Ntssp2 polypeptide for promoting tobacco growth and application thereof

Abstract

The application discloses an NtSSP2 polypeptide for promoting tobacco growth and application thereof, wherein the sequence of the polypeptide is shown as SEQ ID NO. 3, and the sequence also includes a sequence with similar function with similarity not lower than 95 %. After the polypeptide is used for treating tobacco seeds and seedlings, the polypeptide can promote seed germination, promote seedling growth, and improve dry and fresh weight, leaf area, chlorophyll content and antioxidant enzyme activity of the seedlings.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of tobacco seed germination, in particular to a NtSSP2 polypeptide for promoting tobacco growth and application thereof. BACKGROUND

[0002] Polypeptides are a kind of trace small molecules with important regulatory functions composed of amino acids synthesized by plants themselves in plant bodies. They are also called polypeptide hormones due to their trace and efficient characteristics. In plant bodies, polypeptides are functional polypeptides composed of only a few amino acids generated by cleavage and modification of protein precursors after translation.

[0003] Polypeptides are also a kind of degradable and pollution-free regulatory substances, which are expected to become new green growth regulators or synergists. At present, more research reports on promoting growth are that beneficial microorganisms can promote crop growth, and the mechanism of action includes that beneficial microorganisms can secrete polypeptides, which are absorbed by plants to promote plant growth or improve disease resistance. However, there is no report on plant endogenous polypeptides promoting growth. In addition, in the aspect of polypeptide regulation of seed germination, for example, the polypeptide CYS3 disclosed in CN202211007486.2 can promote the germination of immature tobacco seeds.

[0004] The information disclosed in the background section is only intended to increase the understanding of the general background of the application and should not be considered as recognition or implied in any form that this information constitutes prior art known to those of ordinary skill in the art. SUMMARY

[0005] The present application provides a NtSSP2 polypeptide for promoting tobacco growth and application thereof, which can effectively improve the germination rate of seeds in the early stage of germination and reduce the germination time by soaking tobacco seeds with the polypeptide and cultivating seedlings. At the same time, it can improve the fresh weight, leaf area, chlorophyll content, dry weight and antioxidant enzyme activity of seedlings after germination.

[0006] The present application provides a NtSSP2 polypeptide for promoting tobacco growth and application thereof, the gene coding sequence of which is shown as SEQ ID NO. 1, and the gene sequence also includes a gene sequence with similar function with a similarity not less than 95%.

[0007] Preferably, the protein sequence obtained by the gene coding is shown as SEQ ID NO. 2, and the protein sequence also includes a protein sequence with similar function with a similarity not less than 95%.

[0008] Preferably, the protein sequence is obtained after biological cleavage to obtain a polypeptide, and the polypeptide sequence is shown in SEQ ID NO. 3, and the polypeptide sequence also includes a polypeptide sequence with a similarity of not less than 95% and similar functions. The polypeptide can be secreted after biological cleavage, or obtained by artificial enzyme cleavage or artificial chemical synthesis or prokaryotic expression.

[0009] Preferably, the tobacco seed germination seedling growth index includes germination rate, seedling fresh weight, leaf area, chlorophyll content, seedling dry weight, and antioxidant enzyme activity.

[0010] Another aspect of the present application also provides a recombinant vector containing the NtSSP2 polypeptide for promoting tobacco growth and the synthetic gene thereof.

[0011] The recombinant vector used specifically can be various types of vectors commonly used in the art, and the gene sequence is transferred to the corresponding organism for transcription to obtain the protein or polypeptide of the above sequence by using the method commonly used in the art. For example, Agrobacterium is used as an expression vector.

[0012] Another aspect of the present application also provides a complex preparation containing the protein or polypeptide of the NtSSP2 polypeptide for promoting tobacco growth and the protein or polypeptide encoded by the synthetic gene thereof.

[0013] The complex preparation can be a fertilizer, pesticide, growth promoter, etc. containing the protein or polypeptide. The fertilizer, pesticide, and growth promoter are prepared by the method commonly used in the art, and the corresponding adjuvant and process are selected according to the common knowledge in the art to produce.

[0014] Another aspect of the present application also provides a method for promoting tobacco seed germination, including the following steps: soaking or infiltrating tobacco seeds; and the solution used for soaking contains the protein or polypeptide encoded by the gene.

