SNP molecular marker related to pig daily weight gain on pig chromosome 1 and application thereof

By identifying SNP molecular markers on pig chromosome 1, especially the T>C mutation at locus 162158624 on chromosome 1 in the International Pig Reference Genome Version 11.1, primer pairs P001-F and P002-R were designed to establish molecular marker-assisted breeding technology. This solved the problem of increasing the daily weight gain of pigs, resulting in a significant increase in the daily weight gain of breeding pigs and improved economic benefits.

CN118166109BActive Publication Date: 2026-04-28SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTH CHINA AGRICULTURAL UNIVERSITY
Filing Date
2023-12-27
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively increase the daily weight gain of pigs, thus affecting their growth performance and farming efficiency.

Method used

By identifying and utilizing SNP molecular markers on pig chromosome 1, especially the T>C mutation at locus 162158624 on chromosome 1 of the International Pig Reference Genome 11.1, primer pairs P001-F and P002-R were designed to establish molecular marker-assisted breeding technology, screen pig breeds with high daily weight gain, and increase the frequency of dominant alleles generation by generation.

Benefits of technology

It significantly improved the daily weight gain of breeding pigs, reduced breeding costs, increased production efficiency and economic profits, and accelerated the progress of pig genetic improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118166109B_ABST
    Figure CN118166109B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of molecular biology and molecular marker, and particularly relates to a SNP molecular marker related to pig daily weight gain on chromosome 1 of pig and application. The site of the SNP molecular marker related to pig daily weight gain on chromosome 1 of pig corresponds to the 162158624th nucleotide site on chromosome 1 of the international pig reference genome 11.1 version, and the base of the site is T or C. Through selecting the dominant allele of the SNP, the dominant allele frequency can be increased generation by generation, the pig daily weight gain is improved, the pig genetic breeding progress is accelerated, and thus the economic benefit of pig breeding is effectively improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to a SNP molecular marker located on pig chromosome 1 that is related to daily weight gain in pigs and its application. Background Technology

[0002] In modern animal husbandry, improving the daily weight gain of pigs is one of the key goals in breeding. With increasing demand for high-quality meat, researchers are dedicated to optimizing pig growth performance to improve meat yield and quality. Daily weight gain, as a key indicator of growth performance, directly impacts a pig's market value and farming profitability.

[0003] Studies have found a close correlation between daily weight gain and growth rate in pigs. An improvement in this metric is often accompanied by faster growth and higher body weight, thus becoming an important parameter for measuring pig growth performance. Single nucleotide polymorphisms (SNPs), as a common form of genetic variation, have been shown to be closely associated with daily weight gain. Genome-wide association studies (GWAS), as a powerful tool, can reveal the relationship between genes and traits, including key genetic variations affecting daily weight gain. Through large-scale GWAS studies, researchers can identify important genetic variations affecting daily weight gain in pigs, providing strong support for precise genetic improvement and early selection, thereby significantly improving breeding efficiency.

[0004] Duroc pigs exhibit rapid growth and strong adaptability. Their ability to reach market weight quickly and their adaptability to various feeding environments and climatic conditions make them ideal for meat production and breeding. As a terminal sire, the superior growth characteristics of Duroc pigs can be genetically passed on, providing crucial support for improving the quality and growth performance of other pig breeds. Therefore, increasing the daily weight gain of pigs can not only meet the demand for high-quality pork but also promote the sustainable development of agricultural production. Summary of the Invention

[0005] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide a SNP molecular marker located on chromosome 1 of pigs that is associated with daily weight gain in pigs.

[0006] Another object of the present invention is to provide the application of the above-mentioned SNP molecular markers located on chromosome 1 of pigs that are associated with daily weight gain in pigs.

[0007] Another object of the present invention is to provide a primer pair for identifying the above-mentioned SNP molecular markers.

[0008] A fourth objective of this invention is to provide applications of the aforementioned primer pairs.

[0009] The fifth objective of this invention is to provide a method for genetic improvement of pigs.

