A strain of Lonicera japonica and its culture conditions

Abstract

The present invention discloses a strain of Phylloporia lonecerae, which is classified and named as Phylloporia lonecerae, and has been deposited in the China General Microbiological Culture Collection Center on November 22, 2023, with a deposit number of CGMCC No. 40990. At the same time, the present application discloses a culture method for increasing the mycelium yield of Phylloporia lonecerae, adding an elicitor to the culture medium, providing excellent culture conditions for Phylloporia lonecerae, and providing an experimental basis and technical support for the industrial production of Phylloporia lonecerae and the development and utilization of strain resources.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a honeysuckle leaf fungus and culture conditions thereof. Technical Background

[0002] my country is one of the earliest countries to cultivate and apply medicinal fungi. The "Records of the Grand Historian: Biographies of Mince" records the cultivation and application methods of Poria cocos, indicating that our ancestors had already begun to use medicinal fungi thousands of years ago. There are many kinds of common edible and medicinal fungi in my country, including Ganoderma lucidum, Poria cocos, Hericium erinaceus, etc., all of which contain complex and diverse natural active ingredients and have important applications in anti-inflammatory, anti-viral, anti-allergic, anti-tumor, lowering blood lipids, and enhancing immunity. As a major producer and consumer of edible and medicinal fungi, my country's related edible and medicinal fungi industry is developing rapidly, which will continuously promote my country's economic development and improve the quality of life of our people.

[0003] Phylloporia lonecerae, also known as honeysuckle leaf pores, honeysuckle tea leaf pores, tea leaf pores, etc., commonly known as "silver flower moth", is an annual fungus that exclusively parasitizes the stems of living honeysuckle trees. It belongs to the phylum Basidiomycota, class Agaricomycetes, order Agaricales, family Hymenochaetaceae, and genus Phylloporus. Researcher Zhang Xiaoqing, an expert from the Institute of Microbiology, Chinese Academy of Sciences, once identified the fungus as Phylloporia ribis of the same genus, and believed that the fungus was a special species that parasitized on honeysuckle plants. In 2020, our team and the team from the Institute of Microbiology, Chinese Academy of Sciences, jointly corrected the fungus as Phylloporia lonecerae.

[0004] The fruiting bodies of Lonicera japonica are imbricate, overlapping, and covered with fine hairs. The growth cycle is annual. The summer is warm and humid, and the growth is fastest. The fruiting bodies will die during the winter, but the spores will germinate in the second year and continue to grow on the original dead fungus, so that the new and old fungi will overlap each other, and it is easy to be mistaken for perennial fungi in appearance. Long-term folk application practice has proved that Lonicera japonica has good antibacterial and analgesic effects, and it also has a definite effect on the treatment of pharyngitis. The active substances such as triterpenes and sterols contained in the fruiting bodies and fermented mycelium of Lonicera japonica are important components for the fungus to have relevant medicinal functions.

[0005] The fungus has great potential for development in various aspects such as food and medicine, and its industrial production can bring huge economic benefits. The Ministry of Health's Announcement on the Approval of 7 New Resource Foods Including Tea Tree Flowers (2013) [1] approved the production and operation of the fermented mycelium of the tea leaf-shaped pore fungus as a new resource food, which also cleared the policy obstacles for the development and utilization of this fungus and the development of related industries. Honeysuckle leaf pore fungus has great development prospects, but so far, the resource utilization of this fungus is mostly for folk medicine, and industrial production and development are rare.

[0006] The slow development of this fungus is mainly due to the limitation of bacterial yield. The wild strain of Lonicera japonica is extremely difficult to grow in conventional culture medium for large fungi, and the growth rate is extremely slow, which seriously hinders the development and utilization of this resource. Summary of the invention

[0007] To address this problem, in order to produce large quantities of Lonicera mycelium efficiently, this study explored and optimized the fermentation conditions of Lonicera, aiming to provide technical support for the development and utilization of this valuable fungal resource.

[0008] A strain of Phylloporia lonecerae, deposited in the China General Microbiological Culture Collection Center, with the deposit number CGMCC No.40990; the deposit date is November 22, 2023.

[0009] A method for increasing the mycelium yield of Lonicera japonica comprises the following steps:

[0010] (1) Aseptically transferring the honeysuckle seed block to a prepared liquid seed culture medium, and culturing in a dark and shaking manner to obtain a liquid seed;

[0011] (2) inoculating the liquid strain into a liquid fermentation medium with aseptic operation, and culturing the culture at a constant temperature and in the dark with shaking to obtain mycelium; the elicitors added to the liquid fermentation medium are fungal mycelium powder, honeysuckle flowers and honeysuckle branches.

[0012] Furthermore, the formula of the liquid culture medium is: glucose 2%, peptone 0.2%, KH 2 PO 4 0.1%,Mg 2 SO 4 7H 2 O 0.05%.

[0013] Furthermore, the pH value of the liquid culture medium is 5.5-6.5; the liquid culture medium culture conditions are a temperature of 30-32° C. and a culture time of 15-20 days.

