification refers to: PCR amplification system: 2.5 μL of 2×KASP Master Mix, 0.07 μL of KASP Assay Mix, and a concentration of 20 ng / μL. ‒1 The template DNA was 2.43 μL; wherein each 100 μL KASP Assay Mix contained: 12 μL of primer F1 (100 μM), 12 μL of primer F2 (100 μM), 30 μL of primer R (100 μM), and 46 μL of ultrapure water; the nucleotide sequence of primer F1 is shown in SEQ ID NO.1, the nucleotide sequence of primer F2 is shown in SEQ ID NO.2, and the nucleotide sequence of primer R is shown in SEQ ID NO.3; PCR amplification program: Step 1: 94℃, 15 min; Step 2: 94℃, 20 s, 61~55℃, 1 min, decreasing by 0.6℃ for each cycle, for a total of 10 cycles; Step 3: 94℃, 20 s, 55℃, 1 min, for a total of 26 cycles.