A strain of Cladosporium marineum with efficacy in controlling tobacco mosaic virus

Abstract

The present invention provides a marine fungus strain with the effect of preventing and treating tobacco mosaic virus, which is a Cladosporium sp. MFS2330 strain, and its deposit number is CGMCC NO.40805. The MFS2330 strain screened by the present invention is used to prevent and treat tobacco mosaic virus, and can also be used to prepare products with the function of preventing and treating tobacco mosaic virus. The present invention obtains the MFS2330 strain with biological activity against tobacco mosaic virus, which can be applied to the prevention and treatment of tobacco mosaic virus disease. The inhibition rate of its fermentation supernatant to TMV measured by the local dead spot method is 97%; the inhibition rate of the fermentation crude extract to TMV is 72.99%; at the same time, the crude extract of the fermentation liquid of the MFS2330 strain also shows certain biological activity against tobacco aphids, and has practical application value in production.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial screening and application, and particularly relates to a marine Cladosporium strain having the efficacy of preventing and treating tobacco mosaic virus. Background Art

[0002] As people pay more and more attention to their own health and living environment, the rampant use of chemical pesticides has led to an increase in pesticide residues in the environment, and the increase in pest resistance and the resurgence of pests and diseases are the most prominent problems. As countries around the world further understand the various social, environmental, and human health problems caused by chemical pesticides, more and more chemical pesticides are restricted or banned. As a new type of pesticide with low toxicity, low residue, and pests and diseases that are not easy to develop resistance, biological pesticides have naturally become a hot spot for the modern pesticide industry to pay attention to and try to develop, and their research and development and industrialization have also become a strategic need for the country.

[0003] Microbial pesticides are an important type of biological pesticides, including agricultural antibiotics and live microbial pesticides. Microbial pesticides are separated and purified from natural products. They can be used directly for pest control, or as lead compounds to synthesize new pesticides. These pesticides can retain the advantages of low toxicity and low residue of the original bioactive substances, while overcoming the shortcomings of some natural products such as poor stability and low activity, so that the potential of bioactive substances can be fully tapped.

[0004] Fungi are an important resource for the development of microbial pesticides, and countries around the world have invested a lot of scientific research efforts in their research. At present, more than 70 kinds of biological pesticides with terrestrial fungi or their metabolites as active ingredients have been registered. These microbial pesticides are widely used to prevent and control plant diseases, insect pests and field weeds. my country has also made outstanding achievements in application and basic research. Although the current output of biological pesticides in my country only accounts for 9% of the total output of pesticides, from the perspective of human long-term interests and the development trend of pesticides, the development potential of biological pesticides is very huge. The living environment of marine fungi is relatively harsh (high salt, high pressure, hypoxia, low nutrition, no light, etc.). In order to obtain living space, they have produced some unique secondary metabolites in the long-term evolution process, especially marine animal and plant symbiotic fungi. In order to strive for their own maximum survival, they actively participate in the metabolic activities of animals and plants by secreting metabolites with various biological activities, and play an important role in the ecological defense of animals and plants against infection and phagocytosis. Regarding the functions and uses of marine fungal secondary metabolites, researchers have focused more on the development of medical drugs for the treatment of human diseases, while there has been less research on the agricultural antiviral functions of marine fungal metabolites.

[0005] Tobacco mosaic virus disease is a plant virus disease caused by tobacco mosaic virus (TMV). It generally occurs in tobacco areas around the world, causing serious losses and being one of the most serious diseases that harm tobacco. TMV is mainly spread through juice friction and can infect more than 350 host plants including Solanaceae crops such as tobacco, tomato, potato, eggplant, pepper, and nightshade. It can occur throughout the entire growth period from the seedbed to the field, and the color of the diseased leaves after baking is uneven, the quality is degraded, and the yield is reduced. At present, there are many studies on the biological control of tobacco mosaic virus in China, but most of them are limited to the screening of biological control strains, and are mainly based on bacterial screening, and the separation and extraction of the antagonistic substances produced by fungi are rarely studied in depth. The present invention will explore from the aspect of biological control, screen the antagonistic marine fungal strains with excellent prevention effect, and separate and extract the antagonistic active substances produced by them, and apply them to the prevention and control of tobacco mosaic virus disease. Summary of the invention

