A primer pair for detecting molecular markers related to ethylene transition in pear fruit and its application

Abstract

The present invention belongs to the technical field of molecular biology, and discloses a primer pair and application for detecting a molecular marker related to ethylene transition of pear fruit. The molecular marker is expressed as an insertion / deletion length polymorphism of the nucleotide sequence shown in SEQ ID NO.4. The molecular marker described in the present invention is closely related to the non-respiratory transition trait of pear fruit, and a PCR primer pair for accurately confirming the non-respiratory transition mechanism of pear fruit is developed, which has the advantages of strong specificity and good stability. The molecular marker of the present invention can assist in screening the non-respiratory transition trait of pear fruit and distinguish the non-respiratory transition trait dependence mechanism, greatly accelerate the pear breeding process, and is beneficial to the post-harvest storage of the fruit.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a primer pair for detecting molecular markers related to ethylene transition in pear fruit and an application thereof. Background Art

[0002] Pear (Pyrus spp.) belongs to the genus Pyrus (Pyrus L.) of the subfamily Pomaceae of the family Rosaceae. It is a deciduous tree and one of the important economic tree species in temperate fruit trees. As the third largest temperate fruit after apples and grapes, the annual global production of pears exceeds 20 million tons. Pears are tender, juicy and delicious. They are rich in various nutrients needed by the human body, such as protein, fat, carbohydrates, phosphorus, calcium, iron and other elements. Eating them in moderation is good for health. Pears also have the effects of relieving cough and reducing phlegm, aiding digestion, clearing the heart and moistening the lungs, etc. They can be made into ancillary products such as pear juice, pear paste, dried pears, pear preserves, canned pears, pear wine and pear vinegar.

[0003] Climax fruits will have a clear respiratory peak during the ripening process, which is usually accompanied by a large amount of ethylene release. Climax fruits can continue to soften after ripening, and their color and flavor will also change significantly. Non-climax fruits do not have a clear respiratory peak, the amount of ethylene produced is relatively low, and the ripening process is more gradual. The quality of this type of fruit changes little after picking, and it will not continue to soften. Its ripening is mainly manifested in the accumulation of sugar and the reduction of acidity.

[0004] During the breeding process, fruit maturity is mostly judged by appearance, the results are subjective, and there is a lack of quantitative detection methods. In the pear fruit breeding process, there is also a lack of molecular markers that can directly detect ethylene transitions.

[0005] In previous studies, the inventor of this patent disclosed a molecular marker and detection method and application related to ethylene transition in pear fruit in the Chinese invention patent with publication number CN113736902A, which was manifested as the insertion / deletion length polymorphism of the nucleotide sequence of 25bp. The gene fragment length obtained by PCR amplification can quickly determine whether ethylene transition occurs. Later, a molecular marker and application related to non-respiratory transition in pear fruit was disclosed in the Chinese invention patent with publication number CN117305492A, which was manifested as the insertion / deletion length polymorphism of the nucleotide sequence of 1120bp. It can be seen that there is more than one molecular marker related to ethylene transition in pear fruit. The development of more molecular markers and the use of molecular markers to find genes related to ethylene transition in pear fruit are of great significance to pear breeding and post-harvest storage management. Summary of the invention

[0006] The invention provides a primer pair for detecting a molecular marker related to ethylene transition in pear fruit and its application. The molecular marker of the invention is closely related to the ethylene transition trait of pear fruit and is used for breeding research of pear fruit.

[0007] In order to achieve the above object, the technical solution of the present invention is as follows:

[0008] When counting the fruit traits of a pear hybrid population, the inventors found that when the upstream gene that inhibits the expression of the target gene is not expressed, the pear fruit still has a non-respiratory climacteric trait. After resequencing the hybrid population, they found that a 3.8Kb deletion on the chromosome can also lead to the non-respiratory climacteric trait. A molecular marker related to ethylene climacteric in pear fruit was obtained, which is expressed as an insertion / deletion length polymorphism of the nucleotide sequence shown in SEQ ID NO.4.

[0009] Further, individuals having the nucleotide sequence shown in SEQ ID NO.4 and being homozygous at the molecular marker site exhibit non-ethylene climacteric;

[0010] Individuals lacking the nucleotide sequence shown in SEQ ID NO.4 and being homozygous at the molecular marker site exhibit ethylene hopping;

[0011] Individuals lacking the nucleotide sequence shown in SEQ ID NO.4 and being heterozygous at the molecular marker site exhibit ethylene transition.

[0012] The present invention also provides a primer pair for detecting the molecular marker, comprising a forward primer F with a nucleotide sequence as shown in SEQ ID NO.1, a reverse primer R1 with a nucleotide sequence as shown in SEQ ID NO.2, and a reverse primer R2 with a nucleotide sequence as shown in SEQ ID NO.3.

