A novel Cas13a / cr:mi:crRNA gene knockdown tool, construction method and application thereof

Abstract

The present invention relates to the field of biotechnology, and discloses a novel Cas13a / cr:mi:crRNA gene knockdown tool, a construction method and an application thereof. Two regularly clustered short palindromic repeat sequences RNAa (CRISPR-Derived RNA, crRNAa) and regularly clustered short palindromic repeat sequences RNAa (CRISPR-Derived RNA, crRNAb) sequences that guide Cas13a nuclease (Cas13a) to a target gene are respectively connected to the left and right wings of a primary miRNA (pri-miRNA) to form a cr:mi:crRNA guide RNA that triple-recognizes a target gene, and constructs Cas13a / cr:mi:crRNA. After bovine and mouse muscle cells are transfected with Cas13a / cr:mi:crRNA, cr:mi:crRNA is cut and separated with the help of Drosha nuclease to produce crRNAa, crRNAb and precursor miRNA (Previous miRNA, pre-miRNA) separated from each other, thereby performing triple recognition and cutting of the targeted messenger RNA (Messenger RNA, mRNA), significantly improving the efficiency of RNAi and providing an efficient gene interference system for biological breeding.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a novel Cas13a / cr:mi:crRNA gene knockdown tool, a construction method and applications thereof. Background Art

[0002] When gene knockout technology is applied to animals, it may cause compensatory effects on genes due to the complexity of the animals themselves. Compared with gene knockout, RNAi technology can downregulate gene expression while keeping DNA intact. It has the characteristics of simple design and high specificity, and has been applied to the research of animal gene function and gene therapy.

[0003] At present, CRISPR / Cas13a is a commonly used RNA interference (RNAi) method. CRISPR / Cas13a has been widely studied and applied due to its specificity. It guides the Cas13a protein to locate the target mRNA through crRNA, thereby specifically knocking down the target mRNA. miRNA is a type of non-coding single-stranded RNA existing in eukaryotes. Its primary miRNA (pri-miRNA) cuts the flanking sequence through the Drosha nuclease to form a precursor miRNA (pre-miRNA). Subsequently, the Dicer nuclease cuts the loop of the pre-miRNA to form a double-stranded mature miRNA, which recognizes and pairs with the target mRNA, causing translation inhibition or specific cutting of the target mRNA. Although these two interference systems are commonly used, the interference efficiency needs to be improved.

[0004] Myostatin (MSTN) is a negative regulator of muscle development. The reduction of MSTN gene expression can promote muscle mass increase. Methyltransferase like 3 (METTL3) is the core component of N6-methyladenosine (m6A) methyltransferase, which inhibits myoblast proliferation and promotes cell differentiation in an m6A-dependent manner. The expression of large tumor suppreressor2 (Lats2) is affected by gender, growth stage and different muscle tissues, and downregulates muscle growth and development by inhibiting the expression of Yes-associated protein 1 (YAP1) gene. At present, the application of the classic CRISPR / Cas13a interference system in livestock has the defect of low interference efficiency. The present invention uses the Drosha endonuclease in the miRNA maturation process to construct a Cas13a / cr:mi:crRNA knockdown tool to perform joint RNAi on different sites of the target mRNA, thereby improving the interference efficiency and providing a more efficient gene interference system for biological breeding. Summary of the invention

[0005] The present invention first provides a novel Cas13a / cr:mi:crRNA gene knockdown tool, which comprises the structure of crRNAa, primary miRNA and crRNAb; the crRNAa and crRNAb are located on both wings of the primary miRNA.

[0006] Preferably, the tool is a nucleotide sequence.

[0007] Preferably, the means is a carrier.

[0008] Preferably, the means further comprises a U6 promoter.

[0009] The present invention also provides the above-mentioned tool construction method, comprising the following steps:

[0010] 1) Designing crRNA sequences according to the homologous sequence of the target mRNA to obtain crRNAa and crRNAb sequences targeting the target mRNA;

[0011] 2) Using pri-miRNA as the basic framework, design pri-miRNA mimics that target the target mRNA;

[0012] 3) Connecting the crRNAa and crRNAb sequences to the left and right wings of the pri-miRNA mimics, respectively, to obtain the cr:mi:crRNA sequence;

[0013] 4) The LwaCas13a crRNA backbone vector was digested with BbsI restriction endonuclease to obtain a linear LwaCas13a crRNA backbone;

[0014] 5) Connect the cr:mi:crRNA sequence to the linear LwaCas13a crRNA backbone to obtain the cr:mi:crRNA vector.

