InDel molecular marker related to overgrowth of hooves on pig chromosome 13 and application thereof

Abstract

The application discloses an InDel molecular marker related to overgrowth of a hoof on a pig chromosome 13 and application thereof. A site of the InDel molecular marker corresponds to an AAAG>A mutation at 133526622 bp to 133526625 bp on a chromosome 13 of an international pig reference genome 11.1 version, and genotypes of the InDel molecular marker are AAAG / AAAG, AAAG / A or A / A. By using the InDel molecular marker provided in the application, through molecular marker assisted selection, pigs with genotypes of A / A and AAAG / A in a population are gradually eliminated, so that an allele frequency of an allele AAAG can be obviously increased, an incidence of overgrowth of a hoof of a breeding pig can be reduced, breeding loss can be reduced, improvement of a reproduction trait of a sow can be accelerated, and thus economic benefits of breeding of a breeding pig can be effectively improved.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology and relates to an InDel molecular marker located on pig chromosome 13 that is associated with dewclaw overgrowth and its application. Background Technology

[0002] Dewclaws, as an important component of the pig's limb and hoof structure, can negatively impact the health traits of breeding pigs due to abnormal growth, becoming a significant issue in pig production. Overly long dewclaws in pigs can cause abnormal standing posture and gait in sows, pain and stress, leading to hoof injuries, infections, and even arthritis, which in turn affects the sow's feeding, reproductive, and lactation performance. If breeding sows are prematurely culled during their peak reproductive period due to limb and hoof diseases, they will be unable to achieve their optimal reproductive performance, resulting in severe economic losses for pig farms.

[0003] Currently, the main way to alleviate the symptoms of dewclaw overgrowth is through manual physical trimming. This phenotype-based artificial intervention method is labor-intensive and resource-intensive. The trimming process may also cause stress to sows and secondary damage to the limbs and hooves, and cannot solve the problem at its root. Summary of the Invention

[0004] The purpose of this invention is to provide an InDel molecular marker located on pig chromosome 13 that is significantly associated with dewclaw overgrowth and its application.

[0005] According to a first aspect of the present invention, an InDel molecular marker located on chromosome 13 of pigs, significantly associated with the overgrowth trait of dewclaws, is provided. The site corresponds to a 3-nucleotide (AAG) deletion mutation at positions 133526623 bp to 133526625 bp on chromosome 13 of the International Swine Reference Genome 11.1, or denoted as an AAAG>A mutation at positions 133526622 bp to 133526625 bp on chromosome 13 of the International Swine Reference Genome 11.1. The InDel molecular marker of the present invention is named g.133526622_133526625delinsA, and its genotype is AAAG / AAAG (wild type), AAAG / A (heterozygous deletion), or A / A (homozygous deletion).

[0006] The deletion mutation of AAG on chromosome 13, positions 133526623 bp to 133526625 bp, corresponding to the International Swine Reference Genome Version 11.1, provided by this invention, significantly increases the incidence of dewclaw hyperglycemia in sows. In other words, the InDel mutation provided by this invention is detrimental to dewclaw growth in pigs. By detecting whether pigs carry the InDel molecular marker of this invention, the dewclaw hyperglycemia trait in pigs can be identified. In pig crossbreeding, selecting pigs with the InDel molecular marker genotype AAAG / AAAG can accelerate the breeding process and reduce the incidence of dewclaw hyperglycemia.

[0007] According to a second aspect of the invention, an application is provided for detecting the InDel molecular marker g.133526622_133526625delinsA located on porcine chromosome 13 and associated with dewclaw overgrowth, the application comprising at least one of the following (1) to (4): (1) Identify the dewclaw overgrowth trait in pigs; (2) Prepare products for identifying the overgrowth trait of pig hooves; (3) Pig genetic improvement, based on breeding pigs with the InDel molecular marker genotype AAAG / AAAG of this invention to reduce the incidence of pig dewclaw overgrowth; (4) Prepare a product for assisting in the genetic improvement of pigs, which is based on the identification of the genotype of the InDel molecular marker of the present invention to assist in the genetic improvement of pigs.

[0008] In some embodiments, products for detecting the InDel molecular markers of the present invention may include at least one of the following: reagents, kits, chips, and devices for detecting the InDel molecular markers of the present invention.

[0009] In some embodiments, the reagents used to detect the InDel molecular markers of the present invention may include at least one of the following: primers or probes for detecting the InDel molecular markers of the present invention.

[0010] In some implementations, the pig is a Large White pig.

[0011] According to a third aspect of the present invention, a primer pair for detecting the InDel molecular marker of the present invention is provided, the primer pair comprising an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3.