[0013] Furthermore, the primer pair is used to perform PCR amplification on pear genomic DNA and detect the length of the amplified fragment. When the amplified fragment is 219 bp, it shows a non-ethylene transition; when the amplified fragment is 430 bp, it shows an ethylene transition; when the amplified fragment is 219 bp and 430 bp, the molecular marker site of the pear to be tested is heterozygous, showing an ethylene transition.

[0014] The present invention also provides the use of the primer pair in pear breeding.

[0015] The present invention also provides a kit for detecting the above molecular markers, wherein the kit comprises the above primer pair.

[0016] The invention also provides use of the kit in pear breeding.

[0017] The present invention also provides a method for detecting the ethylene transition trait of pear fruit by using the molecular marker, comprising the following steps:

[0018] Using the above primer pair or the above kit, PCR amplification is performed on the genomic DNA of the pear to be tested and the length of the amplified fragment is detected. When the amplified fragment is 219bp, it shows a non-ethylene transition. When the amplified fragment is 430bp, it shows an ethylene transition. When the amplified fragment is 219bp and 430bp, the molecular marker site of the pear to be tested is heterozygous, which shows an ethylene transition.

[0019] Furthermore, agarose gel electrophoresis was used to detect the length of the amplified fragment.

[0020] The invention also provides use of the molecular marker in pear storage management.

[0021] Compared with the prior art, the molecular marker related to ethylene transition in pear fruit provided by the present invention has the following beneficial effects:

[0022] 1. The invention has developed PCR primers for assisting in the screening of non-respiratory bursts in pear fruits, which have the advantages of co-dominance, strong specificity, and good stability. The molecular markers provided by the invention are closely related to the ethylene burst trait of pear fruits. The length of the gene fragment obtained by PCR amplification can be used to judge whether ethylene bursts occur, and the maturity of pear fruits can be quickly and accurately judged, which can be used in pear breeding.

[0023] 2. The molecular markers described in the present invention are closely related to the ethylene transition characteristics of pear fruit and can be used for storage management of pear fruit to avoid waste of resources and misjudgment of fruit. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0025] Figure 1 This is a graph showing the variation trend of ethylene production of pear fruit samples 1 to 8 on different days in Example 1 of the present invention;

[0026] Among them, Figure (1) to Figure (8) represent the trend charts of ethylene production changes on different days for samples 1 to 8 respectively.

[0027] Figure 2 This is a graph showing the variation trend of ethylene production in pear fruit samples at different days 9-16 in Example 1 of the present invention;

[0028] Among them, Figure (9)-Figure (16) represent the trend diagrams of ethylene production changes on different days for samples 9-16 respectively.

[0029] Figure 3 This is a graph showing the variation trend of ethylene production of pear fruit samples at different days 17-24 in Example 1 of the present invention;

[0030] Among them, Figure (17)-Figure (24) represent the trend diagrams of ethylene production changes on different days for samples 17-24 respectively.

[0031] Figure 4 These are the electrophoresis results of the pear fruit samples 1-24 in Example 1 of the present invention. DETAILED DESCRIPTION

[0032] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0033] Example 1

[0034] 1. Collect ripe pear samples and test ethylene production

[0035] Mature pears were collected as samples to be tested. There were 24 samples in total, marked with serial numbers 1, 2, 3, 4...23, 24 (1. Rentou, 2. Gengtouqing, 3. Xizilu, 4. Cuiguan, 5. Huali No. 1, 6. Wanxiu Mansoo, 7. Xingao Niitaka, 8. Qingsong, 9. Baiyu, 10. Sanhua, 11. Huaihua Xiangshui, 12. Xipi Xijiangwu, 13. Dali Torch, 14. Lotus, 15. Xianghuali, 16. Bayuexue, 17. Hanyuan Zhaobaoli, 18. Houzuili, 19. Longquan No. 10, 20. Meitan Papaya, 21. Jizixiao, 22. Xingyi Haizi, 23. Huishui Jingai, 24. Shuaili). We tested the ethylene production of all samples and used the ethylene production trend of the samples on different days to determine whether the samples had ethylene jumps.

[0036] The results show: Figure 1 The following are the test results of ethylene production of samples 1-8. Figure 1 From the variation trend of ethylene production in different samples, it can be seen that the ethylene production in samples 1-8 tends to be stable, and no ethylene jump occurs, that is, samples 1-8 are judged as non-ethylene jump;

[0037] Figure 2 The ethylene production test results of samples 9-16 are as follows: Figure 2From the changing trend of ethylene production of different samples, it can be seen that the ethylene production of samples 9-16 has a jump, that is, samples 9-16 are judged to be ethylene jumps.