[0014] Furthermore, the carbon source of the liquid fermentation medium is glucose, sucrose or maltose, and the nitrogen source is beef extract, peptone, yeast powder or yeast extract.

[0015] Furthermore, the liquid fermentation culture has an inoculation amount of 7-10%, a temperature of 30-32° C., and a time of 20-30 days.

[0016] Furthermore, the liquid fermentation medium is: sucrose 2%, peptone 0.2%, KH 2 PO 4 0.1%,MgSO 4 7H 2 O0.05%, honeysuckle flower 0.1-0.2%, fungal mycelium powder 0.1-0.2%, honeysuckle branch 0.2-0.3%, pH is 5.5-6.5.

[0017] Beneficial Effects

[0018] Lonicera is an annual fungus that parasitizes the stems of living trees of the genus Honeysuckle. It has been proven to have definite effects in antibacterial, analgesic and pharyngitis. However, the wild resources of Lonicera are scarce, which seriously limits the development and utilization of this fungus. In order to breed and produce Lonicera in large quantities and efficiently, this study explored and optimized the culture conditions of Lonicera. The results of the study on the carbon and nitrogen sources suitable for the growth of Lonicera showed that the carbon sources suitable for the growth of Lonicera were glucose, sucrose and maltose, and the nitrogen sources suitable for the growth of Lonicera were beef extract, peptone, yeast powder and yeast extract. The experimental results of the temperature and pH of the growth environment of Lonicera showed that the suitable temperature for the growth of Lonicera was 32℃, and the suitable pH for the growth of Lonicera was pH6. Adding a small amount of special stimulating substances to the basal culture medium can greatly improve the production efficiency. The nutrient components and levels of the liquid fermentation medium of Lonicera were optimized by orthogonal experiments and response surface optimization experiments. The results showed that the optimal medium composition and level for the fermentation of Lonicera japonica were sucrose (2%), peptone (0.2%), KH 2 PO 4 (0.1%), MgSO 4 7H 2O (0.05%), honeysuckle flower (0.16%), fungal mycelium powder (0.18%), honeysuckle branch (0.21%). There are significant pairwise interactions among honeysuckle flower, fungal mycelium powder and honeysuckle branch, and each factor can promote the effect of other factors at the appropriate concentration. According to the simulated binomial equation, the mycelial biomass of honeysuckle leaf fungus can reach a maximum value of 8.22g / L after 4 weeks of cultivation in the optimized fermentation system. The original formula can obtain a biomass of 3.23±0.9g / L after 6 weeks of cultivation. This study shortened the culture cycle by 14 days and increased the biomass by 2.51 times that of the original formula. The above systematic study on the fermentation medium of honeysuckle leaf fungus provides an experimental basis and technical support for the industrial production of honeysuckle leaf fungus and the development and utilization of strain resources.

[0019] Strain deposit information

[0020] Deposit date: November 22, 2023;

[0021] Depository: General Microbiology Center, China Microbiological Culture Collection Administration;

[0022] Deposit number: CGMCC No.40990;

[0023] Address of the depository: The depository address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing;

[0024] Classification name: Phylloporia lonecerae. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The effect of carrot addition on mycelial growth rate;

[0026] Figure 2 The effect of potato addition on mycelial growth rate;

[0027] Figure 3 The effect of sucrose addition on mycelial growth rate;

[0028] Figure 4 The effect of peptone addition on mycelial growth rate;

[0029] Figure 5 The effect of the amount of honeysuckle added on the mycelial growth rate;

[0030] Figure 6 The effect of the amount of fungal mycelium powder added on the mycelium growth rate;

[0031] Figure 7 The effect of the amount of honeysuckle branches added on the mycelial growth rate;

[0032] Figure 8 The contour lines and response surface diagrams of the interaction between honeysuckle X1 and fungal mycelium powder X2 in the culture medium;

[0033] Fig. 9 The contour lines and response surface diagrams of the interaction between honeysuckle flower X1 and honeysuckle branch X3 in the culture medium;

[0034] Fig.10 The contour lines and response surface diagrams of the interaction between fungal mycelium powder X2 and honeysuckle branches X3 in the culture medium;

[0035] Fig.11 The effect of different carbon sources on the growth of Lonicera japonica;

[0036] Fig.12 The effect of different nitrogen sources on the growth of Lonicera japonica;

[0037] Fig.13 The results of the orthogonal test plate test;

[0038] Fig.14 The results of response surface experiment. DETAILED DESCRIPTION

[0039] The following is a detailed description of an embodiment of the present invention. This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and a specific operation process are given, but the protection scope of the present invention is not limited to the following embodiment.

[0040] The honeysuckle leaf fungus in the following examples was collected from Linyi City, Shandong Province on September 20, 2019, and its taxonomic name for preservation is honeysuckle leaf fungus Phylloporia lonecerae, which is preserved in the General Microbiological Center of the China Microbiological Culture Collection Administration Committee, the address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, the preservation date is November 22, 2023, and the preservation number is CGMCC No.40990.

