Leucine dehydrogenase mutants and their applications in the synthesis of chiral nitrogen heterocyclic amines

Abstract

The present invention discloses a leucine dehydrogenase mutant and its application in the synthesis of chiral nitrogen heterocyclic amines, belonging to the technical fields of enzyme engineering and microbial engineering. The present invention provides a leucine dehydrogenase mutant, wherein the leucine dehydrogenase mutant is obtained by mutating one or more amino acids in the 49th, 303rd, 307th, and 143rd positions of the leucine dehydrogenase of the amino acid sequence as shown in SEQ ID NO.1. Using N-Boc-4-acetylpiperidine as a substrate, four-point mutant L49G / V303A / L307A / T143A is used to synthesize (R)-4-aminoethyl-1-Boc-piperidine, and at a substrate concentration of 50mmol / L, the substrate conversion rate of the reaction reaches 99%, and the ee value of the product (R)-4-aminoethyl-1-Boc-piperidine reaches 99%.

Description

Technical Field

[0001] The invention relates to a leucine dehydrogenase mutant and application thereof in the synthesis of chiral nitrogen heterocyclic amines, belonging to the technical fields of enzyme engineering and microbial engineering. Background Art

[0002] Nitrogen-containing structural motifs, including chiral amino groups and nitrogen heterocycles, are key components in natural products, bioactive compounds, and active pharmaceutical ingredients. Chiral nitrogen heterocyclic amines containing both of these key components are structural building blocks and synthetic intermediates for a large number of enzyme inhibitors and enzyme modulators, such as somatostatin modulators, CC chemokine receptor 8 (CCR8) inhibitors, and enhancer of epidermal homolog 2 (EZH2) inhibitors, which are used to treat digestive diseases, Alzheimer's disease, and cancer, respectively. Figure 1 ).

[0003] At present, the commonly used chemical synthesis methods of chiral amines in industry include the resolution of racemic amines, asymmetric reductive amination of carbonyl groups, asymmetric hydrogenation of imines, CH bond amination and asymmetric nucleophilic addition of C=N double bonds, etc. Although the traditional chemical method is relatively mature, it often requires the use of special toxic solvents and chiral ligands, and the reaction operation is complicated, there are many by-products, and the environmental pollution is serious. It is difficult to meet the current green biomanufacturing concept and the needs of sustainable development. Therefore, it is urgent to develop new green and efficient synthesis methods.

[0004] With the rapid development of related biotechnologies such as molecular biology, bioinformatics and synthetic biology, the synthesis of chiral amine compounds mediated by biological methods has become an effective alternative to traditional chemical synthesis. At present, four biocatalytically mediated chiral amine synthesis pathways have been widely studied, namely, kinetic resolution of racemic amines, asymmetric reduction of imines, asymmetric amino transfer and asymmetric reductive amination of prochiral ketones. The biocatalytic enzymes involved are lipase, imine reductase, transaminase and amine dehydrogenase.

[0005] Among them, amine dehydrogenase is a class of NAD(P)H coenzyme-dependent oxidoreductases. The reaction pathway of asymmetric reductive amination of prochiral ketones with free ammonia to prepare chiral amines catalyzed by amine dehydrogenase has the advantages of low cost, high atomic utilization, and only water as a byproduct, which meets the current green biomanufacturing concept and the needs of sustainable development. The optical purity (ee value) of the chiral amine product can reach 99%. Therefore, the asymmetric reductive amination reaction of prochiral ketones catalyzed by amine dehydrogenase is an attractive method for producing high value-added chiral nitrogen heterocyclic amines ( Figure 2). However, both the natural amine dehydrogenase obtained by genome mining technology and the engineered amine dehydrogenase developed by directed evolution can only achieve asymmetric reductive amination of a series of simple aliphatic ketones, alicyclic ketones and aromatic ketones. According to literature research, there is no reported case of preparing chiral nitrogen heterocyclic amines based on the asymmetric reductive amination of prochiral nitrogen heterocyclic ketones catalyzed by amine dehydrogenase.

[0006] Therefore, it is urgent to modify the substrate specificity of existing amine dehydrogenases for prochiral nitrogen heterocyclic ketones in order to achieve the biosynthesis of chiral nitrogen heterocyclic amines catalyzed by amine dehydrogenases. Summary of the invention

[0007] The technical problem to be solved by the present invention is to provide one or more leucine dehydrogenase mutants capable of biocatalytically synthesizing a series of chiral nitrogen heterocyclic amines with industrial application value.

[0008] The present invention provides a leucine dehydrogenase mutant, wherein the leucine dehydrogenase mutant is obtained by mutating one or more amino acids at positions 49, 303, 307 and 143 of the leucine dehydrogenase whose amino acid sequence is shown in SEQ ID NO.1.

[0009] SEQ ID NO.1:

[0010] MVETNVEARF SIFETMAMED YEQVVFCHDK VSGLKAIIAI HDTTLGPALG GLRMWNYASD

[0011] EEALIDALRL AKGMTYSNAA AGLNLGGGKA VIIGDAKTQK SEALFRAFGR YVQSLNGRYI

[0012] TAEDVNTTVA DMDYIHMETD FVTGVSPAFG SSGNPSPVTA YGVYRGMKAA AKEVYGTDSL

[0013] GGKTVAIQGV GNVAFNLCRH LHEEGAKLIV TDINQDALRR AEEAFGALVV GPDEIYSVDA

[0014] DIFAPCALGA TLNDETIPQL KVKIIAGAAL NQLKEDRHGD MLQERGILYT PDFVINAGGV

[0015] INVADELDGY NRERAMKKVE LVYDAVAKVI EIAKRDHLPT YRAAEKMAEE RIATMGSARS

[0016] QFLRRDKNIL GSRG

[0017] In one embodiment of the present invention, the nucleotide sequence encoding leucine dehydrogenase is shown as SEQ ID NO.2.