[0038] Figure 3 The ethylene production test results of samples 17-24 are as follows: Figure 3 From the changing trend of ethylene production of different samples, it can be seen that the ethylene production of samples 17-24 has a jump, that is, samples 17-24 are judged to be ethylene jumps.

[0039] 2. Validation of molecular markers associated with ethylene transitions in pear fruit

[0040] When counting the fruit traits of a pear hybrid population, the inventors found that when the upstream gene that inhibits the expression of the target gene is not expressed, the pear fruit still has a non-respiratory climacteric trait. After resequencing the hybrid population, it was found that a 3.8Kb deletion on the chromosome can also lead to the production of a non-respiratory climacteric trait. The present invention provides a molecular marker related to ethylene climacteric in pear fruit, which is characterized by the following insertion / deletion length polymorphism of the nucleotide sequence;

[0041]

[0042]

[0043]

[0044] (shown in SEQ D NO.4);

[0045] The steps for detecting the ethylene transition trait of pear fruit using the above molecular markers are as follows:

[0046] 1. Extract pear genomic DNA from the above 24 samples;

[0047] 2. Since the obtained insertion / deletion sequence is too long (about 3.8K bp), the cloning process is relatively complicated and prone to mutation. Therefore, according to the genome resequencing results, the present invention selects three relatively conservative regions located before the insertion / deletion, on the insertion / deletion, and after the insertion / deletion to design forward primer F and reverse primers R1 and R2;

[0048] The nucleotide sequence of the forward primer F is shown in SEQ ID NO.1, the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer R2 is shown in SEQ ID NO.3;

[0049] SEQ ID NO.1: CGCTATTCCTCAACGTGTTAAGAT;

[0050] SEQ ID NO.2: GAATGGCAATGGATATTGACTCAT;

[0051] SEQ ID NO. 3: TGTTCAGCTTATAAATCTTCATTTGAAG.

[0052] Using the primer pairs shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, PCR amplification was performed on all the pear genomic DNA samples to be tested and the length of the amplified fragment was detected. The amplification system was: DNA template 0.5 μL, forward primer F1 1 μL, reverse primer R1 1 μL, reverse primer R2 1 μL, 2×ExTaqTM 5 μL, RNase Free water 2.5 μL;

[0053] The amplification program was as follows: 95.0°C, 3 min; 95.0°C, 30 s, 60.0°C, 30 s, 72.0°C, 30 s, 30 cycles; 72.0°C, 5 min; 4.0°C, pluse;

[0054] 3. Result judgment

[0055] The results are as follows Figure 3 As shown, when the amplified fragment is 219bp, it shows non-ethylene transition, when the amplified fragment is 430bp, it shows ethylene transition, and when the amplified fragment is 219bp and 430bp, the molecular marker site of the pear to be tested is heterozygous, showing ethylene transition.

[0056] The nucleotide sequence of 219 bp is as follows:

[0057]

[0058] The nucleotide sequence of 430 bp is as follows:

[0059]

[0060] We found that the results of the changes in ethylene production were consistent with the results determined by molecular markers in the present invention. The present invention provides a molecular marker related to ethylene transitions in pear fruits, which can accurately determine the occurrence of ethylene transitions in pear fruits by detecting the molecular marker, and can quickly and accurately determine the maturity of pear fruits. This can be used for storage management of pear fruits, and can avoid waste of resources and misjudgment of fruits.

[0061] It should be noted that, in order to avoid redundancy, the preferred embodiments of the present invention are described, but once those skilled in the art know the basic creative concept, they can make other changes and modifications to these embodiments. Therefore, the attached claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0062] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A primer pair for detecting molecular markers associated with ethylene transition in pear fruit, characterized in that: The nucleotide sequence of the forward primer F of the primer pair is shown in SEQ ID NO. 1, the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO. 2, and the nucleotide sequence of the reverse primer R2 is shown in SEQ ID NO.

3.

2. Use of the primer pair according to claim 1 in detecting whether pear fruit exhibits ethylene climacteric.

3. A kit, characterized in that: Comprising the primer pair described in claim 1.

4. Use of the kit according to claim 3 in detecting whether pear fruit exhibits ethylene climacteric.

5. A method for detecting ethylene transition characteristics of pear fruit, characterized in that: The method comprises the following steps: using the primers described in claim 1 to perform PCR amplification on the genomic DNA of the pear to be tested and detecting the length of the amplified fragment; when the amplified fragment is 219 bp, it shows a non-ethylene transition; when the amplified fragment is 430 bp, it shows an ethylene transition; when the amplified fragment is 430 bp and 219 bp, the molecular marker site of the pear to be tested is heterozygous, showing an ethylene transition.

6. The method for detecting ethylene climacteric traits in pear fruit according to claim 5, characterized in that: The length of the amplified fragment was checked by agarose gel electrophoresis.

Images