[0012] The primer pairs provided by this invention can specifically amplify amplified fragments containing or without the InDel molecular marker of this invention. They can be used to detect whether there is a deletion of 3 nucleotides (AAG) in the nucleotide sequence shown in SEQ ID NO:1, from position 206 to 208 from the 5' end, corresponding to positions 133526623 bp to 133526625 bp on chromosome 13 of the International Pig Reference Genome Version 11.1.

[0013] According to a fourth aspect of the present invention, a kit for detecting the InDel molecular marker of the present invention is provided, the kit comprising primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3.

[0014] In some embodiments, the kit for detecting the InDel molecular marker of the present invention may further include: dNTPs, DNA polymerase, and Mg. 2+ Components of a conventional PCR reaction system, such as PCR reaction buffer.

[0015] According to a fifth aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps: (1) Determine the genotype of the InDel molecular marker g.133526622_133526625delinsA located on chromosome 13 of pigs and associated with dewclaw overgrowth; (2) Select individuals with the InDel molecular marker genotype AAAG / AAAG and eliminate individuals with the InDel molecular marker genotype AAAG / A or A / A, thereby reducing the incidence of dewclaw overgrowth in offspring pigs.

[0016] In some implementations, in step (1), the pig is a breeding pig in the core breeding pig herd.

[0017] In some implementations, in step (1), the breeding pig is a Large White pig.

[0018] In some implementations, step (1), determining the genotype of the InDel molecular marker located on chromosome 13 of pigs and associated with dewclaw overgrowth, includes the following steps: Whole-genome DNA was extracted from breeding pigs, and PCR amplification was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3. The amplified products were sequenced, and the genotype of the InDel molecular marker located on chromosome 13 of pigs and associated with dewclaw overgrowth was determined based on the sequencing results.

[0019] Compared with the prior art, the beneficial effects of the present invention include: (1) This invention provides an InDel molecular marker g.133526622_133526625delinsA located on chromosome 13 of pigs and associated with the dewclaw overgrowth trait, and verifies its effect on the dewclaw overgrowth trait of pigs. This invention helps to establish a molecular marker-assisted selection breeding technology for rapid improvement of the dewclaw overgrowth trait of pigs and accelerate the breeding process of Large White pigs.

[0020] (2) The present invention provides a primer pair and kit for detecting the InDel molecular marker g.133526622_133526625delinsA located on chromosome 13 of pigs and associated with the dewclaw overgrowth trait. The primer pair and / or kit can be used to accurately identify whether the pig to be tested carries g.133526622_133526625delinsA, thereby identifying the dewclaw overgrowth trait of pigs.

[0021] (3) This invention provides a genetic improvement method for pigs based on the InDel molecular marker located on chromosome 13 of pigs and associated with dewclaw overgrowth. Using this genetic improvement method, the incidence of dewclaw overgrowth can be reduced generation by generation, and the service life of breeding sows can be increased, thereby helping to improve the economic profit and core competitiveness of pig enterprises. Attached Figure Description

[0022] Figure 1 This is a genome-wide association study (GWAS) plot of the dewclaw overgrowth trait on chromosome 13 in Large White pigs; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents -log P value. Detailed Implementation

[0023] The present invention will be further described in detail below with reference to the embodiments. The embodiments are for illustrative purposes only and do not limit the invention in any way. Unless otherwise specified, the raw materials and reagents used in the embodiments are conventional products that can be obtained commercially; experimental methods that do not specify specific conditions in the embodiments are generally performed under conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0024] Example 1: Identification and Validation of InDel Molecular Markers Associated with Excessive Dewclaw Growth in Pigs (1) Experimental pig herd This invention used a total of 653 Large White sows, and the experimental pig population used was the core resource group of the breeding pig division of Guangdong Wens Foodstuff Group Co., Ltd. All sows were fed and managed using the same nutritional standards and feeding methods.

[0025] (2) Phenotypic measurement This invention employs a direct measurement method for phenotypic determination. All pigs measured were of similar age. With the pigs in a lateral recumbent position, their dewclaws were cleaned. Using calipers, the starting point of the upper edge of the dewclaw root and the apex of the horny tip were manually located, and the straight-line distance between them was directly read and recorded. The classification criteria are as follows: a dewclaw length greater than or equal to 7 cm on either side of the left or right hind hoof indicates dewclaw overgrowth (Case); a dewclaw length less than or equal to 4 cm on both sides of the left and right hind hoofs indicates normal dewclaws (Control). After phenotypic screening, 275 Large White sows meeting the classification criteria were divided into dewclaw overgrowth and normal dewclaw groups for subsequent analysis.