[0041] Fruiting body morphological characteristics:

[0042] It is often imbricate and covered with fine hairs with obvious annular bands and sharp edges. The surface of the orifice is straw yellow and polygonal, with 8-9 per mm. The edge of the orifice is thick and entire. The flesh is about 1.5 mm thick, cinnamon-colored, heterogeneous, and there is a thin black line between the upper and lower layers of hairs. The lower flesh is dense and hard, gradually narrowing from the base to the edge, and the upper layer of hairs is narrower, with a base thickness of about 0.5 mm. The tube layer is 2 mm thick, lighter in color than the flesh and harder in texture.

[0043] Microstructural characteristics:

[0044] Mycelial structure: Diphyletic. Flesh: The hyphae of the lower flesh are arranged regularly, light yellow, thick-walled, often separated, and 3.2-4.1μm in diameter; the hyphae of the upper villi are arranged loosely and intertwined, light yellow-brown, thick-walled, separated, and 3.5-4μm in diameter. Bacterial tube: The hyphae of the myelin are arranged slightly parallel to the bacterial tube, golden yellow, thick-walled, occasionally branched and separated, and 2.2-3.4μm in diameter. Basidia 13-15×4-5μm; pseudo-basidia are slightly smaller than basidia. Basidiospore: Oval, CB+, (2.9-)3-3.3(-3.4)×(2-)2.1-2.5(-2.6)μm, L=3.12μm, W=2.23μm, Q=1.38-1.40(n=60 / 2).

[0045] Molecular identification of bacterial species: Use ribosomal DNA internal transcribed spacer (ITS) sequence primers, the primer sequences are ITS4 (TCC TCC GCT TAT TGA TAT GC) and ITS5 (GGA AGT AAA AGT CGT AAC AAG G). PCR amplification reaction system: DNA template (1.5μL), forward primer (1μL), reverse primer (1μL), 2×Taq PCR Mix (15μL), ddH 2 O (11.5 μL). The amplification reaction program was 94°C pre-denaturation for 3 min, 94°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 1 min, repeating steps 2-4 for 35 cycles, and 72°C fill-in for 5 min. The ITS sequence was sequenced.

[0046] ITS sequence of Lonicera japonica:

[0047] CCTTGCATCTGAGGTCAACGATCAAGCAAAGGTCGTAATGACCTTGTCCGAAGACGATTAGAAGCAGACCCGTCAAGATAAGCCCTTCCGGTGAACAAATTACTATTACACCATCCACGCAAACCAAGGTCCAGCTAATGCTTTTCAGAGGAGCCGACATACGCAGAGAG CGCTTACCGGCAAAGCCTCCAAGTCCAAACCATCCATCCAAGCCTAACAAAAGACTGGAGGTTTGAGATTAACATGACACTCAAACAGGCATGCCCTTCGGGATACCAAAGGGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTA TCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTGTGTTTATTTCGCCCATACAGAGCAACACATTCACAAGACATACAAAAAGTTGATAAAGATCAAGGCTTTCGACTACACTCTTCAAATGTACGACGCTCGCTTTCAGACTACTGATGCCTATAGCACCCTCGCC TTACTCACTACCTGTCAGTCTAAAAAGTGAAAACCTACTCGCTTTGCAAAGGTGCACATGGGTTGAGCGGATTGAGCACAGAGCCGTGCACATGCATGTTTCCACACCAGCAGCAGACTCCACTTTCAAAAACTCATTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGATTTTTTACTTCCA

[0048] Example 1

[0049] 1 Materials and methods

[0050] 1.1 Experimental Materials

[0051] Wild Lonicera japonica strain 546 was isolated and preserved by the Shandong Key Laboratory of Applied Fungi.

[0052] Preparation method of fungal mycelium powder: inoculate the mother strain of low-temperature preserved thin multi-year porphyra into the basic liquid culture medium aseptically and activate it for 6 days, then aseptically transfer it to the corn starch liquid fermentation medium with a 5% inoculation amount, and culture it at 26-28℃ and in the dark for 7 days before the culture is finished. The shaking speed is 100-120rpm in the first two days of culture, 140-150rpm on the 3rd to 5th day of culture, and 130-140rpm on the 6th to 7th day of culture. After 7 days of culture, filter it with a 200-300 mesh gauze, rinse the mycelium with distilled water 2-3 times, freeze the mycelium in a -20--40 refrigerator for 1-2 days, and then transfer it to a freeze dryer for freeze drying. The dried mycelium is crushed into powder by a high-speed grinder for use.

[0053] The basic liquid culture medium formula is: 20% potato, 2% glucose. 200 mL of culture medium is placed in a 500 mL Erlenmeyer flask, sterilized at 121°C for 20 min, and set aside.

[0054] Liquid fermentation medium: 1% corn starch, 2% sucrose, 0.5% peptone, 0.05% magnesium sulfate, 0.1% dipotassium hydrogen phosphate. 200 mL of medium was placed in a 500 mL Erlenmeyer flask and sterilized by autoclave at 121°C for 20 min.

[0055] 1.2 Experimental methods

[0056] 1.2.1 Screening of carbon and nitrogen sources suitable for the growth of Lonicera japonica

[0057] Basic medium: glucose (2%), peptone (0.2%), KH 2 PO4(0.1%), MgSO 4 7H 2 O (0.05%), agar (2%), pH natural.