[0018] SEQ ID NO.2:

[0019] atggttgaaa caaacgtaga agcacgattc agtattttcg aaacgatggc aatggaagat

[0020] tacgaacaag tcgtattttg tcacgataaa gtctcaggat taaaggcgat tatcgcgatt

[0021] catgatacga cactcggacc agcactcggc ggactccgta tgtggaacta tgcgtctgac

[0022] gaggaagcat tgatcgacgc gcttcgtttg gcaaaaggca tgacgtattc taatgcggca

[0023] gccggtctga accttggcgg cgggaaagcg gtcatcatcg gtgatgcgaa aacgcaaaaa

[0024] tcagaagctc tgttccgtgc attcggtcgt tacgtacagt cgttaaacgg acgttacatc

[0025] actgcggaag acgtcaacac aacagtcgcc gacatggatt atatccacat ggaaacagac

[0026] ttcgtaaccg gtgtcagccc ggcattcgga tcaagcggca atccgtcacc agtcacggct

[0027] tatggcgttt accgcggaat gaaggcagcc gctaagag tatatggcac agatcactc

[0028] ggaggaaaaa cagttgcgat tcaggtgtt ggtaacgttg ctttcaacct atgccgtcac

[0029] ttgcatgaag aaggcgcaaa attgattgtc acagacatca atcagatgc attacgccgt

[0030] gcagaagaag cgtttggcgc tctcgtcgtc ggaccggatg aaatttacag cgtcgatgcc

[0031] gatatctttg cgccgtgtgc cttaggtgcg acatgaacg atgagacgat tccacactg

[0032] aaagtgaaaa tcattgccgg agcagcactc aaccaacctca aagagatcg tcacggagat

[0033] atgctccagg aacgcggtat attacks ccggactcg tcatcaacgc aggaggtgtc

[0034] atcaatgtgg cgacgaact cgacgggtac aaccgtgagc gggcgatgaa aaagtcgaa

[0035] ctcgtctatg atgcggtagc aaagtcatc gaaattgcca aacgtgacca tctgccgact

[0036] taccggggcag cagagagat ggcagaagaa cggatcgcga caatgggcag tgcccgcagc

[0037] cagttcttac gccgggataa aaacatttta ggatcacgcg gttaa

[0038] In one embodiment of the present invention, the leucine dehydrogenase mutant is obtained by mutating the leucine at position 49 of the leucine dehydrogenase shown in the amino acid sequence of SEQ ID NO.1 to glycine, and is named: L49G;

[0039] In one embodiment of the present invention, the amino acid sequence of the leucine dehydrogenase shown in SEQ ID NO.1 is obtained by mutating the valine at position 303 to alanine, which is named: V303A;

[0040] In one embodiment of the present invention, the amino acid sequence of the leucine dehydrogenase shown in SEQ ID NO.1 is mutated to alanine at position 307, which is named: L307A;

[0041] In one embodiment of the present invention, the amino acid sequence of leucine dehydrogenase as shown in SEQ ID NO.1 is obtained by mutating the threonine at position 143 to alanine, which is named as: T143A;

[0042] In one embodiment of the present invention, the amino acid sequence of the leucine dehydrogenase at position 49 as shown in SEQ ID NO.1 is mutated to glycine, and the amino acid sequence of the leucine dehydrogenase at position 303 as shown in SEQ ID NO.1 is mutated to alanine, and the result is named: L49G / V303A;

[0043] In one embodiment of the present invention, the amino acid sequence of the leucine dehydrogenase at position 49 as shown in SEQ ID NO.1 is mutated to glycine, the amino acid sequence of the leucine dehydrogenase at position 303 as shown in SEQ ID NO.1 is mutated to alanine, and the amino acid sequence of the leucine dehydrogenase at position 143 as shown in SEQ ID NO.1 is mutated to alanine, and the result is named: L49G / V303A / T143A;

[0044] In one embodiment of the present invention, the amino acid sequence of the leucine dehydrogenase at position 49 as shown in SEQ ID NO.1 is mutated to glycine, the amino acid sequence of the leucine dehydrogenase at position 303 as shown in SEQ ID NO.1 is mutated to alanine, and the amino acid sequence of the leucine dehydrogenase at position 307 as shown in SEQ ID NO.1 is mutated to alanine, and the result is named: L49G / V303A / L307A;

[0045] In one embodiment of the present invention, the leucine at position 49 of the leucine dehydrogenase as shown in the amino acid sequence of SEQ ID NO.1 is mutated to glycine, the valine at position 303 of the leucine dehydrogenase as shown in the amino acid sequence of SEQ ID NO.1 is mutated to alanine, the leucine at position 307 of the leucine dehydrogenase as shown in the amino acid sequence of SEQ ID NO.1 is mutated to alanine, and the threonine at position 143 of the leucine dehydrogenase as shown in the amino acid sequence of SEQ ID NO.1 is mutated to alanine, and the obtained protein is named: L49G / V303A / L307A / T143A.

[0046] The present invention also provides a gene encoding the mutant or a recombinant vector carrying the gene.

[0047] The present invention also provides a recombinant cell expressing the mutant or carrying the gene or the recombinant vector.

[0048] In one embodiment of the present invention, the recombinant cell uses bacteria or fungi as expression hosts.

[0049] The present invention also provides a recombinant enzyme catalyst containing the above-mentioned leucine dehydrogenase mutant sequence, wherein the catalyst is in any one of the following forms:

[0050] (1) culturing the recombinant expression transformant and isolating transformant cells containing the recombinase;

[0051] (2) culturing the recombinant expression transformant, isolating transformant cells containing the recombinase, and disrupting the transformant cells containing the recombinase to obtain a cell disrupted liquid;

[0052] (3) culturing the recombinant expression transformant, isolating transformant cells containing the recombinant enzyme, disrupting the transformant cells containing the recombinant enzyme, obtaining a cell disrupted liquid, and freeze-drying the cell disrupted liquid of the recombinant enzyme to obtain a lyophilized enzyme powder.

[0053] The present invention also provides a method for increasing the activity of leucine dehydrogenase on a substrate, wherein the substrate is an N-heterocyclic ketone;

[0054] The method comprises mutating the leucine at position 49 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 to glycine;

[0055] or mutating the valine at position 303 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 to alanine;

[0056] or mutating the leucine at position 307 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 to alanine;

[0057] or mutating the threonine at position 143 of the leucine dehydrogenase whose amino acid sequence is shown in SEQ ID NO.1 to alanine;

[0058] Or the leucine at position 49 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 is mutated to glycine, and the valine at position 303 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine;

[0059] Or the leucine at position 49 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 is mutated to glycine, the valine at position 303 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine, and the threonine at position 143 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine;

[0060] Or the leucine at position 49 of the leucine dehydrogenase as shown in the amino acid sequence of SEQ ID NO.1 is mutated to glycine, the valine at position 303 of the leucine dehydrogenase as shown in the amino acid sequence of SEQ ID NO.1 is mutated to alanine, and the leucine at position 307 of the leucine dehydrogenase as shown in the amino acid sequence of SEQ ID NO.1 is mutated to alanine.