[0010] The objective of this invention is achieved through the following technical solution:

[0011] A molecular marker of a SNP located on chromosome 1 of pigs that is associated with daily weight gain of pigs, the SNP site of which corresponds to the T>C mutation at nucleotide position 162,158,624 on chromosome 1 of the International Swine Reference Genome 11.1;

[0012] The nucleotide sequence of the SNP molecular marker located on chromosome 1 of pigs that is associated with daily weight gain in pigs is shown in SEQ ID NO: 1, wherein M in the sequence is T or C, which leads to differences in daily weight gain in pigs;

[0013] The SNP molecular marker located on chromosome 1 of pigs and associated with daily weight gain of pigs has an SNP site of T163-C163 at position 163 of the sequence marked in SEQ ID NO:1 (position 162158624 on chromosome 1 of the International Pig Reference Genome 11.1, named g.162158624T>C);

[0014] The application of the aforementioned SNP molecular markers in identifying traits related to daily weight gain in pigs and in pig genetic breeding;

[0015] The method for screening pig breeds with high daily weight gain using the above-mentioned SNP molecular markers includes the following steps:

[0016] Detect the above-mentioned SNP molecular markers on pig chromosome 1, and determine whether the single nucleotide at the SNP site of the molecular marker is C or T, discarding C and retaining T;

[0017] The pigs mentioned are Duroc pigs and their synthetic lines;

[0018] The preferred pigs are the S21 Duroc pigs and their synthetic lines;

[0019] A primer pair for identifying the above-mentioned SNP molecular markers comprises primers P001-F and P002-R, the nucleotide sequences of which are shown below:

[0020] Primer P001-F: 5'-CTGTGCTCCATCTGTTTACCCTCTC-3',

[0021] Primer P002-R: 5'-TGTCACAACTTGGAAGCAGCCTAG-3';

[0022] A kit for detecting the above-mentioned SNP molecular markers, comprising the above-mentioned primer pairs;

[0023] Application of the primer pairs or kits described herein in identifying traits related to daily weight gain in pigs;

[0024] Application of the primer pairs or kits in marker-assisted breeding of pigs;

[0025] Application of the primer pairs or kits in improving daily weight gain in pigs;

[0026] A method for increasing daily weight gain in pigs includes the following steps:

[0027] Genotypes at nucleotide 162,158,624 on chromosome 1 of the International Pig Reference Genome 11.1 were detected, and individuals with the TT genotype at nucleotide 162,158,624 were selected as breeding pigs.

[0028] The method for detecting the genotype of chromosome 162,158,624 on the International Swine Reference Genome 11.1 includes the following steps:

[0029] (1) Extract genomic DNA from the pigs to be tested;

[0030] (2) Using the primer pairs mentioned above or the primer pairs in the kit mentioned above as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification is performed to obtain PCR amplification products.

[0031] (3) Sequencing the PCR amplification products to obtain sequencing results;

[0032] (4) Based on the sequencing results, determine the genotype of the SNP molecular markers;

[0033] The pigs mentioned are Duroc pigs and their synthetic lines;

[0034] The preferred pigs are the S21 Duroc pigs and their synthetic lines;

[0035] A method for genetic improvement of pigs, comprising the following steps:

[0036] The above-mentioned SNP molecular markers of breeding pigs in the core breeding pig population were identified, and corresponding selections were made based on the molecular markers: breeding pig individuals with the TT or TC genotype at nucleotide locus 162158624 on chromosome 1 of the International Swine Reference Genome Version 11.1 were selected from the core breeding pig population, and breeding pig individuals with the CC genotype at nucleotide locus 162158624 were culled, so as to increase the frequency of the T allele at this locus in each generation, thereby increasing the daily weight gain of the breeding pigs;

[0037] The pigs mentioned are Duroc pigs and their synthetic lines;

[0038] The preferred pigs are the S21 Duroc pigs and their synthetic lines;

[0039] The present invention has the following advantages and effects compared with the prior art:

[0040] (1) This invention studies and identifies the nucleotide sequences of molecular markers related to daily weight gain in pigs located on chromosome 1, verifies their effects on the daily weight gain trait, and ultimately establishes an efficient and accurate molecular marker-assisted breeding technology. This technology is then applied to genetic improvement of breeding pigs to increase daily weight gain, thereby reducing costs, increasing production efficiency, improving enterprise economic profits, and enhancing core competitiveness. By optimizing the dominant alleles of this SNP, the frequency of dominant alleles can be increased generation by generation, improving the daily weight gain of breeding pigs, accelerating the progress of pig genetic improvement, and thus effectively improving the economic benefits of pig breeding.