[0058] Effects of different carbon sources on growth: The carbon sources in the basal medium were replaced with equal amounts of glucose, sucrose, maltose, lactose, corn starch, and sweet potato starch, respectively, and solid medium was prepared, with the treatment without adding carbon source as CK. Each treatment was repeated 5 times.

[0059] Effects of different nitrogen sources on growth: The nitrogen sources in the basal culture medium were replaced with equal amounts of peptone, yeast extract, yeast powder, beef extract, ammonium sulfate, and urea, respectively, to prepare solid culture medium, and the treatment without nitrogen source addition was designated as CK. Each treatment was replicated 5 times.

[0060] Plate culture: Sterilize the prepared culture medium with 121℃ high pressure steam for 30 minutes and then pour it into the plate. Inoculate the honeysuckle fungus blocks of similar size and shape and consistent growth conditions in the center of the test plate, and culture them in the dark for 30 days. After the culture is completed, observe, take pictures and record the culture characteristics, measure the colony diameter, calculate the mycelial growth rate, and perform variance analysis on the results. 1.2.2 Study on the temperature and pH suitable for the growth of honeysuckle fungus

[0061] According to the single factor screening results of carbon source and nitrogen source, appropriate carbon source and nitrogen source were selected to configure the corresponding solid culture medium.

[0062] The inoculated honeysuckle plates were randomly divided into groups with 5 replicates in each group, and placed at 26°C, 28°C, 30°C, and 32°C, respectively, for constant temperature and light-proof culture.

[0063] The prepared culture medium was divided into 5 groups, and the pH of each culture medium was adjusted to 5, 6, 7, 8, and 9 respectively. After sterilization, the plates were removed, and each group was repeated 5 times. After inoculation with Lonicera japonica, the culture medium was placed in a 30°C environment, kept at a constant temperature and away from light, and cultured statically.

[0064] After the cultivation, the cultivation characteristics of each group were observed, photographed and recorded, the colony diameter was measured, the mycelial growth rate was calculated, and the results were analyzed by variance.

[0065] 1.2.3 Orthogonal experiment for optimizing the culture conditions of Lonicera japonica

[0066] According to the previous experiments on various nutritional factors, appropriate carbon sources and nitrogen sources were selected to participate in the orthogonal experiment. In addition, since wild honeysuckle leaf fungus is a fungus that specifically parasitizes on living honeysuckle trees, in order to explore whether honeysuckle has a regulatory effect on the growth of honeysuckle leaf fungus, honeysuckle flowers were selected as the stimulating factor in this experiment. Previous studies in this laboratory believe that fungal polysaccharide elicitors have a promoting effect on the fermentation growth of fungi and the accumulation of effective ingredients, so fungal mycelium was also selected as an stimulating factor to participate in the experiment (D). A total of 4 factors were set in this orthogonal experiment: carbon source (A), nitrogen source (B), honeysuckle flowers (C), and fungal mycelium (D). The orthogonal experimental design is shown in Tables 1 and 2.

[0067] Basic medium: KH 2 PO 4 0.1%,Mg 2 SO 4 7H 2 O 0.05%, pH natural.

[0068] Table 1 Four-factor three-level orthogonal test design table

[0069]

[0070] Table 2L9 (3 4 )Orthogonal array design table

[0071]

[0072]

[0073] According to Table 1 and Table 2, the corresponding components were added to the basic culture medium to prepare the solid culture medium, and sterilized by high pressure steam at 121°C for 30 minutes. The culture medium was inverted on a 60 mm culture dish, and the bacterial blocks of the same size and similar growth state were inoculated in the center of the plate. The experiment set up 7 biological replicates. After inoculation, the culture medium was inverted in a 32°C constant temperature incubator away from light for 6 weeks, and the mycelial growth was observed and photographed for record.

[0074] 1.2.4 Response surface optimization of culture conditions of Lonicera japonica

[0075] 1) Single factor climbing test

[0076] Since wild honeysuckle leaf fungus is a kind of fungus that parasitizes on living honeysuckle trees, honeysuckle flowers and honeysuckle branches were selected as the stimulating factors in this experiment. Fungal mycelium was selected as the stimulating factor. Under solid culture conditions, the small molecule carbon source and small molecule nitrogen source suitable for the growth of honeysuckle leaf fungus are sucrose and peptone, respectively. In this experiment, carrots, potatoes, sucrose, peptone, honeysuckle flowers, fungal mycelium and honeysuckle branches were selected as experimental factors to determine the climbing step length and range of the single factor climbing test. The experimental design is shown in Table 3.

[0077] The basic medium was sucrose (2%), peptone (0.2%), KH 2 PO 4 (0.1%), MgSO 4 7H 2 O (0.05%), pH natural.