[0015] Preferably, the concentration of the polypeptide solution is 0.05-1 μmol / L. Specifically, it can be 0.05 μmol / L, 0.1 μmol / L, 0.5 μmol / L, or 1 μmol / L. More preferably, the concentration of the polypeptide solution is 1 μmol / L.

[0016] Preferably, the tobacco seeds are soaked or infiltrated at 4°C for 24 hours.

[0017] Another aspect of the present application also provides a method for promoting tobacco seedling growth, including the following steps: culturing the seedlings with a solution containing the protein or polypeptide encoded by the gene.

[0018] Preferably, the concentration of the polypeptide solution is 0.05-1 μmol / L. Specifically, it can be 0.05 μmol / L, 0.1 μmol / L, 0.5 μmol / L or 1 μmol / L. More preferably, the concentration of the polypeptide solution is 0.5 μmol / L.

[0019] The polypeptide sequence as shown in SEQ ID NO. 3 is obtained by E. coli expression and purification, specifically including the following steps:

[0020] 1. Vector construction: copy the polypeptide sequence to the target vector for E. coli expression, and the vector name is pET-30a(+)(NdeI--ATG—polypeptide sequence--His tag--Stop codon--HindIII).

[0021] 2. Transformation:

[0022] Take the BL21(DE3) competent cells from the ultra-low temperature freezer and place them on ice to thaw. Add the plasmid (100 ng) and mix gently. Place on ice for 30 min. Heat shock in a water bath at 42°C for 90 s. Place on ice for 3 min. Add 100 μl of room temperature LB liquid medium. Incubate in a shaker at 37°C and 200 rpm for 60 min. Mix the bacterial solution and then spread it on a kanamycin-resistant plate. Invert the plate and incubate at 37°C overnight.

[0023] 3. Expression: pick 3 single colonies respectively and inoculate into LB test tubes containing 50 μg / ml kanamycin. Incubate in a shaker at 37°C and 200 rpm. When the OD600 reaches 0.6-0.8, add 0.5 mM IPTG to two test tubes respectively, and incubate at 15°C for 16 hours. The last test tube is a negative control.

[0024] 4. Add denaturant solution to inclusion bodies, and use nickel column for purification under denatured state. Then remove urea by dialysis (renaturation), and finally use SDS-PAGE and Western blot to detect the expression amount of the protein.

[0025] The beneficial effects that can be produced by the present application include:

[0026] 1) The NtSSP2 polypeptide for promoting tobacco growth and application thereof provided in the present application, after the polypeptide is used for treating tobacco seeds, the fresh weight, leaf area, chlorophyll content, and dry weight of the seedlings after germination are improved. The fresh weight of the seedlings on the 10th day is increased by 20% compared with the control, and the fresh weight on the 20th day is increased by 114% compared with the control; the leaf area on the 20th day after treatment is increased by 53% compared with the control; the contents of chlorophyll a, chlorophyll b, and chlorophyll a+b on the 10th day after sowing are all significantly higher than those of the control; and the dry weight of the seedlings on the 30th day after sowing is increased by 56% compared with the control. After the tobacco seeds treated by the polypeptide germinate, the growth indexes of the seedlings are all significantly improved, indicating that the polypeptide can effectively improve the growth of tobacco seedlings.

[0027] 2) The NtSSP2 polypeptide for promoting tobacco growth and application thereof provided in the present application, after the polypeptide is used for soaking or infiltrating tobacco seeds, the early germination rate of the seeds is also improved, and the germination rate is increased by 22% compared with the control. This is beneficial to shortening the germination time of tobacco seeds and promoting seed germination. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 FIG. 1 is a columnar graph of the fresh weight of seedlings obtained in the experimental treatment in Example 2 of the present application, wherein a) is the fresh weight on the 10th day after treatment, and b) is the fresh weight on the 20th day after treatment;

[0029] Figure 2 FIG. 2 is a graph of seedlings obtained in the experimental treatment and the control treatment in Example 2 of the present application, wherein a) is the control on the 20th day, and b) is the 20th day after 0.5 μmol / L treatment;

[0030] Figure 3 FIG. 3 is a columnar graph of the leaf area of seedlings obtained in Example 3 of the present application, wherein a) is the leaf area on the 10th day after treatment, and b) is the leaf area on the 20th day after treatment;