[0015] Preferably, the steps include:

[0016] The reaction system and conditions of step 4) are as follows: 1 μg of plasmid, 1 μL of BbsI, 2 μL of 10×Buffer, add ddH2O to 10 μL, mix well and react at 37°C for 1 h;

[0017] Preferably, the steps include:

[0018] The reaction system and conditions of step 5) are as follows: 1 μL of LwaCas13a crRNA backbone recovery product, 3 μL of cr:mi:crRNA sequence, 5 μL of Solution I ligase, and ddH2O added to 10 μL, and ligated at 16°C overnight.

[0019] The present invention also provides an application of the above-mentioned tool, wherein the application is for gene knockdown of a target organism, wherein the application is for non-therapeutic purposes, and optionally, the target organism comprises non-human mammals, plants and microorganisms.

[0020] The present invention also provides a method for gene knockdown, which comprises the step of using the above-mentioned tool, and the method is for non-therapeutic purposes.

[0021] Compared with the prior art, the present invention has at least the following beneficial effects:

[0022] Compared with the maximum interference efficiencies of 54% and 33% mediated by classic CRISPR / Cas13a and miRNA, respectively, the interference efficiency of the Cas13a / cr:mi:crRNA knockdown tool constructed in the present invention is 97%; and the Cas13a / cr:mi:crRNA knockdown tool has no effect on cell viability and proliferation. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is the mechanism of action of Cas13a / cr:mi:crRNA;

[0024] Figure 2 It is the design principle of pri-miRNA;

[0025] Figure 3It is a single enzyme digestion of LwaCas13a crRNA backbone vector;

[0026] Figure 4 is the sequencing result of cr:mi:crRNA vector;

[0027] Figure 5 is the sequencing result of the cr:mi:crRNA vector of the mutant miRNA;

[0028] Figure 6 It is a schematic diagram of establishing a cell line stably expressing Cas13a protein;

[0029] Figure 7 is flow cytometry sorting;

[0030] Figure 8 is the GFP observation of bovine SCs and mouse C2C12 stably expressing Cas13a protein;

[0031] Fig. 9 is the cr:mi:crRNA and the cr:mi:crRNA long transcript sequence of the mutant miRNA;

[0032] Fig.10 This is the electrophoresis result diagram of Cas13a / cr:mi:crRNA effectively producing crRNA and miRNA separated from each other, 1, 2, and 3 are con, crRNA-1, and miRNA, respectively.

[0033] Fig.11 These are the results of crRNA-1 and miRNA sequencing.

[0034] Fig.12 In bovine Cas13a-SCs, qPCR was used to detect the efficiency of MSTN mRNA interference mediated by Cas13a / cr:mi:crRNA;

[0035] Fig.13 In mouse Cas13a-C2C12, qPCR was used to detect the efficiency of MSTN mRNA interference mediated by Cas13a / cr:mi:crRNA;

[0036] Fig.14 In bovine Cas13a-SCs, the efficiency of MSTN protein interference mediated by Cas13a / cr:mi:crRNA was detected by WB;

[0037] Fig.15 In mouse Cas13a-C2C12, WB was used to detect the efficiency of MSTN protein interference mediated by Cas13a / cr:mi:crRNA;

[0038] Fig.16In bovine Cas13a-SCs, qPCR was used to detect the efficiency of METTL3 mRNA interference mediated by Cas13a / cr:mi:crRNA;

[0039] Fig.17 In mouse Cas13a-C2C12, qPCR was used to detect the efficiency of METTL3 mRNA interference mediated by Cas13a / cr:mi:crRNA;

[0040] Fig.18 In bovine Cas13a-SCs, the efficiency of METTL3 protein interference mediated by Cas13a / cr:mi:crRNA was detected by WB;

[0041] Fig.19 In mouse Cas13a-C2C12, WB was used to detect the efficiency of METTL3 protein interference mediated by Cas13a / cr:mi:crRNA;