[0078] Table 3 Single factor climbing test design

[0079]

[0080]

[0081] According to Table 3, add or replace the corresponding components in the basic culture medium to prepare the solid culture medium, sterilize with high-pressure steam at 121℃ for 30min, invert the culture medium in a 60mm culture dish, inoculate the bacterial blocks of the same size and similar growth status in the center of the plate, and set up 7 biological replicates in the experiment. After inoculation, invert and culture in a 32℃ constant temperature incubator away from light for three weeks, observe the growth of mycelium and take photos for record.

[0082] 2) Response surface optimization experiment

[0083] According to the results of the single factor climbing test, three factors that have a significant impact on the growth of Lonicera japonica in the culture medium were selected for response surface optimization experiment. The minimum and maximum values ​​of each factor and the addition amount of other factors were determined according to the results of the single factor climbing test.

[0084] Design-Expert software was used for response surface optimization design, and the Box-Behnken method was used to design a three-factor three-level response surface optimization experiment, with a total of 17 groups of experiments.

[0085] According to the response surface optimization experiment design, the liquid culture medium was prepared and divided into 500 mL triangular flasks, with a bottling volume of 200 mL. After sterilization with high-pressure steam at 121°C for 20 minutes, the liquid strain was inoculated with an inoculation volume of 10%. Four groups of biological replicates were set up for the experiment. After inoculation, the culture was cultured at 32°C, 120 rpm, and light-proof for 30 days. The mycelial growth was observed and photographed.

[0086] 1.2.5 Experimental data processing

[0087] The DPS data processing system and SPSS data processing system were used to compare the significant differences of the data using Ducan's new multiple range method, and the significance level was set at α=0.05(P<0.05). The Box-Behnken response surface optimization experiment design and data processing were performed using Design-Expert software.

[0088] 2 Results and analysis

[0089] 2.1 Effects of different carbon sources on the growth of Lonicera japonica

[0090] As shown in Table 4, the mycelial growth characteristics of the sucrose group, maltose group and glucose group all showed uniform growth of velvet tape, the mycelial morphology was good, the color was darker and the growth was uniform, the colony density was large, and the mycelial growth rate was good. Among them, the mycelial growth rate of the sucrose group was the largest, and the colony density of the maltose group was the highest. The mycelial growth of the control group, lactose group, corn starch group, sweet potato starch group and soluble starch group all showed flocculent radial growth, and the colony density was low, the color was lighter, the colony edge was partially transparent or completely transparent, and the growth state was poor. Except for the control group and lactose group, the mycelial growth rate was not significantly different from that of the sucrose group, maltose group and glucose group. Therefore, the carbon sources more suitable for the growth of honeysuckle leaf inoculum are glucose, sucrose and maltose. Since this study aims to explore the industrial large-scale fermentation system for the growth of honeysuckle leaf inoculum, considering the cost of experiment and promotion, only sucrose was selected as the main carbon source of the honeysuckle leaf inoculum culture medium among the three small molecule carbon sources suitable for the growth of honeysuckle leaf inoculum.

[0091] Table 4 Effects of different carbon sources on the growth of Lonicera japonica

[0092]

[0093] *Note: 1. Significant difference analysis: P < 0.05 level

[0094] 2. Colony density: "++++" extremely dense, "+++" very dense, "+" dense, "--" sparse

[0095] 2.2 Effects of different nitrogen sources on the growth of Lonicera japonica

[0096] As shown in Table 5, in the nitrogen source screening test, the mycelial growth characteristics of the beef extract group, peptone group, yeast powder group and yeast paste group all showed uniform growth of velvet tape, the mycelial morphology was good, the color was darker and the growth was uniform, the colony density was large, and the mycelial growth rate was good. Among them, the mycelial growth rate of the beef extract group was the largest, and the colony density of the peptone group, yeast powder group and yeast paste group was the highest. The mycelium of the control group and the ammonium sulfate group showed flocculent radial growth, and the colony density was low, the color was lighter, the colony edge was partially transparent or completely transparent, and the growth state was poor. The strain in the urea group did not germinate. Therefore, the nitrogen sources more suitable for the growth of Lonicera japonica are beef extract, peptone, yeast powder and yeast paste. Since this study aims to explore the industrial large-scale fermentation system for the growth of Lonicera japonica, considering the cost of the test and promotion, only peptone was selected as the main carbon source of the culture medium of Lonicera japonica among the four small molecule carbon sources suitable for the growth of Lonicera japonica.

[0097] Table 5 Effects of different nitrogen sources on the growth of Lonicera japonica

[0098]

[0099]

[0100] *Note: 1. Significant difference analysis: P < 0.05 level

[0101] 3. Colony density: "+++" very dense, "++" relatively dense, "+" dense, "--" relatively sparse 2.3 Effects of different temperatures on the growth of Lonicera japonica

[0102] The results of the temperature experiment are shown in Table 6. The mycelium of Honeysuckle Leaf Inoculum grows uniformly in a tapered shape at four gradient temperatures, and the colony color and edge growth conditions are consistent. The mycelium growth rate under 26℃ and 28℃ environments is low, and the colony density is low. The colony density of Honeysuckle Leaf Inoculum at 30℃ and 32℃ is large, and the mycelium growth rate of the 32℃ group is significantly the highest. Therefore, the most suitable growth temperature for Honeysuckle Leaf Inoculum is 32℃. In summary, 32℃ was selected as the culture temperature of Honeysuckle Leaf Inoculum.

