Traditional Chinese medicine composition and application thereof in preparing antiviral drugs

Abstract

The present application relates to the technical field of traditional Chinese medicine, and particularly relates to a traditional Chinese medicine composition and application thereof in preparation of an antiviral medicine. The present application comprises honeysuckle, stevia leaf, wild chrysanthemum, isatis leaf and osmanthus, and the traditional Chinese medicine composition obtained thereby contains rich plant microRNA, MIR2911, thereby playing a good antiviral effect. Moreover, due to the negative effect of a flavoring agent on active ingredients in a product, the present application improves the prescription, and on the basis of avoiding the addition of a flavoring agent and a preservative, the product of the prescription obtains a good taste and can maintain stable quality for several months.

Description

Technical Field

[0001] This invention relates to the field of traditional Chinese medicine technology, and in particular to traditional Chinese medicine compositions and their application in the preparation of antiviral drugs. Background Technology

[0002] Viral infection refers to the process by which viruses invade the body through various routes and multiply in susceptible host cells. Human viruses are those that can infect or cause disease in humans. The essence of viral infection is the interaction between the virus and the body, and between the virus and susceptible cells. Viral infections often produce varying degrees of damage or viral diseases depending on the type of virus and the individual's condition. Viral pathogenesis begins with invasion of the host and infection of cells, and its pathogenic effects manifest at both the systemic and cellular levels. Common viral diseases include influenza, HIV / AIDS, measles, rubella, mumps, rubella, chickenpox, respiratory viral infections, viral hepatitis, poliomyelitis, other enterovirus infections, Japanese encephalitis, and epidemic hemorrhagic fever.

[0003] The primary treatment for viral infections is antiviral medication. Commonly used antiviral chemical agents include nucleoside analogs, non-nucleoside reverse transcriptase inhibitors, and protease inhibitors. Many traditional Chinese medicine (TCM) herbs also possess antiviral properties. In TCM, herbs with heat-clearing and detoxifying effects are typically selected for treating viral infections, particularly respiratory viruses. TCM herbs often exhibit broad-spectrum antiviral activity and contain a variety of effective substances, enabling multi-target therapy against viral infections. Therefore, further development of TCM herbs that can more effectively treat viral infections is of great significance. Summary of the Invention

[0004] In view of this, the technical problem to be solved by the present invention is to provide a traditional Chinese medicine composition and its application in the preparation of antiviral drugs.

[0005] The traditional Chinese medicine composition provided by this invention consists of honeysuckle, stevia leaves, wild chrysanthemum, indigo leaves, and osmanthus.

[0006] In this invention, the traditional Chinese medicine composition comprises the following components in parts by weight:

[0007] Honeysuckle 3-5 parts;

[0008] Stevia leaves 0.08~0.12 parts;

[0009] Wild chrysanthemum 0.5-2 parts;

[0010] 0.08-0.12 parts of Isatis tinctoria leaves;

[0011] Osmanthus flowers, 0.1-0.5 parts.

[0012] In some embodiments, the composition comprises the following components in parts by weight:

[0013] Honeysuckle 4 parts, stevia leaves 0.1 parts, wild chrysanthemum 0.5 parts, indigo leaves 0.1 parts, and osmanthus 0.2 parts;

[0014] Alternatively, use 4 parts honeysuckle, 0.1 parts stevia leaves, 1 part wild chrysanthemum, 0.1 parts indigo leaves, and 0.2 parts osmanthus.

[0015] Alternatively, use 4 parts honeysuckle, 0.1 parts stevia leaves, 1.5 parts wild chrysanthemum, 0.1 parts indigo leaves, and 0.2 parts osmanthus.

[0016] Alternatively, use 4 parts honeysuckle, 0.1 parts stevia leaves, 2 parts wild chrysanthemum, 0.1 parts indigo leaves, and 0.2 parts osmanthus.

[0017] The present invention also provides:

[0018] The use of the composition of the present invention in the preparation of antiviral products; the antiviral includes anti-Ebola virus, anti-coronavirus or anti-influenza virus.

[0019] The present invention also provides:

[0020] An antiviral product comprising the composition described in this invention.