[0061] Or the leucine at position 49 of the leucine dehydrogenase as shown in the amino acid sequence of SEQ ID NO.1 is mutated to glycine, the valine at position 303 of the leucine dehydrogenase as shown in the amino acid sequence of SEQ ID NO.1 is mutated to alanine, the leucine at position 307 of the leucine dehydrogenase as shown in the amino acid sequence of SEQ ID NO.1 is mutated to alanine, and at the same time, the threonine at position 143 of the leucine dehydrogenase as shown in the amino acid sequence of SEQ ID NO.1 is mutated to alanine.

[0062] In one embodiment of the present invention, the structural formula of the N-heterocyclic ketone is:

[0063] Wherein m = 1 or 2, n = 1, 2 or 3, R = tert-butyloxybenzyl, benzyl or benzyloxycarbonyl.

[0064] In one embodiment of the present invention, the structural formula of the N-heterocyclic ketone includes but is not limited to:

[0065]

[0066] The present invention also provides the use of the leucine dehydrogenase mutant or the recombinant cell or the recombinant enzyme catalyst in catalyzing the reduction of substrate N-heterocyclic ketone to prepare chiral nitrogen heterocyclic amine.

[0067] In one embodiment of the present invention, the structural formula of the N-heterocyclic ketone is:

[0068] Wherein m = 1 or 2, n = 1, 2 or 3, R = tert-butyloxybenzyl, benzyl or benzyloxycarbonyl.

[0069] In one embodiment of the present invention, the structural formula of the N-heterocyclic ketone includes but is not limited to:

[0070]

[0071] In one embodiment of the present invention, the application is to add the phenylalanine amine dehydrogenase mutant or the recombinant cell or the recombinant enzyme catalyst to a medium containing glucose dehydrogenase, NAD + , N-heterocyclic ketone and glucose to prepare chiral nitrogen heterocyclic amine.

[0072] In one embodiment of the present invention, the reaction system further contains NH4Cl / NH4OH buffer.

[0073] In one embodiment of the present invention, the glucose dehydrogenase is derived from Bacillus amyloliquefaciens.

[0074] In one embodiment of the present invention, the reaction system volume is 1L, comprising wet bacteria (40g) of the above mutant enzyme, wet bacteria expressing GluDH (48g), N-Boc-4-acetylpiperidine (50mmol / L), glucose (60mmol / L), NAD + (0.1 mmol / L), NH4Cl / NH4OH buffer (2 mol / L, pH 8.5). The reaction mixture was reacted at 30°C and 200 rpm.

[0075] The present invention also provides the mutant or the gene or the recombinant vector or the recombinant cell or the recombinant enzyme catalyst or the method or the application of the method in the fields of food, biomaterials, medicine, additives or cosmetics.

[0076] Beneficial Effects

[0077] (1) The catalytic activity was determined using N-Boc-4-acetylpiperidine as the substrate. The wild-type leucine dehydrogenase showed no measurable catalytic activity, while the double-point mutant L49G / V303A had a catalytic activity of 7.2 U / g, successfully achieving a transformation from no catalytic activity to a significant one.

[0078] (2) The catalytic activity of the optimal quadruple-point mutant L49G / V303A / L307A / T143A was determined using N-Boc-4-acetylpiperidine as the substrate. The catalytic activity reached 837.4 U / g, which was 116.3 times that of the double-point mutant L49G / V303A.

[0079] (3) The four-point mutant L49G / V303A / L307A / T143A has broad substrate specificity and can catalyze the asymmetric reductive amination reactions of a series of structurally diverse prochiral nitrogen heterocyclic ketones S1-S10, with specific catalytic activities of 606.3, 1162.5, 837.4, 1015.2, 524.7, 589.3, 247.1, 312.5, 1009.3 and 1018.6 U / g, respectively.

[0080] (4) Chiral nitrogen heterocyclic amines P1-P10 were synthesized using the four-point mutants L49G / V303A / L307A / T143A using prochiral nitrogen heterocyclic ketones S1-S10 as substrates. At a substrate concentration of 10 mmol / L, the substrate conversion rates of the reactions were 99%, 99%, 99%, 99%, 92%, 97%, 44%, 68%, 99%, and 99%, respectively. The ee values ​​of the products P1-P10 all reached 99%.

[0081] (5) Using N-Boc-4-acetylpiperidine as the substrate, the four-point mutant L49G / V303A / L307A / T143A was used to synthesize (R)-4-aminoethyl-1-Boc-piperidine. At a substrate concentration of 50 mmol / L, the substrate conversion rate of the reaction reached 99%, and the ee value of the product (R)-4-aminoethyl-1-Boc-piperidine reached 99%. BRIEF DESCRIPTION OF THE DRAWINGS

[0082] Figure 1 : Examples of drugs containing chiral nitrogen heterocyclic amine building blocks.

[0083] Figure 2 : Asymmetric reductive amination of prochiral ketones by amine dehydrogenase to prepare chiral nitrogen heterocyclic amines.

[0084] Figure 3 : Chemical structural formulas of prochiral azacycloketone substrates S1-S10.

[0085] Figure 4: The conversion rate of S1-S10 catalyzed by leucine dehydrogenase and the four-point mutant L49G / V303A / L307A / T143A whole cells and the ee values ​​of the products P1-P10.

[0086] Figure 5 : Conversion rate of N-Boc-4-acetylpiperidine catalyzed by whole cells of the four-point mutant L49G / V303A / L307A / T143A.

[0087] Figure 6 : ee values ​​of (R)-4-aminoethyl-1-Boc-piperidine synthesized by whole cells of the four-point mutant L49G / V303A / L307A / T143A.

[0088] Figure 7 : The structural formula of chiral nitrogen heterocyclic amines P1-P10. DETAILED DESCRIPTION

[0089] The E. coli BL21 (DE3) involved in the following examples was purchased from Beina Biotechnology, the pET-28a (+) plasmid was purchased from Novagen, glucose dehydrogenase (GluDH) was purchased from Merck, and NAD + , NADH was purchased from Solebow Biotechnology Co., Ltd. (the strain Escherichia coli BL21 (DE3) can be purchased and does not need to be deposited for patent procedures).