[0026] (3) Extraction of porcine genomic DNA Ear tissues were collected from 275 Large White sows. Whole-genome DNA was extracted using the standard phenol-chloroform method. The concentration and OD ratio (OD260 / 280, OD260 / 230) of each sample were accurately determined using a NanoDrop 2000 / 2000C nucleic acid and protein analyzer. DNA samples that passed the NanoDrop 2000 / 2000C nucleic acid and protein analyzer test were diluted to approximately 50 ng / μL. 6 μL of the extracted DNA sample was then mixed with 2 μL of loading buffer and loaded onto a 1% (w / v) agarose gel. Electrophoresis was performed at 150 V for 25 min. The DNA integrity was observed and photographed using a UV spectrophotometer and gel imaging device. Quality-tested DNA samples were sent to Neocate Biotechnology (Shanghai) Co., Ltd. for whole-genome 80K chip (Illumina Porcine 80K SNP BeadChip) genotyping according to the company's standard procedures.

[0027] (4) Genome-wide genotyping Genotyping of an 80K microarray was performed using the Swine Imputation (SWIM) database platform. Quality control of the imputation data was performed using PLINK v1.90 software, retaining the Hardy-Weinberg equilibrium (HWE) test. P Value greater than 10 -6 The detection rate is greater than 90% and the minimum allele frequency is greater than 5% for variant sites, and variant sites on sex chromosomes are removed.

[0028] (5) Genome-wide association analysis (GWAS) GWAS analysis of the dewclaw overgrowth trait in Large White sows was performed using a univariate mixed linear model in GEMMA v0.98.5. To reduce the false positive rate of GWAS, the Bonferroni correction method was used to determine the significance threshold (the significance threshold at the genome-wide level was 0.05 divided by the number of valid loci, i.e., the significance level threshold was 3.416e-9, or 0.05 / 14637387), and the stratification effect of the study population was assessed using the genome expansion coefficient.

[0029] GWAS analysis results are as follows Figure 1 As shown.

[0030] from Figure 1 It is known that in Large White pigs, there is a locus on chromosome 13 that significantly affects the overgrowth trait of the dewclaw, and the significantly associated InDel is g.133526622_133526625delinsA ( P = 8.750028×10 -37 ).

[0031] (6) Comparison of the distribution of InDel molecular marker (g.133526622_133526625delinsA) genotype frequency and allele frequency in overgrown and normal individuals. The results are shown in Table 1.

[0032] As shown in Table 1, the InDel molecular marker g.133526622_133526625delinsA exhibits polymorphism in the Large White sow population. Comparative analysis between individuals with hoof dysplasia and normal individuals revealed that the A / A genotype had the highest frequency (89.96%) in the hoof dysplasia group, while the AAAG / AAAG genotype had a frequency of 0. Therefore, the A / A genotype is an unfavorable genotype leading to hoof dysplasia in sows. In breeding, the incidence of hoof dysplasia can be reduced by culling A / A type breeding pigs and selecting AAAG / AAAG type breeding pigs.

[0033] Table 1. Genotype frequency distribution of InDel molecular markers among pigs with excessively long dewlaps and normal hooves (number of individuals in parentheses).

[0034] (7) Effect analysis This invention provides an InDel molecular marker that is significantly associated with the trait of excessive hoof growth in pigs. As shown in Table 1, the frequency of the dominant allele AAAAG at the InDel locus g.133526622_133526625delinsA is 0.133 in the population. Therefore, by using molecular marker-assisted selection to gradually eliminate pigs with genotypes A / A and AAAG / A in the population, the allele frequency of the AAAG allele can be significantly increased, the incidence of excessive hoof growth in breeding pigs can be reduced, breeding losses can be reduced, and the progress of improving sow reproductive traits can be accelerated, thereby effectively improving the economic benefits of breeding pigs.

[0035] Example 2: Methods for genetic improvement of pigs The target fragment containing the InDel site, which is significantly associated with dewclaw overgrowth in Large White pigs, is a 305 bp nucleotide sequence from chromosome 13. The specific nucleotide sequence is shown in SEQ ID NO:1, and the primer pairs for PCR amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0036] SEQ ID NO:1 CACTCTAAGGTCCATAAAGAACCTCTATAATTCAACAATTTTAAAAGATAAGATTTACAATTTAAAAATGGACAAAGAATTTGAGTAAACATTTCTCTAAAGAATTTATGTAAATGCTAAAAAAGTACATTAAAAGATATTCAACATTACTCAAAAATCACAAGATACCACTTCACATCCACTAGGACAGCTAGAATTTTTTAAA AAG AAGAATAAAAGAACAAGTGTCGTCAAGGATTTAGAGAAATTGTAACCCTCATACACTGCTAGTAGGAATGTAAAATGGTACGCTCACTGTGGAAAAC The 3 bp long sequence (AAG) marked in the sequence is the missing sequence; the primer binding positions are shown in bold at the beginning and end of the sequence.