[0031] Figure 4 FIG. 4 is a columnar graph of the chlorophyll content of seedlings obtained in Example 4 of the present application, wherein a) is the chlorophyll content on the 10th day after treatment, and b) is the chlorophyll content on the 20th day after treatment;

[0032] Figure 5 FIG. 5 is a columnar graph of the antioxidant enzyme activity of seedlings obtained in Example 5 of the present application;

[0033] Figure 6 FIG. 6 is a graph of the dry weight of seedlings obtained in Example 6 of the present application, wherein a) is the fresh weight of seedlings after floating cultivation for 30 d, b) is the dry weight of seedlings after floating cultivation for 30 d, c) is a photograph of the control group, and d) is a photograph of the treatment group;

[0034] Figure 7 FIG. 7 is a result of polypeptide treatment for promoting seed germination in Example 7 of the present application, wherein a) is a photograph of the control group, b) is a photograph of the treatment group, and c) is a columnar comparison graph of the germination rate;

[0035] Figure 8 Figure 8 is a schematic diagram of the detection results of NtSSP2 polypeptide in Example 1 of the present application; wherein a) is the result of SDS-PAGE; b) is the result of western blot. DETAILED DESCRIPTION

[0036] The present application will be further described in conjunction with the accompanying drawings and examples, but in no way limited by the present application, any transformation or improvement based on the teaching of the present application, all fall within the scope of the present application.

[0037] EXAMPLE

[0038] The materials and instruments used in the following examples are obtained from commercial channels unless otherwise specified; the detection methods used are all existing methods unless otherwise specified.

[0039] Example 1 Synthesis of NtSSP2 polypeptide

[0040] Coding sequence of NtSSP2 gene (SEQ ID NO. 1)

[0041] ATGGCGAAGATTTCAGTTGCTGCTGCTCTTCTCTTGTGCTTGTTAGCCGTTGCAAGTGCCAACACCTTCACCGTCACCACCACCGTGACGGAGGACGATATCGACAATCAAGGGTCACAGAGGTGCCAAGAGCAGATCCAGAGACAGAGGCTCAACCACTGCAGGATGTACCTTTCAAGAAGCCGCCAATATTATGGCGACGAGCTGAGCATGGTGACAGATGATGAGGAGAGCAACCAAGGACAGCAGCATCTCCAACAATGTTGCCAGGAATTGAGGAACATGGACACTCTATGCCGCTGCGAGGCACTTAGGAGAATGGTGACACAGCAGCGTGGTGGCCGCGGCCAAGAGGCAGAGCGCATGTCAGAGAGAGCTCGTTATCTCCCCCGTATGTGCAATATCCAGCCTACCCAGTGCCGCTTCTAA

[0042] NtSSP2 protein sequence (SEQ ID NO. 2) encoded by the above-mentioned gene

[0043] MAKISVAAALLLCLLAVASANTFTVTTTVTEDDIDNQGSQRCQEQIQRQRLNHCRMYLSRSRQYYGDELSMVTDDEESNQGQQHLQQCCQELRNMDTLCRCEALRRMVTQQRGGRGQEAERMSERARYLPRMCNIQPTQCRF

[0044] The polypeptide sequence after the above protein cleavage

[0045] MAKISVAAALLLCLLAVASANTFTVTTTVTEDDIDNQGSQRCQEQIQRQRLNHCRMYLSRSRQYYGDELSMVTDDEESNQGQQHLQQCCQELRNMDTLCRCEALRRMVTQQRGGRGQEAERMSERARYLPRMCNIQPTQCRF

[0046] The NtSSP2 polypeptide is obtained by expression and purification in E. coli, and the process comprises the following steps:

[0047] 1. Vector construction: copy the polypeptide sequence to the target vector for E. coli expression, and the vector name is pET-30a(+)(NdeI--ATG—polypeptide sequence--His tag--Stop codon--HindIII).

[0048] 2. Transformation: take the BL21(DE3) competent cells from the ultra-low temperature freezer and place them on ice to thaw. Add the plasmid (100 ng) and mix gently. Place on ice for 30 min. Heat shock in a water bath at 42°C for 90 s. Place on ice for 3 min. Add 100 μl of room temperature LB liquid medium. Incubate in a shaker at 37°C, 200 rpm for 60 min. Mix the bacterial solution and spread on a kanamycin-resistant plate. Invert the plate and incubate at 37°C overnight.