[0090] The preparation method of the substrate (S1-S10) solution involved in the following embodiments is: first prepare 2 mol / L, pH 9.5 NH4Cl / NH4OH buffer, and then add the substrates (S1-S10) to the buffer respectively to obtain a substrate solution with a final concentration of 20 m mol / L.

[0091] The culture medium involved in the following examples is as follows:

[0092] LB liquid culture medium: yeast powder 5.0 g / L, tryptone 10.0 g / L, NaCl 10.0 g / L, kanamycin 50 mg / L.

[0093] LB solid medium: yeast powder 5.0 g / L, tryptone 10.0 g / L, NaCl 10.0 g / L, agar powder 20 g / L, kanamycin 50 mg / L.

[0094] The detection methods involved in the following embodiments are:

[0095] Detection of leucine dehydrogenase activity:

[0096] The reductive amination activity was determined by spectrophotometry. Leucine dehydrogenase is an NADH cofactor-dependent enzyme. NADH has a UV absorption peak at 340 nm, so it can be measured by OD 340 The enzyme activity of AmDH was calculated by the change in absorbance at 340 nm. The assay system was 200 μL, including NH4Cl / NH4OH buffer (2 mol / L, pH 9.5), N-heterocyclic ketone substrate (20 m mol / L), NADH (0.2 m mol / L) and appropriate enzyme solution. The change in absorbance at 340 nm was detected at 30°C, and the buffer without substrate was used as a blank control.

[0097] The enzyme activity unit (U) is defined as the enzyme activity that catalyzes the oxidation of 1 μmol NADH per minute under the above conditions; the calculation formula is: enzyme activity (U) = EW × V × 10 3 / (6220×l), EW is the change in absorbance at 340nm per unit time; V is the total volume of the activity assay system (mL); 6220 is the molar extinction coefficient (L / mol / cm); l is the light distance (cm). Enzyme specific activity (mU / mg) is defined as: the number of enzyme activity units per milligram of protein, and the calculation formula is: enzyme specific activity (U / mg) = enzyme activity (U) / protein amount (mg).

[0098] Protein concentration of concentrated enzyme solution

[0099] The protein concentration was determined using a Bradford protein assay kit (for protein concentration determination using a Bradford protein assay kit, refer to: Zhou-Pan XR, E Sérée, Zhou XJ, et al. Involvement of Human Liver Cytochrome P450 3A in Vinblastine Metabolism: Drug Interactions 1 [J]. Cancer Research, 1993, 53 (21): 5121-5126.), and the unit is mg / mL.

[0100] Substrate and product detection methods:

[0101] 1 mL of sample was taken at regular intervals, the sample was quenched with NaOH aqueous solution (200 μL, 10 mol / L), extracted with methyl tert-butyl ether (500 μL, twice), and the conversion rate of N-heterocyclic substrate in the reaction solution was determined by GC-FID (gas chromatography). The determination conditions were: Agilent J&W CP-Chiralsil-DEX CB GC column (25 m×0.32 mm×0.25 μm); the column temperature program was: starting from 90°C, holding for 0 min, increasing to 170°C at 20°C / min, holding for 2 min, then increasing to 200°C at 10°C / min, and holding for 1 min. The ee value of the product chiral N-heterocyclic amine in the reaction solution was determined by GC-FID (gas chromatography) under the following conditions: Agilent J&W CP-Chiralsil-DEX CB GC column (25m×0.32mm×0.25μm); the column temperature program was: starting from 120°C, holding for 0 min, increasing to 160°C at 5°C / min, holding for 2 min, then increasing to 200°C at 1°C / min, and holding for 10 min.

[0102] The reaction formula of the present invention is:

[0103]

[0104] Boc is tert-butyloxybenzyl, Bn is benzyl, and Cbz is benzyloxycarbonyl.

[0105] In the following structural formula, the names of S1-S10 are: N-Boc-3-acetylazetidine, N-Boc-3-acetylpyrrolidine, N-Boc-4-acetylpiperidine, N-Boc-3-acetylpiperidine, N-Bn-4-acetylpiperidine, N-Bn-3-acetylpiperidine, N-Cbz-4-acetylpiperidine, N-Cbz-3-acetylpiperidine, (R)-N-Boc-3-acetylpiperidine, (S)-N-Boc-3-acetylpiperidine; the specific structure is shown below:

[0106]

[0107] Example 1: Preparation of a single mutant containing leucine dehydrogenase

[0108] The specific steps are as follows:

[0109] (1) Chemically synthesizing a gene encoding leucine dehydrogenase LAmDH whose amino acid sequence is shown in SEQ ID NO.1 (the nucleotide sequence of the gene is shown in SEQ ID NO.2);

[0110] (2) Construction of recombinant vector

[0111] Reference can be made to the literature "Chen, FF; Liu, YY; Zheng, GW; Xu, JH, Asymmetric amination of secondary alcohols by using a redox-neutral two-enzyme cascade. ChemCatChem2015, 7(23), 3838-3841."

[0112] Specifically, pET-28a(+) plasmid was used as an expression vector, and the LAmDH gene was connected to the pET-28a(+) plasmid to prepare the recombinant vector pET-28a(+)-LAmDH.

[0113] (3) Preparation of mutants

[0114] 1) Using the recombinant vector pET-28a(+)-LAmDH as a template, L49, V303, L307, T143, L52, N78, I120, and V300 on the LAmDH sequence were mutated to L49G, V303A, L307A, T143A, L52G, N78A, I120A, and V300G, respectively. Targeted mutagenesis was performed using the whole plasmid PCR method.