[0042] Fig. 20 In bovine Cas13a-SCs, qPCR was used to detect the efficiency of LATS2 mRNA interference mediated by Cas13a / cr:mi:crRNA;

[0043] Fig.21 In mouse Cas13a-C2C12, qPCR was used to detect the efficiency of LATS2 mRNA interference mediated by Cas13a / cr:mi:crRNA;

[0044] Fig. 22 In bovine Cas13a-SCs, WB was used to detect the efficiency of LATS2 protein interference mediated by Cas13a / cr:mi:crRNA;

[0045] Fig.23 In mouse Cas13a-C2C12, WB was used to detect the efficiency of LATS2 protein interference mediated by Cas13a / cr:mi:crRNA;

[0046] Fig.24 is the effect of Cas13a / cr:mi:crRNA on the viability of bovine SCs and mouse C2C12 cells;

[0047] Fig.25 It is the effect of Cas13a / cr:mi:crRNA on bovine SCs cell proliferation.

[0048] Fig.26 It is the effect of Cas13a / cr:mi:crRNA on the proliferation of mouse C2C12 cells. DETAILED DESCRIPTION

[0049] In order to make the technical problems, technical solutions and advantages to be solved by the present invention more clear, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0050] The sources of the biological material of the present invention are as follows: the bovine muscle satellite cells are obtained by separating and culturing the gastrocnemius muscle of beef cattle; and the mouse myoblasts are C2C12 myoblasts preserved in the laboratory.

[0051] Example 1 Figure 1-5 This is the construction process of the cr:mi:crRNA vector of the present invention and the cr:mi:crRNA vector of the mutant miRNA.

[0052] Using pri-miR-31 as the basic framework, pri-miRNA mimics were designed ( Figure 2 The cr:mi:crRNA sequence was synthesized by Takara Biotechnology (Dalian) Co., Ltd., see Table 1 (connected to pMD-19T).