[0006] The purpose of the present invention is to provide a marine fungus strain with the effect of preventing and controlling tobacco mosaic virus, that is, a marine Cladosporium sp. strain from seawater and its application in the prevention and control of tobacco mosaic virus. At the same time, the screened strain that can produce secondary metabolites with biological activity against tobacco mosaic virus is applied to the biological control of tobacco mosaic virus, thereby making up for the shortcomings of the prior art.

[0007] The Cladosporium sp. MFS2330 strain from seawater provided by the present invention was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on August 18, 2023. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.40805.

[0008] The MFS2330 strain screened by the present invention is used for preventing and controlling tobacco common mosaic virus, and can also be used to prepare products for preventing and controlling tobacco common mosaic virus;

[0009] The product is a microbial agent.

[0010] The present invention also provides a metabolite of the MFS2330 strain, and the preparation method thereof is as follows:

[0011] The MFS2330 strain was fermented, and ethyl acetate was added to the fermentation supernatant for extraction. The obtained organic phase was concentrated under reduced pressure on a rotary evaporator, eluted with methanol, and evaporated to dryness at room temperature to obtain a crude metabolic extract of the MFS2330 strain.

[0012] The fermentation is carried out by inoculating the MFS2330 strain into a PDB liquid culture medium and fermenting at 28°C.

[0013] The above metabolites are used to prevent and treat tobacco common mosaic virus disease.

[0014] The invention obtains the MFS2330 strain having biological activity against tobacco mosaic virus, and can be applied to the prevention and treatment of tobacco mosaic virus disease. The inhibition rate of the fermentation supernatant against TMV is 97% determined by the local dead spot method; the inhibition rate of the fermentation crude extract against TMV is 72.99%; at the same time, the crude extract of the fermentation liquid of the MFS2330 strain also exhibits certain biological activity against tobacco aphid, and has practical application value in production. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 : Colony culture morphology of strain MFS2330, where the left picture is a front photo and the right picture is a back photo;

[0016] Figure 2 : The result diagram of the inhibitory effect of the fermentation supernatant of strain MFS2330 on TMV, wherein ck is the control, and the treatment is the treatment with the fermentation supernatant of strain MFS2330;

[0017] Figure 3 : The inhibitory effect of the crude extract of secondary metabolites of strain MFS2330 on TMV, wherein ck is the control, and the treatment is the treatment with the crude extract of secondary metabolites of strain MFS2330;

[0018] Figure 4 : The result of 14-day liquid fermentation of strain MFS2330 PDB,

[0019] Figure 5 : The result of 7-day solid fermentation of strain MFS2330 in rice medium,

[0020] Figure 6 : HPLC spectrum of crude extract of secondary metabolism of strain MFS2330 (the upper figure is liquid fermentation culture, the lower figure is solid fermentation culture). DETAILED DESCRIPTION

[0021] The present invention is further described below in conjunction with the accompanying drawings, but the present invention is not limited in any way. Any changes or improvements made based on the teachings of the present invention belong to the protection scope of the present invention.

[0022] Example 1: Isolation, purification and identification of Cladosporium sp. MFS2330 strain

[0023] The seawater samples collected from Xiaonanshan, Suizhong, Huludao City, Liaoning Province in October 2020 were placed on PDA culture medium (culture medium preparation method: peel the potatoes, cut 200g into small pieces, add 1L of seawater and boil for 30min, filter through 4-6 layers of gauze, add 20g of glucose, dissolve, and replenish the lost water with distilled water. For the solid culture medium, add 1.5-2% agar, 121°C, and autoclave for 20min.) and cultured at 28°C. The MFS2330 strain was isolated and purified from a single spot.