[0115] The primer sequences involved are as follows:

[0116] The primers used for mutation L49G are as follows:

[0117] L49G-For:CGGACCAGCAGGTGGCGGACTCCGTATG;

[0118] L49G-Rev: CACCTGCTGGTCCGAGTGTCGTATCATGAA;

[0119] The primers used for mutation V303A are as follows:

[0120] V303A-For: CGTCGGCGCCATTGATGACACCTCCTGCGTTG;

[0121] V303A-Rev: CATCAATGGCGCCGACGAACTCGACGGGTACA;

[0122] The primers used for mutation L307A are as follows:

[0123] L307A-For:ACCCGTCGCCTTCGTCGGCCACATTGATGACA;

[0124] L307A-Rev:CGACGAAGGCGACGGGTACAACCGTGAGCGGG;

[0125] The primers used for mutation T143A are as follows:

[0126] T143A-For:CACCGCCTACGAAGTCTGTTTCCATG;

[0127] T143A-Rev:CATGGAAACAGACTTCGTAGGCGGTG;

[0128] The primers used for mutant L52G are as follows:

[0129] L52G-For:GGAGGTCGTATGTGGAACTATGCGTCTGACGA;

[0130] L52G-Rev:TTCCACATACGACCTCCGCCGAGTGCTGGTCC;

[0131] The primers used for mutant N78A are as follows:

[0132] N78A-For:GTATTCTGCCGCGGCAGCCGGTCTGAACCTTG;

[0133] N78A-Rev: CTGCCGCGGCAGAATACGTCATGCCTTTTGCC;

[0134] The primers used for mutant I120A are as follows:

[0135] I120A-For:ACGTTACGCCACTGCGGAAGACGTCAACACAA;

[0136] I120A-Rev: CCGCAGTGGCGTAACGTCCGTTTAACGACTGTACG;

[0137] The primers used for mutant V300G are as follows:

[0138] V300G-For: AGGAGGTGGTATCAATGTGGCCGACGAAC;

[0139] V300G-Rev:CATTGATACCACCTCCTGCGTTGATGACG.

[0140] 2) PCR reaction was carried out in 50 μL system, and the reaction conditions were: 94°C pre-denaturation for 4 min; then 30 cycles: 98°C denaturation for 10 s, 55°C annealing for 5 s, 72°C extension for 5 min; finally 72°C extension for 10 min, and 4°C insulation.

[0141] The PCR amplification product was detected by 1% agarose gel electrophoresis. After the detection, 0.5 μL of methylated template digestion enzyme (Dpn I) was added to 10 μL of the amplification product, and the mixture was mixed by blowing and suction with the pipette tip. The reaction was carried out at 37°C for 1.5 hours. The amplification product treated with Dpn I was transformed into Escherichia coli BL21 (DE3), and the transformation product was spread on LB solid culture medium and cultured at 37°C for 8 to 10 hours. 20 transformants were picked from the LB solid culture medium and inoculated into LB liquid culture medium for culture. After culturing at 37°C for 10 hours, the plasmid was extracted and sequenced. If the sequencing was correct, the recombinant Escherichia coli containing the gene encoding the mutant was obtained.

[0142] The recombinant strains were prepared respectively: BL21 / pET-28a(+)-L49G, BL21 / pET-28a(+)-V303A, BL21 / pET-28a(+)-L307A, BL21 / pET-28a(+)-T143A, BL21 / pET-28a(+)-L52G, BL21 / pET-28a(+)-N78A, BL21 / pET-28a(+)-I120A, BL21 / pET-28a(+)-V300G, and BL21 / pET-28a(+)-LAmDH.

[0143] 3) Spread the recombinant E. coli on LB solid culture medium, culture at 37°C for 8-10 hours to obtain single colonies; pick single colonies and inoculate them into LB liquid culture medium, culture at 37°C and 200 rpm for 6-8 hours to obtain seed solution; inoculate the seed solution into LB liquid culture medium at an inoculation amount of 2% (v / v), culture at 37°C and 200 rpm for 2-3 hours, add IPTG with a final concentration of 0.1 mmol / L to the fermentation liquid, continue induction culture at 17°C and 200 rpm for 12-16 hours to obtain fermentation liquid; centrifuge the fermentation liquid at 4°C and 8000 rpm for 5 minutes, discard the supernatant, and wash the precipitate twice with 9% physiological saline to obtain wet cells;

[0144] The wet cells were resuspended in buffer A (100 mmol / L Tris, 150 mmol / L NaCl, 20 mmol / L imidazole, pH 7.5) and ultrasonically disrupted, and centrifuged at 10000 rpm and 4°C for 30 min to obtain a crude enzyme solution;

[0145] Crude enzyme solutions containing mutants were prepared respectively: L49G, V303A, L307A, T143A, L52G, N78A, I120A, and V300G.

[0146] Example 2: Preparation of double mutants, triple mutants and quadruple mutants containing leucine dehydrogenase

[0147] The specific steps are as follows:

[0148] (1) Construction of double mutants

[0149] The construction of L49G / V303A, L49G / L307A, L49G / N78A, and L49G / V300G mutants was the same as in Example 1. Taking the preparation of L49G / V303A mutant as an example, pET-28a(+)-L49G was used as a template, and the relevant primers in Example 1 were used to mutate the above-mentioned sites according to the method of Example 1; the methods for other mutation sites were the same.

[0150] According to the method of Example 1, recombinant cells containing mutants were prepared: BL21 / pET-28a(+)-L49G / V303A, BL21 / pET-28a(+)-L49G / L307A, BL21 / pET-28a(+)-L49G / N78A, and BL21 / pET-28a(+)-L49G / V300G.

[0151] At the same time, crude enzyme solutions containing the following mutants were prepared: L49G / V303A, L49G / L307A, L49G / N78A, and L49G / V300G.

[0152] (2) Construction of triple mutants

[0153] The construction of L49G / V303A / T143A, L49G / V303A / L52G, and L49G / V303A / L307A mutants was the same as in Example 1. Taking the preparation of L49G / V303A / T143A mutant as an example, pET-28a(+)-L49G / V303A was used as a template, and the relevant primers in Example 1 were used to mutate the above-mentioned sites according to the method of Example 1; the methods for other mutation sites were the same.

[0154] According to the method of Example 1, recombinant cells containing mutants were prepared: BL21 / pET-28a(+)-L49G / V303A / T143A, BL21 / pET-28a(+)-L49G / V303A / L52G, and BL21 / pET-28a(+)-L49G / V303A / L307A.

[0155] At the same time, crude enzyme solutions containing the following mutants were prepared: L49G / V303A / T143A, L49G / V303A / L52G, and L49G / V303A / L307A.

[0156] (3) Construction of quadruple mutants

[0157] The construction of the L49G / V303A / L307A / T143A mutant was the same as in Example 1, using pET-28a(+)-L49G / V303A / L307A as a template and the relevant primers in Example 1 to mutate the above sites according to the method of Example 1.