[0103] Table 6 Effects of different ambient temperatures on the growth of Lonicera japonica

[0104]

[0105] *Note: 1. Significant difference analysis: P < 0.05 level

[0106] 2. Colony density: "+++" means very dense, "++" means relatively dense

[0107] 2.4 Effects of different culture medium pH on the growth of Lonicera japonica

[0108] As shown in Table 7, the experiments with different initial pH values ​​were all cultured at 30°C. As shown in Table 4, all experimental groups had germinated, but the colony growth of the initial culture medium pH 5 and pH 6 was significantly superior to that of the pH 7, pH 8, and pH 9 groups, and the colony density was greater. The best growth effect was in the pH 6 group.

[0109] Table 7 Effect of different pH on the growth of Lonicera japonica

[0110]

[0111]

[0112] *Note: 1. Significant difference analysis: P < 0.05 level

[0113] 2. Colony density: "+++" very dense, "++" relatively dense, "+" dense

[0114] 2.5 Analysis of orthogonal test results for optimizing culture conditions of Lonicera japonica

[0115] It can be seen from the plate culture results in Table 8 that the treatment groups with the densest colony density are the third, fourth, seventh and eighth groups, and the treatment groups with the largest mycelium growth are the seventh, eighth, fifth and fourth groups, which have significant differences in growth with other treatment groups, followed by the third, second, sixth and ninth groups. The lowest growth is in the first group, and there are significant differences in growth among these groups.

[0116] Table 8 Plate culture results

[0117]

[0118] *Note: 1. Significant difference analysis: P < 0.05 level

[0119] 2. Colony density: The colony density on the plate is divided into five levels, represented by numbers "1" to "5". "1" represents the lowest colony density and "5" represents the highest colony density.

[0120] The visual analysis and variance analysis results of the orthogonal test results of mycelium growth rate are shown in Tables 9 and 10. Variance analysis results model R 2 =0.981, adjusted R 2 =0.978, indicating that the data of this experiment is reliable and can reflect the experimental results. The four factors in the culture medium of Honeysuckle Leaf Inoculum: sucrose A, peptone B, honeysuckle flower C, fungal mycelium D, the significant P value is less than 0.05, indicating that the four factors involved in the orthogonal experiment have a significant effect on the mycelial growth rate of Honeysuckle Leaf Inoculum, and the experimental results are statistically significant. There are differences in the effects of the four factors on the mycelial growth rate. The factor with the greatest impact on the mycelial growth rate is fungal mycelium (D), followed by honeysuckle flower (C), and then sucrose (A). Among the four factors, the factor with the least impact on mycelial growth is peptone (B).

[0121] From the results of intuitive analysis and variance analysis, it can be seen that in order to obtain a greater mycelial growth rate, the factor sucrose is optimal at the second level of 2% addition, and the factor peptone is optimal at the second level of 0.2% addition. The promoting effects of honeysuckle and fungal mycelium increase with increasing concentration, and both have the best promoting effects at the highest level of 0.1%. The optimal concentrations of these two factors for promoting the mycelial growth of Honeysuckle Leaf Pore Fungus are worthy of further study.

[0122] Table 9 Intuitive analysis of orthogonal test of mycelium growth rate

[0123]

[0124] Table 10 Analysis of variance of orthogonal test for mycelium growth rate

[0125]

[0126]

[0127] a R-square = .981 (adjusted R-square = .978)

[0128] The statistical results of the orthogonal test of colony density and the results of variance analysis are shown in Table 11 and Table 12. The four factors have different effects on the colony density of Lonicera japonica. The factor with the greatest impact on colony density is fungal mycelium (D), followed by honeysuckle (C), and then sucrose (A). Among the four factors, the factor with the least impact on colony density is peptone (B). The results of the orthogonal experiment of colony density are similar to the results of mycelium growth.

[0129] Comparing the mean values ​​of colony density at different levels of each factor, it can be seen that for obtaining a larger colony density, the factor sucrose is optimal at the second level of 2% addition, the factor peptone is optimal at the second level of 0.2% addition, and the factor honeysuckle and the factor fungal mycelium are both optimal at the third level. The results of the orthogonal test of colony density are consistent with the results of the mycelium growth experiment.

[0130] Table 11 Colony density results of each treatment

[0131]

[0132] *Note: Colony density: The colony density on the plate is divided into five levels, represented by numbers "1" to "5", "1" represents the lowest colony density, and "5" represents the highest colony density.

[0133] Table 12 Intuitive analysis of colony density test results

[0134]

[0135]

[0136] 2.6 Analysis of response surface optimization results of the culture conditions of Lonicera japonica

[0137] 1) Single factor climbing experiment results

[0138] Based on the difference in mycelial growth rate under the same culture conditions, a single factor climbing test was conducted on the amount of carrot added to the culture medium. The test results are as follows: Figure 1 As shown, the amount of carrot added to the culture medium promotes the growth of honeysuckle mycelium, which first increases and then weakens. When the amount of carrot added is around 20%, the mycelium growth rate reaches a high value of 0.68±0.04mm / d. From the variance analysis table 13, it can be seen that the model F value of this factor is 2.4, and the model P value is 0.0729, which is greater than 0.05, indicating that the influence of this factor on the test results is not significant.