[0024] The 18s rDNA ITS gene sequence analysis identified it as Cladosporium sp. The ITS gene sequence is as follows:

[0025] ATTCCCCTTCCGAGTTTAACTCCCACCCCTGTGACATACCACTTGTTGCCTCGGCG

[0026] GATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTA

[0027] TATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTT

[0028] CTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGA

[0029] ATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGA

[0030] GCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGGCTTTCCTCA

[0031] AATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAA

[0032] TCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAAT

[0033] ACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA (SEQ ID NO: 1).

[0034] Example 2: Culture morphology and physicochemical parameters of Cladosporium sp. MFS2330 strain

[0035] 1. Microscopic morphological characteristics of MFS2330 strain

[0036] Observation under a microscope showed that the hyphae of strain MFS2330 were slender with many branches, the sporangium was spherical and connected to the mycelium, and the conidia were ovoid or spherical with a diameter of 2-8 μm.

[0037] 2. MFS2330 strain culture conditions

[0038] The colony was cultured on PDA medium for 7 days, with a diameter of about 8 cm, white on the front, light pink in some parts, irregular edges, and light yellow on the back ( Figure 1 ). After being cultured on PDA liquid medium, the bacteria are in the shape of a pancake. The optimal growth temperature of the strain is 28℃, the optimal pH value is 10, the optimal culture time is 8 days, and the optimal culture medium is seawater PDA medium.

[0039] Example 3: Inhibitory effect of MFS2330 strain on tobacco mosaic virus TMV

[0040] The inhibitory effect of the obtained strain on tobacco mosaic virus TMV was determined by the local dead spot method. 1g of fresh TMV-infected leaves was weighed and 10mL of sterile phosphate buffer was added to grind into a homogenate. After filtering with sterile gauze, the supernatant was taken as the inoculation liquid: the strain was inoculated in PDB liquid culture medium for large-scale fermentation culture, and the fermentation supernatant was taken as the anti-TMV bacterial liquid for standby use. The bacterial liquid was mixed with the TMV inoculation liquid in equal amounts, and the PDB liquid culture medium was mixed with the TMV inoculation liquid in equal amounts. After standing for 10 minutes at room temperature, they were rubbed and inoculated with Sansheng-NN tobacco. Before inoculation, an appropriate amount of corundum was sprayed on the surface of the leaves. The left half leaf was inoculated with a mixture of the bacterial liquid and the TMV inoculation liquid, and the right half leaf was inoculated with a mixture of the PDB culture medium and the TMV inoculation liquid as a control. Each half leaf was inoculated with 200uL. After inoculation, the leaf surface was rinsed with clean water and repeated 3 times. The results were observed 3 days after inoculation, and the number of dead spots was counted to calculate the inhibition rate. The results showed that the fermentation liquid of the strain had a good inhibitory effect on TMV, and the dead spot inhibition rate reached 97% (Table 1, Figure 2 ), the inhibitory rate of the secondary metabolite extract of the strain on TMV necrosis reached 72.99% (Table 2, Figure 3 ), the biocontrol strains produced resistance substances that inhibited TMV activity during their growth and metabolism.

[0041] Inhibition rate (%) = [1-(average number of necrotic spots in treatment group / average number of necrotic spots in control group)] × 100.