[0158] According to the method of Example 1, a recombinant cell containing the mutant was prepared: BL21 / pET-28a(+)-L49G / V303A / L307A / T143A.

[0159] At the same time, a crude enzyme solution containing the following mutants was prepared: L49G / V303A / L307A / T143A.

[0160] Example 3: Purification and enzyme activity characterization of leucine dehydrogenase mutants

[0161] The specific steps are as follows:

[0162] 1. Protein purification

[0163] The crude enzyme solutions prepared in Example 1 and Example 2 were purified by the following method:

[0164] After filtering with a 0.22um water filter membrane, slowly load the sample onto the Ni-NAT affinity chromatography column. After loading, wash with buffer A first, then gradient elute with buffer B (100mmol / L Tris, 150mmol / L NaCl, 500mmol / L imidazole, pH 7.5), collect the elution peak corresponding to 300mmol / L imidazole to obtain pure enzyme solution.

[0165] Pure enzyme solutions containing the following mutants were prepared respectively: L49G, V303A, L307A, T143A, L52G, N78A, I120A, V300G, L49G / V303A, L49G / L307A, L49G / N78A, L49G / V300G, L49G / V303A / T143A, L49G / V303A / L52G, L49G / V303A / L307A, L49G / V303A / L307A, and pure enzyme solution containing wild-type LAmDH.

[0166] 2. Calculation of specific activity of pure enzyme solution of mutant

[0167] The activity was evaluated using N-Boc-4-acetylpiperidine and N-tert-butyl-4-acetylpiperidine as substrates;

[0168] The enzyme activity was calculated according to the detection method of leucine dehydrogenase activity, and the specific activity (enzyme activity / protein concentration, the unit is U / g) was calculated.

[0169] Specifically: in NH4Cl / NH4OH buffer (2 mol / L, pH 9.5) were added with N-Boc-4-acetylpiperidine (20 mmol / L) and NADH (0.2 mmol / L) to obtain a reaction system; the reaction system was kept at 30°C for 2 min, and then 20 uL of concentrated pure enzyme (final concentration was 0.5 mg / mL) was added to start the reaction; the reaction was carried out at 30°C for 5 min, and the absorbance change at 340 nm was recorded every 10 s; the catalytic activity of the mutant to N-Boc-4-acetylpiperidine was obtained; catalytic activity (U / mg) = Ew × V / 6220 / L × protein concentration of concentrated enzyme solution; wherein Ew is the absorbance change value at 340 nm within 1 min; V is the volume of the enzyme activity assay reaction system, in mL, which is 0.2 here; 6200 is the molar extinction coefficient, in L / mol / cm; L is the optical path distance, in cm, which is 0.5 here; the value is the average of three separate measurements.

[0170] (1) The data results of the enzyme activity of single-point mutants are shown in Table 1.

[0171] Table 1: Specific activity of mutants for substrates N-Boc-4-acetylpiperidine and N-tert-butyl-4-acetylpiperidine (unit: U / g)

[0172]

[0173] The results showed that the wild-type LAmDH had no measurable catalytic activity towards N-Boc-4-acetylpiperidine (<0.1U / g); all single-point mutants had no measurable catalytic activity towards the target substrate N-Boc-4-acetylpiperidine (S3), but the mutant L49G produced a specific catalytic activity of 236.1U / g towards N-tert-butyl-4-acetylpiperidine with a smaller molecular size.

[0174] (2) Calculation of specific activity of pure enzyme solutions of double mutants, triple mutants and quadruple mutants

[0175] The activity was evaluated using N-Boc-4-acetylpiperidine as a substrate. The enzyme activity was calculated according to the detection method of leucine dehydrogenase activity, and the specific activity (enzyme activity / protein concentration, unit is U / g) was calculated. The values ​​are the average values ​​of three separate determinations, and the results are shown in Table 2.

[0176] Table 2: Specific activity of mutants for target substrate N-Boc-4-acetylpiperidine

[0177]

[0178] The results showed that the catalytic activity of the double-point mutant L49G / V303A towards N-Boc-4-acetylpiperidine was 7.2 U / g; the catalytic activities of the triple mutants L49G / V303A / T143A and L49G / V303A / L307A were 40.3 U / g and 94.6 U / g respectively; the catalytic activity of the quadruple-point mutant L49G / V303A / L307A / T143A towards N-Boc-4-acetylpiperidine was 837.4 U / g.

[0179] Example 4: Prochiral azacycloketone substrate range of mutants L49G / V303A, L49G / V303A / L307A / T143A

[0180] The specific steps are as follows:

[0181] (1) Prochiral azacycloketone substrates S1-S10 (20 mmol / L) (structures such as Figure 3 ) and NADH (0.2mmol / L) to obtain a reaction system;

[0182] (2) The reaction system was kept at 30° C. for 2 min, and then 20 μL of concentrated pure enzymes of wild-type LAmDH and mutants L49G / V303A and L49G / V303A / L307A / T143A (final concentration 0.5 mg / mL) obtained in Example 4 were added to start the reaction;

[0183] (3) The reaction was allowed to proceed at 30°C for 5 min, and the absorbance change at 340 nm was recorded every 10 s;

[0184] The catalytic activities of wild-type LAmDH and mutants L49G / V303A and L49G / V303A / L307A / T143A towards prochiral azacycloketone substrates S1-S10 were obtained;

[0185] Catalytic activity (U / mg) = Ew × V / 6220 / L × protein concentration of concentrated enzyme solution;

[0186] Wherein, Ew is the absorbance change at 340 nm within 1 min; V is the volume of the enzyme activity assay reaction system, in mL, which is 0.2 here; 6200 is the molar extinction coefficient, in L / mol / cm; L is the optical path distance, in cm, which is 0.5 here;

[0187] The result is:

[0188] Wild-type LAmDH has no measurable catalytic activity (<0.1 U / g) towards prochiral azacyclic ketone substrates S1-S10;

[0189] The specific catalytic activities of the double-point mutant L49G / V303A towards the prochiral azacycloketone substrates S1-S10 were 5.3, 9.9, 7.2, 7.6, 0, 0, 0, 0, 7.8, and 7.7 U / g, respectively;

[0190] The four point mutants L49G / V303A / L307A / T143A all showed measurable catalytic activity towards the prochiral azacyclic ketone substrates S1-S10, with specific catalytic activities of 606.3, 1162.5, 837.4, 1015.2, 524.7, 589.3, 247.1, 312.5, 1009.3 and 1018.6 U / g, respectively.