[0053] Table 1 Synthetic sequences

[0054] Composition Sequence sequence (5′ - 3′) sequence (5′ - 3′) MSTN-crRNA-1 SEQ ID NO:1:ATACCTTGTACCGTCTTTCATGGGTTTTG MSTN-crRNA-3 SEQ ID NO:2: TGATTTCAATGCCTAAGTTGGATTCAGG MSTN-miRNA SEQ ID NO:3: TGCTCTGCCAAATACCAGTGC MSTN-cr:mi:crRNA SEQ ID NO:4:CTTAAGATACCTTGTACCGTCTTTCATGGGTTTGCTCGAGagggatggtattgctcctgtaactcggaactggagaggTGCTCTGCCAAATACCAGTGCgttgaactgggaacgGCACTGGTTTGG CAGAGCAtttcctgtctgacagcagcttggctacctccgtcctgttcGGATCCgaaacaccgatttagactaccccaaaaacgaaggggactaaaacTGATTTCAATGCCTAAGTTGGATTCAGGAAGCTT mutantMSTN-cr:mi:crRNA SEQ ID NO:5:CTTAAGATACCTTGTACCGTCTTTCATGGGTTTGCTCGAGagggatggtattgctcctgtaactcggaactggagaggTGCTCTGCCAATAACTAGGTCgttgaactgggaacgGACCTAGATTGG CAGAGCAtttcctgtctgacagcagcttggctacctccgtcctgttcGGATCCgaaacaccgatttagactaccccaaaaacgaaggggactaaaacTGATTTCAATGCCTAAGTTGGATTCAGGAAGCTT METTL3-crRNA-1 SEQ ID NO:6: CCTGGATAGAGCTCCACGTGTCCGACAT METTL3-crRNA-3 SEQ ID NO:7: CTTCTGATGCTGAAGAGGCCAGACCAGA METTL3-miRNA SEQ ID NO:8:AGGGTCTGTAGCTAGTTCAGG METTL3-cr:mi:crRNA SEQ ID NO:9:CTTAAGCCTGGATAGAGCTCCACGTGTCCGACATCTCGAGagggatggtattgctcctgtaactcggaactggagaggAGGGTCTGTAGCTAGTTCAGGgttgaactgggaacgCCTGAACTAGCTACAGACCCTtttcctgtctgacagcagcttggctacctccgtcctgttcGGATCCgaaacaccgatttagactaccccaaaaacgaaggggactaaaacCTTCTGATGCTGAAGAGGCCAGACCAGAAAGCTT mutantMETTL3-cr:mi:crRNA SEQ ID NO:10:CTTAAGCCTGGATAGAGCTCCACGTGTCCGACATCTCGAGagggatggtattgctcctgtaactcggaactggagaggAGGGTCTGTAGTCAGATCGAGgttgaactgggaacgCTCGATCTGACTACAGACCCTtttcctgtctgacagcagcttggctacctccgtcctgttcGGATCCgaaacaccgatttagactaccccaaaaacgaaggggactaaaacCTTCTGATGCTGAAGAGGCCAGACCAGAAAGCTT Lats2-crRNA-1 SEQ ID NO:11:ATCTGCTCCTGCTCGGCCTCACAGAGCC Lats2-crRNA-3 SEQ ID NO:12:AGTACAGGCTGTCCTTGTCCTGGAAGGA Lats2-miRNA SEQ ID NO:13:GCGCCCTCTGCTCCAGGGTCT Lats2-cr:mi:crRNA SEQ ID NO:14: CTTAAGATCTGCTCCTGCTCGGCCTCACAGAGCCCTCGAGagggatggtattgctcctgtaactcggaactggagaggGCGCCCTCTGCTCCAGGGTCTgttgaactgggaacg AGACCCTGGAGCAGAGGGCGCtttcctgtctgacagcagcttggctacctccgtcctgttcGGATCCgaaacaccgatttagactaccccaaaaacgaaggggactaaaacAGTACAGGCTGTCCTTGTCCTGGAAGGAAAGCTT mutantLats2-cr:mi:crRNA SEQ ID NO:15: CTTAAGATCTGCTCCTGCTCGGCCTCACAGAGCCCTCGAGagggatggtattgctcctgtaactcggaactggagaggGCGCCCTCTGCCTCACGGCTTgttgaactgggaacg AAGCCGTGAGGCAGAGGGCGCtttcctgtctgacagcagcttggctacctccgtcctgttcAAGCCGTGAGGCAGAGGGCGCgaaacaccgatttagactaccccaaaaacgaaggggactaaaacAGTACAGGCTGTCCTTGTCCTGGAAGGAAAGCTT

[0055] 1) Plasmid extraction. After the E. coli carrying the LwaCas13a crRNA backbone vector is cultured, the bacterial solution is collected. The plasmid is extracted according to the instructions of the plasmid extraction kit. The extracted plasmid is stored at -20℃.

[0056] 2) Single restriction enzyme digestion of plasmid. The LwaCas13a crRNA backbone vector was digested with BbsI restriction enzyme. The reaction composition was: 1 μg of plasmid, 1 μL of BbsI, 2 μL of 10×Buffer, and ddH2O was added to 10 μL. After mixing, the reaction was carried out at 37°C for 1 h.

[0057] 3) Electrophoresis identification. The digestion product in (2) was subjected to agarose gel electrophoresis to separate a 2935 bp linear LwaCas13a crRNA backbone vector, which was consistent with experimental expectations ( Figure 3 ).

[0058] 4) Gel excision and recovery: Purify the target fragment according to the instructions of the gel recovery kit and store the purified product at -20℃.

[0059] 5) Homologous recombination. The linear LwaCas13a crRNA backbone vector was connected to the cr:mi:crRNA sequence. The reaction composition was: 1 μL of LwaCas13a crRNA backbone recovery product, 3 μL of cr:mi:crRNA sequence, 5 μL of Solution I ligase, and ddH2O was added to 10 μL. The connection was carried out at 16°C overnight.

[0060] 6) Transformation. Take 10 μL of the above ligation product and add it to 50 μL of ice-cold DH5α competent cells and mix gently. Place the transformation system on ice for 30 min, heat shock at 42°C for 60 sec, and place on ice for 2 min. Add 1 mL of non-resistant LB culture medium to the system and culture at 37°C for 1 h. After the shaking culture, spread the transformation product on the LB plate containing the corresponding antibiotics and culture at 37°C overnight.