[0042] Table 1: Data table of the inhibitory effect of the fermentation supernatant of MFS2330 strain on TMV

[0043]

[0044]

[0045] Table 2: Data table of the inhibitory effect of crude extracts of secondary metabolism of MFS2330 strain on TMV

[0046]

[0047] Example 4: Detection of fermentation products of marine fungus strain MFS2330

[0048] The tested marine fungus strain MFS2330 was inoculated into liquid PDB medium ( Figure 4 ) and solid rice medium ( Figure 5 ), 28 ° C, and static fermentation culture for about 40 days. After fermentation, the supernatant of the liquid PDB medium was extracted three times with an equal volume of ethyl acetate, and the solid fermentation rice culture was directly extracted three times with an equal volume of ethyl acetate. The obtained organic phases were concentrated under reduced pressure on a rotary evaporator, eluted with methanol, and evaporated to dryness at room temperature to obtain crude secondary metabolites of liquid fermentation and solid fermentation of MFS2330 strain.

[0049] The crude extracts of MFS2330 obtained by the two culture methods were dissolved in an appropriate amount of methanol and analyzed by high performance liquid chromatography (HPLC). The number of chromatographic peaks and ultraviolet absorption curves were compared and analyzed to analyze the variety richness and content of secondary metabolites of strain MFS2330 under the two different culture methods of liquid and solid. Figure 6 ). From the results, the variety richness of secondary metabolites of strain MFS2330 under the two culture methods was quite different.

[0050] Table 3: HPLC standard procedure table

[0051]

[0052]

[0053] Example 5: Bioassay of the secondary metabolic active substances of the marine fungus strain MFS2330 against Myzus persicae

[0054] The marine fungus MFS2330 strain was inoculated into liquid PDB medium and fermented at 28°C for about 40 days. After fermentation, the supernatant of the liquid PDB medium was extracted three times with an equal volume of ethyl acetate, and the obtained organic phases were concentrated under reduced pressure on a rotary evaporator, eluted with methanol, and evaporated to dryness at room temperature to obtain the crude extract of the secondary metabolism of the liquid fermentation of the MFS2330 strain.

[0055] The toxicity of the fungal crude extract to tobacco aphids was tested by the insect-leaf dipping method. Filter paper was placed in a petri dish (9 cm in diameter), and 1 mL of distilled water was added to maintain a suitable humidity. A tobacco leaf of appropriate size was immersed in the solution for 10 seconds, dried, and then placed in the petri dish. The tobacco leaf stalk was moisturized with absorbent cotton and water. The tobacco leaf with aphids was immersed in the diluted crude extract solution for 10 seconds, and 30 aphids (uniform size, healthy, wingless aphids) were picked and placed in the petri dish.

[0056] The crude extract was prepared into a 10000 mg / L stock solution with acetone, and then diluted with clean water to prepare 5000 mg / L, 2500 mg / L, 1250 mg / L, 625 mg / L and 312.5 mg / L solutions, CK (acetone). Three replicates were set up for each, and the mortality of tobacco aphids under each concentration of crude extract was checked and counted within 24 hours. The data were processed with SPSS software to calculate LC50, regression equation and correlation coefficient.

[0057] Table 4: LC50 analysis of crude extracts of secondary metabolites of strain MFS2330 against tobacco aphid

[0058] Regression equation LC50(mg / L) Confidence interval Correlation coefficient y=-11.054+4.314x 472.15 375.93-565.48 0.84

[0059] The results showed that the active ingredients of the crude extract of secondary metabolism of marine fungus strain MFS2330 were highly toxic to Myzus persicae, and the insecticidal rate could reach 100% when the treatment concentration was 5000 mg / L. The LC50 of the fermentation broth extract of strain MFS2330 to Myzus persicae was 472.15 mg / L by SPSS software, and the toxicity regression equation was: y=-11.054+4.314x, R=0.84, and the 95% confidence limit was 375.93-565.48.

Claims

1. A Cladosporium strain, characterized in that The Cladosporium strain ( Cladosporium sp . )’s deposit number is CGMCC NO.40805.

2. Use of the Cladosporium strain according to claim 1 in preventing and controlling tobacco common mosaic virus.

3. Use of the Cladosporium strain according to claim 1 in the preparation of a product for preventing and controlling tobacco common mosaic virus.

4. The use according to claim 3, characterized in that The product is a microbial agent.

Images