[0191] Example 5: Analytical-scale synthesis of chiral nitrogen heterocyclic amines P1-P10 by asymmetric reductive amination of wild-type LAmDH and four-point mutants L49G / V303A / L307A / T143A

[0192] Wild-type LAmDH and the four-point mutant L49G / V303A / L307A / T143A were used to synthesize chiral nitrogen heterocyclic amines P1-P10 ( Figure 7 ); the names of P1-P10 are: (R)-3-aminoethyl-1-Boc-azetidine, (R)-3-aminoethyl-1-Boc-pyrrolidine, (R)-4-aminoethyl-1-Boc-piperidine, (R)-3-aminoethyl-1-Boc-piperidine, (R)-4-aminoethyl-1-Bn-piperidine, (R)-3-aminoethyl-1-Bn-piperidine, (R)-4-aminoethyl-1-Cbz-piperidine, (R)-3-aminoethyl-1-Cbz-piperidine, (R,R)-4-aminoethyl-1-Boc-piperidine, (R,S)-4-aminoethyl-1-Boc-piperidine;

[0193] The specific steps are as follows:

[0194] (1) Preparation of wet cells

[0195] The recombinant Escherichia coli BL21 / pET-28a(+)-LAmDH, BL21 / pET-28a(+)-L49G / V303A / L307A / T143A prepared in Examples 1 to 2 and the cells expressing GluDH purchased from Sigma-Aldrich were respectively spread on LB solid culture medium and cultured at 37°C for 8 to 10 hours to obtain single colonies; single colonies were picked and inoculated into LB liquid culture medium, and cultured at 37°C and 200 rpm for 6 to 8 hours to obtain seed solutions;

[0196] The seed solution was inoculated into LB liquid medium at an inoculation rate of 2% (v / v), and cultured at 37° C. and 200 rpm for 2 to 3 hours. IPTG with a final concentration of 0.1 mmol / L was added to the fermentation liquid, and the induction culture was continued at 17° C. and 200 rpm for 12 to 17 hours to obtain fermentation liquids.

[0197] The fermentation broth was centrifuged at 4°C and 8000 rpm for 5 min, the supernatant was discarded, and the precipitate was washed twice with 9% saline to obtain wet cells:

[0198] (2) The reaction system volume was 20 mL, which contained the L49G / V303A / L307A / T143A wet cells (20 g) obtained in step (1), GluDH wet cells (24 g), S1-S10 (10 mmol / L), glucose (12 mmol / L), NAD + (0.1mmol / L), NH4Cl / NH4OH buffer (2mol / L, pH 8.5).

[0199] The reaction mixture was reacted at 30°C and 200 rpm for 24 h.

[0200] The result is:

[0201] The substrate conversion rates of 10mmol / L S1-S10 catalyzed by the four-point mutant L49G / V303A / L307A / T143A were 99%, 99%, 99%, 99%, 92%, 97%, 44%, 68%, 99%, 99%, and 99%, respectively, and the ee values ​​of the products P1-P10 all reached 99%;

[0202] However, wild-type LAmDH cannot catalyze S1-S10 to generate the corresponding P1-P10 ( Figure 4 ).

[0203] Example 6: Preparative-scale synthesis of (R)-4-aminoethyl-1-Boc-piperidine by asymmetric reductive amination of the four-point mutant L49G / V303A / L307A / T143A

[0204] The leucine dehydrogenase quadruple mutant L49G / V303A / L307A / T143A was coupled with glucose dehydrogenase (GluDH) and N-Boc-4-acetylpiperidine was used as substrate to prepare (R)-4-aminoethyl-1-Boc-piperidine.

[0205] The specific steps are as follows:

[0206] (1) Preparation of wet cells

[0207] The recombinant Escherichia coli BL21 / pET-28a(+)-LAmDH, BL21 / pET-28a(+)-L49G / V303A / L307A / T143A prepared in Examples 1 to 2, and cells expressing GluDH purchased from Sigma-Aldrich were respectively spread on LB solid culture medium and cultured at 37°C for 8 to 10 hours to obtain single colonies; a single colony was picked and inoculated into LB liquid culture medium, and cultured at 37°C and 200 rpm for 6 to 8 hours to obtain a seed solution;

[0208] The seed solution was inoculated into LB liquid medium at an inoculation rate of 2% (v / v), and cultured at 37°C and 200 rpm for 2-3 hours, and IPTG with a final concentration of 0.1 mmol / L was added to the fermentation liquid, and the induction culture was continued at 17°C and 200 rpm for 12-17 hours to obtain a fermentation liquid;

[0209] The fermentation liquid was centrifuged at 4°C and 8000 rpm for 5 min, the supernatant was discarded, and the precipitate was washed twice with 9% saline to obtain wet cells:

[0210] (2) The reaction system volume was 1 L, which contained the L49G / V303A / L307A / T143A wet cells (40 g) obtained in step (1), GluDH wet cells (48 g), N-Boc-4-acetylpiperidine (50 mmol / L), glucose (60 mmol / L), NAD + (0.1mmol / L), NH4Cl / NH4OH buffer (2mol / L, pH 8.5).

[0211] The reaction mixture was reacted at 30°C and 200 rpm for 48 h, and the conversion rate of the substrate N-Boc-4-acetylpiperidine was detected during the reaction; the results are as follows: Figure 5 As shown;

[0212] The results show that after the reaction is completed, the result is:

[0213] The conversion rate of 50mmol / L N-Boc-4-acetylpiperidine catalyzed by L49G / V303A / L307A / T143A can reach 99% ( Figure 5), the ee value of the product (R)-4-aminoethyl-1-Boc-piperidine reached 99% ( Figure 6 ).