[0021] The antiviral product of this invention also includes water as a raw material. Experiments show that adding flavoring agents to the composition leads to a significant decrease in the MIR2911 content. Therefore, a good taste can be obtained by relying solely on the appropriate combination of the components without adding any flavoring agents.

[0022] In this invention, the product is an extract, tea bag, compound preparation, oral liquid, syrup, granules, tablets, pills, or capsules; wherein, the compound preparation refers to an oral liquid preparation made by extracting, purifying, and concentrating medicinal materials with water or other solvents using a suitable method (a traditional Chinese medicine compound preparation is a concentrated decoction of a traditional Chinese medicine compound, or an oral liquid preparation made by preparing traditional Chinese medicine extracts with water as a solvent). The capsules are hard capsules or soft capsules. The tablets are oral tablets or oral tablets. In this invention, oral tablets refer to tablets for oral administration; most of the drugs in such tablets are absorbed through the gastrointestinal tract to exert their effects, while some tablets exert their effects locally in the gastrointestinal tract. In some embodiments provided by this invention, the oral tablets are ordinary compressed tablets, dispersible tablets, effervescent tablets, chewable tablets, coated tablets, or sustained-release tablets. This invention also provides:

[0023] The present invention relates to a method for preparing the antiviral product. This method mainly involves pulverizing the composition.

[0024] In this invention, the product is tea bags, and its preparation method includes: pulverizing the composition of this invention to a mesh size of not less than 200 to obtain the contents of tea bags.

[0025] The method for preparing the tea bags also includes the step of packaging the contents in a nylon filter bag. The nylon filter bag has a pore size of not less than 120 μm.

[0026] In this invention, the product is an extract, and its preparation method includes: pulverizing the composition of this invention to a mesh size of not less than 200 mesh, extracting it with 20 to 60 times its weight of water at 80°C to 100°C for 5 to 40 minutes, and then concentrating it to obtain the extract.

[0027] The method for preparing the extract further includes a step of sterilizing the extracted liquid. The sterilization conditions include high-temperature, high-pressure sterilization at 121°C for 3-30 minutes. Preferably, the sterilization conditions include high-temperature, high-pressure sterilization at 121°C for 10 minutes.

[0028] In some embodiments, in the method for preparing the extract, during the water extraction step, the mass of water is 40 times that of the composition. The water temperature is 100°C. The extraction time is 5-6 minutes.

[0029] This invention combines honeysuckle, stevia leaves, wild chrysanthemum, indigo leaves, and osmanthus to obtain a traditional Chinese medicine composition rich in MIR2911, thus exhibiting good antiviral effects. Furthermore, due to the negative impact of flavoring agents on the active ingredients in the product, this invention improves the formulation to achieve a good taste and avoids the need for flavoring agents. In addition, this invention studies the process of making the composition into tea bags or tea beverages, enabling the resulting product to remain stable for several months. Detailed Implementation

[0030] This invention provides a traditional Chinese medicine composition and its application in the preparation of antiviral drugs. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can obviously make modifications or appropriate alterations and combinations to the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0031] The test materials used in this invention are all common commercial products and can be purchased on the market.

[0032] Studies have shown that plant MIR2911 can inhibit the replication of various viruses, including multiple subtypes of influenza virus, Ebola virus, adenovirus, and coronavirus. Recent studies have also shown that MIR2911 can accelerate the recovery of COVID-19 patients. In various embodiments of this invention, the content of MIR2911 is detected, and the detection method includes:

[0033] 1. Sample processing method: Take 1-10g of sample, dissolve in 200ml of boiling water, filter, and extract 50μl of supernatant. Elute with 600μl of water. Extract nucleic acid using the TRizol method.