[0037] Upstream primer-F: 5'-CACTCTAAGGTCCATAAAGAACC-3' (SEQ ID NO:2); Downstream primer primer-R: 5'-GTTTTCCACAGTGAGCGTAC-3' (SEQ ID NO:3).

[0038] The genetic improvement methods for pigs include the following steps: S1. Determine the genotype of InDel molecular markers associated with dewclaw overgrowth in pigs. (1) Take ear tissue from pigs or tail tissue from piglets, extract the whole genome DNA of pigs using the standard phenol-chloroform method, and then perform quality testing and concentration determination on the extracted DNA.

[0039] (2) PCR amplification Prepare a 10 μL mixture, including: 1 μL DNA template, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O; the PCR mix includes dNTPs, DNA polymerase, and Mg2+. 2+ Components of a conventional PCR reaction system, such as PCR reaction buffer.

[0040] PCR reaction program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 45 s, for a total of 35 cycles, with a final extension at 72℃ for 5 min.

[0041] (3) DNA sequence sequencing identification The PCR amplification products were sequenced, and the gene fragments were sequenced in both forward and reverse reactions. Based on the sequencing results, it was determined whether there was a deletion of 3 nucleotides (AAG) in the nucleotide sequence shown in SEQ ID NO:1 from position 206 to 208 from the 5' end, corresponding to positions 133526623 bp to 133526625 bp on chromosome 13 of the International Swine Reference Genome Version 11.1, and the genotype of the InDel molecular marker of the pig to be tested was determined. S2. Select pigs with the InDel molecular marker genotype AAAG / AAAG and cull pigs with the InDel molecular marker genotype AAAG / A or A / A.

[0042] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. An InDel molecular marker located on pig chromosome 13 and associated with dewclaw overgrowth, characterized in that, The InDel molecular marker site corresponds to the deletion of nucleotide AAG at positions 133526623 bp to 133526625 bp on chromosome 13 of the International Pig Reference Genome Version 11.1, with genotypes of AAAG / AAAG, AAAG / A, or A / A.

2. The application of the product for detecting the InDel molecular marker located on porcine chromosome 13 associated with dewclaw overgrowth as described in claim 1, characterized in that, The application includes at least one of the following items (1) to (4): (1) Identify the dewclaw overgrowth trait in pigs; (2) Prepare products for identifying the overgrowth trait of pig hooves; (3) Pig genetic improvement, based on breeding pigs with the InDel molecular marker genotype AAAG / AAAG to reduce the incidence of pig dewclaw overgrowth; (4) Prepare a product for assisting in the genetic improvement of pigs, the product being based on the identification of the genotype of the InDel molecular marker to assist in the genetic improvement of pigs.

3. The application according to claim 2, characterized in that, The product for detecting the InDel molecular marker associated with dewclaw overgrowth located on porcine chromosome 13 according to claim 1 includes at least one of the following: reagents, kits, chips, and devices for detecting the InDel molecular marker.

4. The application according to claim 3, characterized in that, The reagents used to detect the InDel molecular marker include at least one of the following: primers or probes for detecting the InDel molecular marker.

5. The application according to any one of claims 2 to 4, characterized in that, The pig in question is a Large White pig.

6. A primer pair for detecting the InDel molecular marker located on porcine chromosome 13 associated with dewclaw overgrowth as described in claim 1, characterized in that, The primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of which is shown in SEQ ID NO:2 and the nucleotide sequence of which is shown in SEQ ID NO:

3.

7. A kit for detecting the InDel molecular marker located on porcine chromosome 13 associated with dewclaw overgrowth as described in claim 1, characterized in that, Its composition includes the primer pair as described in claim 6.

8. A method for genetic improvement of pigs, characterized in that, Includes the following steps: (1) Determine the genotype of the InDel molecular marker on chromosome 13 of pigs as described in claim 1 that is associated with dewclaw overgrowth; (2) Select individuals with the InDel molecular marker genotype AAAG / AAAG.

9. The method for genetic improvement of pigs according to claim 8, characterized in that, In step (1), the method for determining the genotype of the pig associated with the InDel molecular marker located on chromosome 13 of the pig according to claim 1, which is related to dewclaw overgrowth, includes the following steps: Whole-genome DNA was extracted from pigs and PCR amplification was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:

3. The amplification products were sequenced, and the genotype of the pigs with the InDel molecular marker located on chromosome 13 of pigs and associated with dewclaw overgrowth, as described in claim 1, was determined based on the sequencing results.

10. The method for genetic improvement of pigs according to claim 8 or 9, characterized in that, The pig in question is a Large White pig.

Images