[0049] 3. Expression: pick 3 single colonies respectively and inoculate into LB test tubes containing 50 μg / ml kanamycin. Incubate in a shaker at 37°C, 200 rpm. When the OD600 reaches 0.6-0.8, add 0.5 mM IPTG to two test tubes respectively, and incubate at 15°C for 16 hours. The last test tube is the negative control.

[0050] 4. Purification: add denaturant solution to include the inclusion body, and use nickel column for purification under denatured state. Then remove urea by dialysis (renaturation), and finally use SDS-PAGE (as shown in Figure 8 a) and Western blot

[0051] Figure 8 ​b) detecting the amount of protein expressed.

[0052] Example 2 NtSSP2 polypeptide treatment increases seedling fresh weight

[0053] Materials and Methods:

[0054] A piece of filter paper was placed in a Petri dish and soaked with different concentrations of polypeptide solution. The polypeptide concentration was set at 0.05, 0.1, 0.5, and 1 μmol / L. As time went on, the solution in the Petri dish would evaporate and decrease, and the polypeptide solution was continuously replenished to keep the filter paper moist. A total of 100 ml of polypeptide solution was used, and then tap water was continuously replenished. The control was tap water. Each repeat was sowed with 150 seeds, and there were three repeats. The fresh weight of seedlings was measured on the 10th day and the 20th day after sowing.

[0055] Results and Analysis:

[0056] Overall, the fresh weight on the 10th day and the 20th day showed an increasing trend with increasing concentration. The fresh weight on the 10th day and the 20th day under 0.5 μmol / L and 1 μmol / L polypeptide solution was significantly different from the control (p=0.05), and the fresh weight on the 10th day and the 20th day under 0.05 μmol / L and 0.1 μmol / L polypeptide solution was not significantly different from the control (p=0.05). The fresh weight on the 10th day under 0.5 μmol / L treatment was 20% higher than the control. The fresh weight on the 20th day under 0.5 μmol / L treatment was 55% higher than the control, and the fresh weight on the 20th day under 1 μmol / L treatment was 114% higher than the control.

[0057] Example 3 NtSSP2 polypeptide treatment increases leaf area

[0058] Materials and Methods:

[0059] A piece of filter paper was placed in a Petri dish and soaked with different concentrations of polypeptide solution. The polypeptide concentration was set at 0.05, 0.1, 0.5, and 1 μmol / L. As time went on, the solution in the Petri dish would evaporate and decrease, and the polypeptide solution was continuously replenished to keep the filter paper moist. A total of 100 ml of polypeptide solution was used, and then tap water was continuously replenished. The control was tap water. Each repeat was sowed with 150 seeds, and there were three repeats. The fresh weight of seedlings was measured on the 10th day and the 20th day after sowing.

[0060] Results and Analysis:

[0061] Compared with the control, different concentrations of polypeptide solution treatment can significantly improve the leaf area of seedlings (p=0.05). Among them, the change rule is basically the same as the fresh weight of seedlings. The leaf area of 0.5 μmol / L treatment on the 10th day is increased by 36% compared with the control. The leaf area of 0.5 μmol / L treatment on the 20th day is increased by 53% compared with the control, and the leaf area of 1 μmol / L treatment on the 20th day is increased by 54% compared with the control,

[0062] Example 4 NtSSP2 polypeptide treatment increases chlorophyll content

[0063] Materials and methods:

[0064] In the culture dish, add 0.1 μmol / L polypeptide solution to the wet filter paper, and sow the tobacco seeds on the wet filter paper. With the extension of time, the solution in the culture dish will volatilize and decrease, and the polypeptide solution is continuously supplemented during the period to keep the filter paper wet. A total of 50 ml of polypeptide solution is used, and then tap water is continuously supplemented. The control is tap water. Three repetitions are made, and the chlorophyll content of seedlings is determined on the 10th day and the 20th day after sowing. The chlorophyll content determination method refers to “Principle and Technology of Plant Physiology and Biochemistry (3rd Edition) ” edited by Wang Xuekui and Huang Jianliang, published by Higher Education Press. The type of extraction solution is 80% acetone.