[0214] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A leucine dehydrogenase mutant, characterized in that: The leucine dehydrogenase mutant is obtained by mutating the leucine at position 49 of the leucine dehydrogenase with the amino acid sequence shown in SEQ ID NO.1 to glycine; or by mutating the leucine at position 49 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 to glycine, and by mutating the valine at position 303 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 to alanine; or the amino acid sequence of the leucine dehydrogenase shown in SEQ ID NO.1 is mutated to glycine at position 49, the amino acid sequence of the leucine dehydrogenase shown in SEQ ID NO.1 is mutated to alanine at position 303, and the amino acid sequence of the leucine dehydrogenase shown in SEQ ID NO.1 is mutated to threonine at position 143 to alanine at the same time; or the amino acid sequence of the leucine dehydrogenase shown in SEQ ID NO.1 is mutated to glycine at position 49, the amino acid sequence of the leucine dehydrogenase shown in SEQ ID NO.1 is mutated to alanine at position 303, and the amino acid sequence of the leucine dehydrogenase shown in SEQ ID NO.1 is mutated to alanine at position 307; Or the amino acid sequence of the leucine dehydrogenase shown in SEQ ID NO.1 at position 49 is mutated to glycine, the amino acid sequence of the leucine dehydrogenase shown in SEQ ID NO.1 at position 303 is mutated to alanine, the amino acid sequence of the leucine dehydrogenase shown in SEQ ID NO.1 at position 307 is mutated to alanine, and the amino acid sequence of the leucine dehydrogenase shown in SEQ ID NO.1 at position 143 is mutated to alanine.

2. A gene encoding the mutant according to claim 1 or a recombinant vector carrying the gene.

3. A recombinant cell expressing the mutant according to claim 1 or carrying the gene or the recombinant vector according to claim 2.

4. The recombinant cell according to claim 3, characterized in that The recombinant cell uses bacteria or fungi as host cells.

5. A recombinant enzyme catalyst comprising the leucine dehydrogenase mutant sequence of claim 1, characterized in that: Is any of the following: (1) culturing a recombinant expression transformant containing the leucine dehydrogenase mutant, and isolating transformant cells containing the recombinant leucine dehydrogenase mutant enzyme; (2) culturing a recombinant expression transformant containing the leucine dehydrogenase mutant, isolating transformant cells containing the recombinant leucine dehydrogenase mutant enzyme, and disrupting the transformant cells containing the recombinant leucine dehydrogenase mutant enzyme to obtain a cell disrupted liquid; (3) culturing a recombinant expression transformant containing the leucine dehydrogenase mutant, isolating transformant cells containing the recombinant leucine dehydrogenase mutant enzyme, disrupting the transformant cells containing the recombinant leucine dehydrogenase mutant enzyme, obtaining a cell disrupted liquid, and freeze-drying the cell disrupted liquid of the recombinant leucine dehydrogenase mutant enzyme to obtain a lyophilized enzyme powder.

6. A method for increasing the activity of leucine dehydrogenase on a substrate, characterized in that: The method comprises the following steps: when the substrate is N-tert-butyl-4-acetylpiperidine, mutating the leucine at position 49 of the leucine dehydrogenase of the amino acid sequence as shown in SEQ ID NO.1 to glycine; Or the method is that when the substrate is S1-S4, S9-S10, the leucine at position 49 of the leucine dehydrogenase with an amino acid sequence as shown in SEQ ID NO.1 is mutated to glycine, and the valine at position 303 of the leucine dehydrogenase with an amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine; Or the method is that when the substrate is N-Boc-4-acetylpiperidine, the leucine at position 49 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 is mutated to glycine, the valine at position 303 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine, and the threonine at position 143 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine; Or the method is that when the substrate is N-Boc-4-acetylpiperidine, the leucine at position 49 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 is mutated to glycine, the valine at position 303 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine, and the leucine at position 307 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine; Or the method is, when the substrate is S1 to S10, the leucine at position 49 of the leucine dehydrogenase of the amino acid sequence as shown in SEQ ID NO.1 is mutated to glycine, the valine at position 303 of the leucine dehydrogenase of the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine, the leucine at position 307 of the leucine dehydrogenase of the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine, and the threonine at position 143 of the leucine dehydrogenase of the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine; The structural formula of S1~S10 is: 。 7. Use of the leucine dehydrogenase mutant according to claim 1, the recombinant cell according to claim 3 or 4, or the recombinant enzyme catalyst according to claim 5 in catalyzing the reduction of substrate N-heterocyclic ketone to prepare chiral nitrogen heterocyclic amines, characterized in that: When the substrate is N-tert-butyl-4-acetylpiperidine, the leucine at position 49 of the leucine dehydrogenase whose amino acid sequence is shown in SEQ ID NO.1 is mutated to glycine; When the substrate is S1-S4, S9-S10, the leucine at position 49 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 is mutated to glycine, and the valine at position 303 of the leucine dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine; When the substrate is N-Boc-4-acetylpiperidine, the leucine at position 49 of the leucine dehydrogenase of the amino acid sequence as shown in SEQ ID NO.1 is mutated to glycine, the valine at position 303 of the leucine dehydrogenase of the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine, and the threonine at position 143 of the leucine dehydrogenase of the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine; or the leucine at position 49 of the leucine dehydrogenase of the amino acid sequence as shown in SEQ ID NO.1 is mutated to glycine, the valine at position 303 of the leucine dehydrogenase of the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine, and the leucine at position 307 of the leucine dehydrogenase of the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine; When the substrate is S1 to S10, the leucine at position 49 of the leucine dehydrogenase of the amino acid sequence as shown in SEQ ID NO.1 is mutated to glycine, the valine at position 303 of the leucine dehydrogenase of the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine, the leucine at position 307 of the leucine dehydrogenase of the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine, and the threonine at position 143 of the leucine dehydrogenase of the amino acid sequence as shown in SEQ ID NO.1 is mutated to alanine; The structural formula of S1~S10 is: 。 8. The use according to claim 7, characterized in that: The application is to add the leucine dehydrogenase mutant or the recombinant cell or the recombinant enzyme catalyst to a cell containing glucose dehydrogenase, NAD + , the substrate according to claim 7, and glucose in a reaction system to prepare a chiral nitrogen heterocyclic amine.

9. The use according to claim 8, characterized in that: The reaction system also contains NH4Cl / NH4OH buffer.

10. The use according to claim 8, characterized in that: The glucose dehydrogenase is derived from Bacillus amyloliquefaciens .

11. Use of the mutant according to claim 1, the gene according to claim 2, the recombinant vector, the recombinant cell according to claim 3 or 4, or the recombinase catalyst according to claim 5 in the preparation of a medicine.

Images