[0041] (2) This invention provides a primer pair for identifying the above-mentioned SNP molecular markers located on chromosome 1 of pigs that are related to daily weight gain of pigs. Through this primer pair, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately improve the daily weight gain of breeding pigs and accelerate the breeding process. Attached Figure Description

[0042] Figure 1 This is a Manhattan plot of genome-wide association analysis of daily weight gain trait on chromosome 1 in S21 Duroc pigs; where: the horizontal axis represents the chromosome number of the pig; and the vertical axis represents the -logP value.

[0043] Figure 2 This is a graph showing the daily weight gain of pigs with different genotypes. Detailed Implementation

[0044] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0045] Example 1

[0046] (1) Laboratory animals

[0047] The experimental pig population used in this invention consists of 3,769 purebred S21 Duroc pigs from the breeding pig division of Wens Foodstuff Group Co., Ltd., which is the core group of the breeding pig division, and the phylogenetic record of the group is detailed.

[0048] The pigs have free access to feed and water, and the feeding methods and rearing conditions remain consistent throughout the entire process, which is a standard practice.

[0049] The average daily weight gain of live pigs from 30 kg to 100 kg was determined using the Osborne FIRE Pig Performance Testing System (Kansas, NE, USA).

[0050] (2) Sample collection

[0051] Ear tissue or tail tissue was collected from each individual in the S21 Duroc breeding pig population and soaked in a 75% ethanol solution. The tissue was then stored at -20°C for later use.

[0052] (3) Pig genome 50K SNP genotyping

[0053] Whole-genome DNA was extracted from ear or tail tissue of S21 Duroc pigs using the standard phenol-chloroform method. The concentration and OD ratio (OD260 / 280, OD260 / 230) of each sample were accurately determined using a NanoDrop 2000 / 2000C nucleic acid and protein analyzer. DNA samples that passed the NanoDrop 2000 / 2000C nucleic acid and protein analyzer were diluted to approximately 50 ng / μL according to the measured concentration. 6 μL of the extracted DNA sample was then mixed with 2 μL of loading buffer and loaded onto a 1% (w / v) agarose gel. Electrophoresis was performed at 150V for 25 min. The DNA integrity was observed and photographed using a UV spectrophotometer and gel imaging device.

[0054] DNA samples were sent to Neogene Biotech (Shanghai) Co., Ltd., where the pig whole genome 50K SNP chip (Illumina, USA) was used for genotyping on the Illumina Beadstration platform according to the company's standard procedures. Finally, the genotype data was read using GenomeStudio software.

[0055] (4) Genotype filling

[0056] Genotyping of the 50K SNP microarray dataset was performed using the SWIM database (https: / / quantgenet.msu.edu / swim / ), a website for porcine genotyping. The filled genome sequence dataset was quality controlled using PLINK v1.9, with a rejection rate <99%, a mimor allelic frequency (MAF) <1%, or a deviation from Hardy-Weinberg equilibrium (HWE) P ≤ 10. -6SNP markers were selected, and individuals with a detection rate <90%, a family Mendelian error rate >0.1, and SNPs located at unknown locations or on sex chromosomes were excluded. After quality control, the remaining 561,100 SNP markers and 3,732 samples were used for subsequent data analysis, ultimately yielding valid genotype data for 561,100 SNPs.

[0057] (5) Genome-wide association analysis (GWAS)

[0058] To eliminate population stratification effects, this invention employs a linear mixed model with single-point regression analysis combined with GWAS analysis using the GenABEL software package in R. The analysis model utilizes the similarity of genomes among individuals to correct for stratification effects. For the filled genome data, the Bonferrini method is used to determine the SNP significance threshold. The genome-level significance threshold is 0.05 divided by the number of effective SNP sites, i.e., the genome-level significance threshold is 0.05 / 561100 (number of effective SNPs), or 8.91e-08. The chromosome-level significance threshold is 1 divided by the number of effective SNP sites, i.e., the chromosome-level significance threshold is 1 / 561100 (number of effective SNPs), or 1.78e-06.