[0061] 7) Screening of positive clones. Single colonies of uniform size grown on the resistance plate were picked and cultured in liquid LB medium at 37°C for subsequent sequencing verification. The results showed that the present invention successfully constructed cr:mi:crRNA vectors and cr:mi:crRNA vectors with mutated miRNAs ( Figures 4 - 5 ).

[0062] Example 2

[0063] like Figures 6 - 8 The process of transfecting the LwaCas13a-msfGFP-NES vector expressing the Cas13a protein into cells is used to illustrate that the present invention successfully obtains bovine muscle satellite cell lines (Cas13a-Satellitecells, Cas13a-SCs) and mouse myoblast C2C12 (Cas13a-C2C12) cell lines that stably express the Cas13a protein.

[0064] Bovine SCs and mouse C2C12 were passaged to six-well plates. When the cell confluence reached 70%-80%, 7 μg of LwaCas13a-msfGFP-NES plasmid was transfected using the transfection reagent Lipfectamine 2000 (Invitrogen, USA). The medium was changed after 6 h. After 24 h, the green fluorescent protein (GFP) fluorescence was observed, and cells stably expressing GFP were sorted using flow cytometry fluorescence sorting technology. The results showed that 6% of bovine SCs contained Cas13a-SCs, and 2.5% of mouse C1C12 contained Cas13a-C2C12 ( Figure 7 ), thereby obtaining bovine Cas13a-SCs and mouse Cas13a-C2C12 cell lines that stably express Cas13a protein (Figure 8 ).

[0065] Example 3

[0066] like Figures 9 - 11 The poly (A) tailing, reverse transcription and polymerase chain reaction (PCR) process are used to illustrate that the cr:mi:crRNA vector constructed by the present invention can produce crRNA and miRNA separated from each other.

[0067] Mouse C2C12 cells were transfected with 3 μg of cr:mi:crRNA vector using Lipfectamine 2000 reagent. The medium was changed after 6 h. Total RNA was extracted from cells using FastPure Cell / Tissue Total RNA Isolation Kit (Vazyme, China) after 48 h, and then poly(A) tailed the total RNA using E. coli Poly(A) Polymerase Kit (Vazyme, China).

[0068] The RNA with poly (A) tail was reverse transcribed using HiScript II Q RT SuperMix (Vazyme, China) reverse transcription kit to obtain complementary deoxyribonucleic acid (cDNA). The cDNA was amplified by PCR and the PCR product was subjected to agarose gel electrophoresis. The results showed that the band size was consistent with the experimental expectations ( Figure 10 Finally, the PCR products were sequenced and verified by gel recovery. The results showed that the cr:mi:crRNA vector constructed by the present invention can produce crRNA and miRNA separated from each other ( Figure 11 ).

[0069] Example 4

[0070] like Figures 12 - 15 , Figures 16 - 19 and Figures 20 - 23 The real-time fluorescence quantitative (RT-qPCR) and protein immunoblotting (Western Blot) detection process is used to illustrate that compared with the classic CRISPR / Cas13a and miRNA, the Cas13a / cr:mi:crRNA gene knockdown tool constructed by the present invention can significantly improve the interference efficiency of MSTN, METTL3 and LATS2 genes.

[0071] The total RNA of bovine SCs and mouse C2C12 was extracted using RNAiso Plus kit (TaKaRa, Dalian), and the RNA was reverse transcribed into cDNA using cDNA reverse transcription kit, and qPCR was performed using Real-time PCR detection system (ABI, USA). Primers were designed using Primer Premier 5.0, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal reference gene. RT-qPCR reaction system: cDNA 1μL, primers (10 μmol / L) 0.5μL each, TB Green Supermix (Takara, Dalian) 10μL, supplemented with ddH2O to 20μL. The reaction procedure was denaturation at 95℃ for 30 s, annealing at 95℃ for 15 s, extension at 60℃ for 30 s, and 40 cycles. 2 -ΔΔCt Methods The relative expression of target genes was analyzed.