[0139] Table 13 Analysis of variance of the effect of carrot addition on mycelial growth rate

[0140]

[0141] αR 2 =0.249 (adjusted R 2 =0.145)

[0142] Based on the difference in mycelial growth rate under the same culture conditions, a single factor climbing test was conducted on the amount of potato added to the culture medium. The test results are as follows: Figure 2As shown in the figure, the effect of adding potato to the culture medium on the growth of honeysuckle mycelium showed a trend of first increasing and then weakening. When the amount of potato added was around 15%, the mycelium growth rate reached a high value of 1.08±0.09mm / d. From the variance analysis table 14, it can be seen that the model F value of this factor is 3.27, and the model P value is 0.0256, which is less than 0.05, indicating that the influence of this factor on the test results is significant and meaningful.

[0143] Table 14 Analysis of variance of the effect of potato addition on mycelium growth rate

[0144]

[0145] αR 2 =0.318 (adjusted R 2 =0.221)

[0146] Based on the difference in mycelial growth rate under the same culture conditions, a single factor climbing test was conducted on the amount of sucrose added to the culture medium. The test results are as follows: Figure 3 As shown, under the influence of different sucrose addition amounts in the culture medium, the growth difference of honeysuckle leaf hole fungus mycelium among the groups was not significant, fluctuating between 0.65mm / d and 0.71mm / d, with little change. From the variance analysis table 15, it can be seen that the model F value of this factor is 1.57, and the model P value is 0.213, which is greater than 0.05, indicating that the influence of this factor on the test results is not significant.

[0147] Table 15 Analysis of variance of the effect of sucrose addition on mycelial growth rate

[0148]

[0149] αR 2 =0.194 (adjusted R 2 =0.070)

[0150] Based on the difference in mycelial growth rate under the same culture conditions, a single factor climbing test was conducted on the amount of peptone added to the culture medium. The test results are as follows: Figure 4 As shown in the figure, the effect of the addition of peptone in the culture medium on the growth of the mycelium of Lonicera japonica showed a trend of first increasing and then weakening. When the addition of peptone was around 0.3%, the mycelium growth rate reached a high value of 0.76±0.05mm / d. From the variance analysis table 16, it can be seen that the model F value of this factor is 17.61, and the model P value is 0.0001, which is less than 0.01, indicating that the influence of this factor on the test results is extremely significant and meaningful.

[0151] Table 16 Analysis of variance of the effect of peptone addition on mycelial growth rate

[0152]

[0153] αR 2 =0.723 (adjusted R 2 =0.682)

[0154] Based on the difference in mycelial growth rate under the same culture conditions, a single factor climbing test was conducted on the amount of honeysuckle added to the culture medium. The test results are as follows: Figure 5 As shown, the effect of honeysuckle added in the culture medium on the growth of honeysuckle mycelium showed a trend of first strengthening and then weakening. When the amount of honeysuckle added was around 0.15%, the mycelium growth rate reached a high value of 0.91±0.05mm / d. From the variance analysis table 17, it can be seen that the model F value of this factor is 26.56, and the model P value is 0.0001, which is less than 0.01, indicating that the influence of this factor on the test results is extremely significant and meaningful.

[0155] Table 17 Analysis of variance of the effect of honeysuckle addition on mycelial growth rate

[0156]

[0157]

[0158] αR 2 =0.818 (adjusted R 2 =0.786)

[0159] Based on the difference in mycelial growth rate under the same culture conditions, a single factor climbing test was conducted on the amount of fungal mycelium added to the culture medium. The test results are as follows Figure 6 As shown, the effect of the addition of fungal mycelium in the culture medium on the growth of honeysuckle mycelium showed a trend of first increasing and then weakening. When the addition of fungal mycelium was around 0.1%, the mycelium growth rate reached a high value of 0.91±0.10mm / d. From the variance analysis table 18, it can be seen that the model F value of this factor is 14.14, and the model P value is 0.0001, which is less than 0.01, indicating that the influence of this factor on the test results is extremely significant and meaningful.

[0160] Table 18 Analysis of variance of the effect of fungal mycelium addition on mycelium growth rate

[0161]

[0162] αR 2 =0.661 (adjusted R 2 =0.614)

[0163] Based on the difference in mycelial growth rate under the same culture conditions, a single factor climbing test was conducted on the amount of honeysuckle added to the culture medium. The test results are as follows: Figure 7As shown, the addition of honeysuckle branches in the culture medium promotes the growth of honeysuckle mycelium, and when the addition of honeysuckle branches is around 0.2%, the mycelium growth rate reaches a high value of 0.83±0.03mm / d. From the variance analysis table 19, it can be seen that the model F value of this factor is 16.64, and the model P value is 0.0001, which is less than 0.01, indicating that the influence of this factor on the test results is extremely significant and meaningful.