[0059] GWAS analysis results are as follows Figure 1 As shown. From Figure 1 It can be seen that in the S21 Duroc pig line, there is a site on chromosome 1 that significantly affects daily weight gain, and the most strongly associated SNP is g.162158624T>C (P value 1.80E-07).

[0060] (6) Association analysis of different genotypes of SNP locus (162158624) with daily weight gain phenotype: According to Table 1, the SNP locus g.162158624T>C (nucleotide 163 in SEQ NO.1, corresponding to the T>C mutation at position 162158624 on chromosome 1 of the International Swine Reference Genome 11.1) was significantly associated with the daily weight gain trait (P<0.01), indicating that this molecular marker significantly affects the daily weight gain trait of breeding pigs. By assisting in the selection of this SNP locus in pigs, the daily weight gain of breeding pigs can be improved, thereby increasing economic benefits.

[0061] Additionally, according to Table 1 and... Figure 2 It was found that the daily weight gain of TT and CT type pigs was greater than that of CC type pigs. The daily weight gain of TT type breeding pigs was 12.29g higher than that of CC type breeding pigs on average, and the difference between the two was highly significant (P<0.01). This result indicates that gradually eliminating CC type breeding pigs in breeding to increase the frequency of the T allele at this locus in each generation can significantly improve the daily weight gain of breeding pigs, bringing more economic benefits to breeding enterprises.

[0062] Table 1. Correlation analysis of SNP sites of molecular markers g.162158624T>C with daily weight gain.

[0063]

[0064] Note: ① Daily weight gain of 100 kg is expressed as mean ± standard deviation (SD); ② Uppercase letters indicate the results of multiple comparison analysis of daily weight gain between different genotypes. If the uppercase letters are the same, it means that there is no significant difference in daily weight gain between the two genotype groups. If the uppercase letters are different, it means that the difference in daily weight gain between the two genotype groups is extremely significant (P<0.01); ③ *** indicates that the variance analysis results of genotype and daily weight gain are extremely significant (P<0.01); ④ The total sample size is 3769, of which 37 have no genotype.

[0065] Example 2: Target DNA Sequence Amplification and Sequencing

[0066] (1) Primer design

[0067] The DNA sequence of SEQ ID NO:1 on pig chromosome 1 was downloaded from the Ensembl website (http: / / asia.ensembl.org / index.html), and primers were designed using the primer design software Primer Premier 6.0. The DNA sequences of the designed primers are shown below:

[0068] Primer P001-F: 5'-CTGTGCTCCATCTGTTTACCCTCTC-3',

[0069] Primer P002-R: 5'-TGTCACAACTTGGAAGCAGCCTAG-3;

[0070] (2) PCR amplification

[0071] Prepare a 10 μL reaction mixture: Add 1 μL of DNA template, 3.4 μL of double-distilled water, 5 μL of 2×Tag PCRStanMix with Loading Dye, and 0.3 μL each of primers P001-F and P002-R to a 10 μL reaction mixture; PCR reaction conditions are as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles; and finally 72℃ extension for 5 min.

[0072] (3) DNA sequencing

[0073] DNA sequence sequencing and identification: Performed at BGI Genomics Co., Ltd. in Shenzhen, with two sequencing reactions (positive and negative). The obtained sequences were compared with the NCBI genome sequence to identify mutations at corresponding SNP sites. The sequencing results are shown below:

[0074]

[0075] Note: M marked in the sequence listing is the mutation site, indicated by an underline (the mutated base in parentheses represents the allele mutation). The positions of the designed primer sequences are indicated by bolding at the beginning and end of the sequence.

[0076] Example 3: Analysis of the T>C effect of SNP sites of molecular markers g.162158624

[0077] Table 1 shows that for the daily weight gain trait of the S21 Duroc breed, the effect of the dominant allele (TT) at the SNP locus g.162158624T>C was significantly higher than the average effect of the CC phenotype by 12.29g. Therefore, by using marker-assisted selection to gradually cull pigs with the CC genotype within the population, the allele frequency of allele T can be significantly increased, thereby improving the daily weight gain of breeding pigs, reducing breeding losses, accelerating the improvement of genetic defects in pigs, and effectively improving the economic benefits of pig breeding.