[0065] Results and analysis:

[0066] On the 10th day after sowing, the chlorophyll a, chlorophyll b, and chlorophyll a+b contents of the polypeptide treatment were significantly higher than those of the control. On the 20th day after sowing, the chlorophyll a and chlorophyll a+b contents of the polypeptide treatment were significantly higher than those of the control, and there was no significant difference in chlorophyll b content between the polypeptide treatment and the control (p=0.05).

[0067] Example 5 NtSSP2 polypeptide treatment affects antioxidant enzyme activity

[0068] Materials and methods:

[0069] In the culture dish, add 0.1 μmol / L polypeptide solution to the wet filter paper, and sow the tobacco seeds on the wet filter paper. With the extension of time, the solution in the culture dish will volatilize and decrease, and the polypeptide solution is continuously supplemented during the period to keep the filter paper wet. A total of 50 ml of polypeptide solution is used, and then tap water is continuously supplemented. The control is tap water. Three repetitions are made, and the chlorophyll content of seedlings is determined on the 10th day and the 20th day after sowing. The chlorophyll content determination method refers to “Principle and Technology of Plant Physiology and Biochemistry (3rd Edition) ” edited by Wang Xuekui and Huang Jianliang, published by Higher Education Press. The type of extraction solution is 80% acetone.

[0070] Results and analysis:

[0071] The CAT content of the polypeptide treatment after 10 days is significantly lower than that of the control, the SOD content is significantly lower than that of the control, and the POD content is significantly higher than that of the control (p=0.05).

[0072] Example 6 NtSSP2 polypeptide treatment increases seedling dry weight in substrate-raised seedlings

[0073] Materials and methods:

[0074] In floating seedling culture, tobacco seeds were sown in the substrate, and the treatment group was cultured with 0.1 μmol / L polypeptide solution, and the control group was cultured with tap water. The seedling dry weight was measured on the 30th day after sowing. Three replicates were determined, and 10 seedlings were determined for each replicate.

[0075] Results and analysis:

[0076] The fresh weight of the seedlings in the treatment group was significantly higher than that of the control group, which increased by 56% compared with the control group. The dry weight of the seedlings in the treatment group was also significantly higher than that of the control group, which increased by 49% compared with the control group (p=0.05). It is shown that the polypeptide can promote the growth of seedlings.

[0077] Example 7 NtSSP2 polypeptide treatment promotes seed germination

[0078] Materials and methods:

[0079] The polypeptide was prepared into a concentration of 1 μmol / L using ultrapure water, and a sufficient number of tobacco seeds were counted. The tobacco seeds were soaked in polypeptide solution (experimental group) and ultrapure water (control group, MOCK) at 4°C for 24 hours. After soaking, the seeds were placed on wet filter paper for germination experiment. Three replicates were set up, and 50 seeds were set up for each replicate. The number of tobacco seeds germinated on the 3rd day was counted. The standard for germination was that the radicle length was greater than the seed length.

[0080] Results and analysis:

[0081] The germination rate was counted on the 3rd day of seed germination. The germination rate of the treatment group was significantly higher than that of the control group (p=0.05), which increased by 22% compared with the control group. It is shown that the polypeptide can promote seed germination, increase germination speed, and reduce germination time.

[0082] Example 8

[0083] The difference between Example 8 and Example 7 is that the concentration of the polypeptide solution used is 0.05 μmol / L.

[0084] The results obtained in Example 8 are similar to those in Example 7, which are not repeated here.

[0085] Although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments, or make equivalent replacements to part of the technical features, as long as they are within the spirit and principles of the present application. Any modification, equivalent replacement, improvement, etc. made shall be included in the protection scope of the present application.

Claims

1. A method of promoting the growth of tobacco seedlings, characterized by, The method comprises the following steps: Culturing seedlings with a solution containing a protein or polypeptide encoded by a gene; The gene is an NtSSP2 polypeptide for promoting tobacco growth, and the gene coding sequence of the polypeptide is shown as SEQ ID NO. 1; The protein sequence encoded by the gene is shown as SEQ ID NO. 2; The polypeptide is obtained after biological cleavage of the protein sequence, and the polypeptide sequence is shown as SEQ ID NO.

3.

2. The method of claim 1, wherein, The concentration of the polypeptide solution is 0.05-1 μmol / L.

3. The method of claim 2, wherein, The concentration of the polypeptide solution is 0.5 μmol / L.

Images