[0072] The results showed that when targeting MSTN mRNA, the highest interference efficiency of MSTN mRNA mediated by classical CRISPR / Cas13a and miRNA was 54% and 33%, respectively. In bovine Cas13a-SCs, the interference efficiency mediated by Cas13a / cr:mi:crRNA gene knockdown tool and Cas13a / cr:mi:crRNA gene knockdown tool with mutated miRNA was increased to 90% and 85.5%, respectively. In mouse Cas13a-C2C12, the interference efficiency mediated by Cas13a / cr:mi:crRNA gene knockdown tool and Cas13a / cr:mi:crRNA gene knockdown tool with mutated miRNA was increased to 97% and 90%, respectively. Figures 12 - 13 ). When targeting METTL3 mRNA, the interference efficiency mediated by the Cas13a / cr:mi:crRNA gene knockdown tool and the Cas13a / cr:mi:crRNA gene knockdown tool with mutant miRNA was increased to 88% and 84% in bovine Cas13a-SCs, compared with the highest interference efficiency of 46% and 33% mediated by classical CRISPR / Cas13a and miRNA, respectively. In mouse Cas13a-C2C12, the interference efficiency mediated by the Cas13a / cr:mi:crRNA gene knockdown tool and the Cas13a / cr:mi:crRNA gene knockdown tool with mutant miRNA was increased to 92% and 87%, respectively ( Figures 16 - 17). When targeting LATS2 mRNA, the interference efficiency mediated by the Cas13a / cr:mi:crRNA gene knockdown tool and the Cas13a / cr:mi:crRNA gene knockdown tool with mutant miRNA was increased to 90% and 83% in bovine Cas13a-SCs, compared with the highest interference efficiency of 52% and 31% mediated by classical CRISPR / Cas13a and miRNA, respectively. In mouse Cas13a-C2C12, the interference efficiency mediated by the Cas13a / cr:mi:crRNA gene knockdown tool and the Cas13a / cr:mi:crRNA gene knockdown tool with mutant miRNA was increased to 95% and 89.5%, respectively ( Figures 20 - 21 ).

[0073] The protein lysis buffer RIPA was added to the centrifuge tube containing the cells to be tested (Beyotime, Shanghai). The protein lysis buffer contained protease inhibitors (Sigma, USA) and incubated on ice for 30 min. The supernatant was centrifuged at 13000 g for 5 min. The protein concentration was detected by BCA kit (Thermo, USA). The sample was added with protein loading buffer (Biosharp, Shanghai) and boiled for 10 min and stored at -80 ℃. The sample was separated by 10% SDS-PAGE electrophoresis and then transferred to NC membrane (Solarbio, Beijing) at 200 mA for 1 h. It was blocked with 5% skim milk for 1 h and then incubated with MSTN antibody, METTL3 antibody and LATS2 antibody (Abcam, USA) overnight. The secondary antibody was incubated for 1 h (Proteintech, Wuhan), and the image was taken after development. The results are consistent with those of RT-qPCR, that is, the Cas13a / cr:mi:crRNA gene knockdown tool constructed by the present invention can significantly reduce the expression of MSTN, METTL3 and LATS2 proteins ( Figures 14 - 15 , Figures 18 - 19 , Figures 22 - 23 ).

[0074] Example 5

[0075] like Figure 7 and Figure 8 This is the detection process of cell viability and proliferation ability, which is used to illustrate that the Cas13a / cr:mi:crRNA gene knockdown tool constructed by the present invention has no effect on the viability and proliferation ability of bovine Cas13a-SCs and mouse Cas13a-C2C12 cells.

[0076] The cr:mi:crRNA vector was transfected into bovine Cas13a-SCs and mouse Cas13a-C2C12. After 48 h, the MTT cytotoxicity detection kit (Solarbio, Beijing) and cell proliferation detection kit (Solarbio, Beijing) were used to detect the effects of the Cas13a / cr:mi:crRNA gene knockdown tool on cell viability and proliferation ability. The results showed that the Cas13a / cr:mi:crRNA gene knockdown tool constructed by the present invention had a significant effect on cell viability ( Figure 24 ) and value-added capabilities ( Figures 25 - 26 ) has no impact.

[0077] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A novel Cas13a / cr:mi:crRNA gene knockdown vector, characterized in that: The vector comprises the structures of crRNAa, primary miRNA and crRNAb; the crRNAa and crRNAb are located on both wings of the primary miRNA; the nucleotide sequence of the vector is selected from one or more of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:14, and SEQ ID NO:15.

Images