[0164] Table 19 Analysis of variance of the effect of honeysuckle branch addition on mycelium growth rate

[0165]

[0166] αR 2 =0.697 (adjusted R 2 =0.655)

[0167] 2) Response surface optimization test results

[0168] According to the results of the single factor climbing test, honeysuckle, fungal mycelium, honeysuckle branches and peptone all have extremely significant effects on promoting the growth of honeysuckle leaf hole fungus mycelium. As a small molecule nitrogen source, peptone is a basic nutrient in the culture medium. The other three stimulating factors have greater optimization value. At the same time, considering the cost of subsequent experiments, only the three factors of honeysuckle, fungal mycelium and honeysuckle branches with the most significant influence are selected for response surface optimization experiments. When the amount of peptone added is 0.2%-0.3%, there is a relatively good promotion effect, so 0.2% is selected as the amount of peptone added. The Box-Behnken three-factor three-level response surface optimization experiment design was performed using Design-Expert software. The specific experimental design of the three variables and the experimental results are shown in Tables 20 and 21.

[0169] Table 20 Response surface optimization design

[0170]

[0171] Table 21 Response surface optimization results of liquid fermentation of Lonicera japonica

[0172]

[0173]

[0174] The experimental data were fitted by regression analysis, and the following second-order polynomial model was obtained:

[0175] Y=-2.02288+25.745X1+47.23X2+41.085X3-55.25X1X2+10.75X1X3-55.5X2X3-54.65X12 -80.9X2 2 -82.9X3 2

[0176] Among them, Y represents mycelial biomass, X1 represents the amount of honeysuckle added, X2 represents the amount of fungal mycelium added, and X3 represents the amount of honeysuckle branch added. The variance analysis of the culture medium optimization fitting model for the mycelial biomass of honeysuckle leaf pore fungus was performed. The model F value was 14.87 and the P value was 0.0009, which was less than 0.05, indicating that the model was accurate and reliable. The determination coefficient R 2 =0.9503, adjusted R 2 =0.8864, indicating that the model can reflect the test results well. The coefficient of variation CV is 6.40%, indicating that the test data is reliable and the model prediction value has a high correlation with the actual value. Among all the independent variables, interaction terms and quadratic terms in the model, X1, X2, X3, X1X2, X2X3, X1 2 , X2 2 、X3 2 The P values ​​of the models are all less than 0.05, indicating that the model is significant and meaningful.

[0177] Table 22 Analysis of variance of the response surface fitting model of Lonicera japonica culture medium

[0178]

[0179]

[0180] The contour map and response surface map of the three-factor interaction simulated by Design-Expert software are as follows Figure 8-Figure 10 As shown, the contour map is elliptical, indicating that there are significant pairwise interactions between the three factors, and each factor can promote the effects of other factors at appropriate concentrations. According to the simulated binomial equation, when the addition amount of honeysuckle in the culture medium is 0.16%, the addition amount of fungal mycelium is 0.18%, and the addition amount of honeysuckle branches is 0.21%, the maximum value of mycelial biomass is 8.22g / L. The original formula can obtain a biomass of 3.23±0.9g / L after 6 weeks of cultivation. This study shortened the culture period by 14 days and increased the biomass by 2.51 times that of the original formula.

Claims

1. A strain of Phylloporia lonecerae, deposited in the China General Microbiological Culture Collection Center, with the deposit number CGMCC No.40990; the deposit time is November 22, 2023.

2. A method for increasing the mycelium yield of the honeysuckle fungus according to claim 1, characterized in that: The following steps are involved: (1) Aseptically transferring the honeysuckle seed block to a prepared liquid seed culture medium, and culturing in a dark and shaking manner to obtain a liquid seed; (2) inoculating the liquid strain into a liquid fermentation medium with aseptic operation, and culturing the culture at a constant temperature and in the dark with shaking to obtain mycelium; the elicitors added to the liquid fermentation medium are fungal mycelium powder, honeysuckle flowers and honeysuckle branches.

3. The culture method according to claim 2, characterized in that The formula of the liquid bacterial culture medium is: 2% glucose, 0.2% peptone, 0.1% KH2PO4, and 0.05% Mg2SO4·7H2O.

4. The culture method according to claim 2, characterized in that The pH value of the liquid bacterial culture medium is 5.5-6.5; the liquid bacterial culture conditions are a temperature of 30-32° C. and a culture time of 15-20 days.

5. The culture method according to claim 2, characterized in that: The carbon source of the liquid fermentation medium is glucose, sucrose or maltose, and the nitrogen source is beef extract, peptone, yeast powder or yeast extract.

6. The culture method according to claim 2, characterized in that: The liquid fermentation culture inoculation amount is 7-10%, the temperature is 30-32° C., and the time is 20-30 days.

7. The culture method according to claim 2, characterized in that: The liquid fermentation medium comprises: 2% sucrose, 0.2% peptone, 0.1% KH2PO4, 0.05% MgSO4·7H2O, 0.1-0.2% honeysuckle flower, 0.1-0.2% fungal mycelium powder, 0.2-0.3% honeysuckle branch, and the pH value is 5.5-6.5.

Images