[0078] This invention utilizes the detection of the mutation site at position 163 in the SEQ ID NO:1 sequence to conduct preliminary association analysis between its genotype and the daily weight gain of breeding pigs, providing a new molecular marker for marker-assisted selection in pigs.

[0079] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a SNP molecular marker located on chromosome 1 of pigs that is associated with daily weight gain in identifying the daily weight gain trait in pigs and in breeding for the genetic inheritance of the daily weight gain trait, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, where M in the sequence is T or C, leading to differences in daily weight gain in pigs; among them, the daily weight gain of pigs with TT genotype and CT genotype is greater than that of pigs with CC genotype. The pigs mentioned are the S21 Duroc pigs and their synthetic lines.

2. A method for screening pig breeds with high daily weight gain using SNP molecular markers located on chromosome 1 of pigs that are associated with daily weight gain, characterized by comprising the following steps: The SNP molecular marker described in claim 1 is detected on chromosome 1 of pigs, wherein the single nucleotide at the SNP site of the molecular marker is C or T, and C is eliminated and T is retained; wherein, the daily weight gain of pigs with TT genotype and CT genotype at the SNP molecular marker is greater than that of pigs with CC genotype; The pigs mentioned are the S21 Duroc pigs and their synthetic lines.

3. The application of a primer pair for identifying SNP molecular markers located on pig chromosome 1 that are associated with daily weight gain in pigs, or a kit for detecting SNP molecular markers located on pig chromosome 1 that are associated with daily weight gain in pigs, in identifying the trait of daily weight gain in pigs, characterized in that: The primer pair comprises primer P001-F and primer P002-R, and their nucleotide sequences are shown below: Primer P001-F: 5' - CTGTGCTCCATCTGTTTACCCTCTC -3', Primer P002-R: 5' - TGTCACAACTTGGAAGCAGCCTAG -3'; The kit described above contains the primer pairs described above; The SNP molecular marker is the SNP molecular marker described in claim 1; wherein, the daily weight gain of pigs with TT and CT genotypes at the location of the SNP molecular marker is greater than that of pigs with CC genotype; The pigs mentioned are the S21 Duroc pigs and their synthetic lines.

4. The application of a primer pair for identifying SNP molecular markers located on pig chromosome 1 that are associated with daily weight gain in pigs, or a kit for detecting SNP molecular markers located on pig chromosome 1 that are associated with daily weight gain in pigs, in marker-assisted breeding of pig daily weight gain trait, characterized in that: The primer pair comprises primer P001-F and primer P002-R, and their nucleotide sequences are shown below: Primer P001-F: 5' - CTGTGCTCCATCTGTTTACCCTCTC -3', Primer P002-R: 5' - TGTCACAACTTGGAAGCAGCCTAG -3'; The kit described above contains the primer pairs described above; The SNP molecular marker is the SNP molecular marker described in claim 1; wherein, the daily weight gain of pigs with TT and CT genotypes at the location of the SNP molecular marker is greater than that of pigs with CC genotype; The pigs mentioned are the S21 Duroc pigs and their synthetic lines.

5. A method for genetic improvement of pigs, characterized in that... It includes the following steps: Identify the SNP molecular markers described in claim 1 for the breeding pigs in the core breeding pig herd, and make corresponding selections based on the molecular markers: select breeding pig individuals with the SNP molecular markers described in claim 1 as TT genotype and TC genotype in the core breeding pig herd, and eliminate breeding pig individuals with the CC genotype, so as to increase the frequency of the allele T at this locus generation by generation, thereby increasing the daily weight gain of the breeding pigs. The pigs mentioned are the S21 Duroc pigs and their synthetic lines.

Citation Information

Patent Citations

  • SNP marker which affects daily weight gain trait of pigs and application thereof

    CN108913779A

  • Single nucleotide polymorphisms (SNP) molecular marker located on porcine chromosome 1 and related to daily gain of pig and application of SNP molecular marker

    CN110541038A