[0034] 2. qPCR conditions:

[0035] 2.1 The primer and probe sequences are as follows:

[0036] R: gtcgtatccagtgcagggtccgaggtattcgcactggatacgactcccag

[0037] UR: agtgcagggtccgaggtatt

[0038] F:aatacgggggacgggct

[0039] 2.2 The reverse transcription system and qPCR system are shown in Table 1:

[0040] Table 1 Reaction system:

[0041]

[0042] 2.3 The reaction procedure includes:

[0043] 2.3.1 Reverse transcription reaction procedure: (segmented)

[0044] 65℃ 5min→4℃ 2min→4℃+∞→42℃ 60min→70℃ 10min→4℃+∞

[0045] 2.3.2 qPCR reaction program:

[0046] 95℃ for 5 min → 40 cycles (95℃ 10 s → 60℃ 30 s → 72℃ 20 s) → 95℃ 15 s → 60℃ 60 s → 95℃ 30 s

[0047] The invention is further illustrated below with reference to the embodiments (the CT values ​​and concentrations in each table in the embodiments are data obtained from different batches of experiments, therefore the data between different tables are not comparable, and only the data within the table can be compared):

[0048] Example 1: Screening of medicinal slices

[0049] The content of MIR2911 in various Chinese herbal medicines that are both food and medicine and have antiviral or heat-clearing and detoxifying effects was detected, and prescription materials were screened based on the MIR2911 content of each herbal medicine. The test data (Table 2-1) show that the MIR2911 content varies among the Chinese herbal medicines, with honeysuckle having the highest content, followed by wild chrysanthemum, green tea, and indigo leaves.

[0050]

[0051] Formula research was conducted based on the top five tea leaves with the highest MIR2911 content. Green tea leaves were discarded in subsequent formula studies due to the diverse sources and significant variations in active ingredients, which made quality control difficult. Furthermore, stevia leaves, a common flavoring agent in herbal teas, are characterized by high sweetness and low calories; and during the screening of tea leaves, the inventors were surprised to find that they also contain a high level of MIR2911, potentially possessing antiviral activity, and therefore included them in the formula. The candidate formula ingredients include: honeysuckle, stevia leaves, wild chrysanthemum, indigo leaves, and osmanthus. Finally, the inventors unexpectedly discovered that, using the same process and extracting the same weight of the composition with honeysuckle, the final extract of MIR2911 from the composition was slightly higher than that from honeysuckle, and the viral inhibition effect of the composition extract was significantly better than that of honeysuckle.

[0052] Example 2: Preliminary study on the dissolution process based on honeysuckle

[0053] A preliminary dissolution process study was conducted based on honeysuckle to investigate the effects of different raw material particle sizes, extraction times, extraction-to-liquid ratios, and extraction temperatures on the dissolution efficiency of the active ingredient MIR2911. Finally, the main parameters of the preliminary dissolution process were determined.

[0054] 2.1 Research on Grinding Technology

[0055] Honeysuckle slices were powdered using three methods: hand grinding, high-speed blending, and pulverizing. The particle size after hand grinding was less than 30 mesh, after high-speed blending the particle size was approximately 50 mesh, and after pulverizing the particle size was approximately 150 mesh. These samples were then soaked and the dissolution rate of MIR2911 was measured. As shown in Table 3, the results indicate that finer particle sizes lead to easier dissolution. Considering production feasibility, the particle size should not be lower than 200 mesh.

[0056]

[0057] 2.2 Study on the feed-liquid ratio

[0058] Study on variable-material (honeysuckle) and fixed-liquid (extract) extraction: The volume of the extract was fixed at 200ml, and the amount of honeysuckle added was continuously increased to study the upper limit of leaching. Data (Table 4) shows that the upper limit of honeysuckle extraction with 200ml of extract is approximately 5g. At this point, further increasing the amount of honeysuckle added has no contribution to leaching. Simultaneously, while maintaining a constant material-to-liquid ratio, a scale-up study was conducted at a ratio of 6. Data (Table 4) shows conclusions that are basically consistent with the previous findings, with an upper limit of 4g.

[0059]

[0060] Study on the ratio of honeysuckle powder to extract: In previous studies on sample processing methods, it was found that when the ratio of powdered honeysuckle to pure water was too high, the detection results exceeded the optimal range of the PCR method, making further research impossible. The highest measured powder-to-water ratio was 1:20. In this part of the study, the amount of honeysuckle was fixed at 1g, and the effect of different volumes of extract on the extraction effect was investigated. Data (Table 5) shows that the sample detection was effective and showed concentration differences within the powder-to-water ratio range of 1:1600. However, the detection value at 1:1600 was close to the water background and was no longer considered. The dissolution was basically stable and saturated between 1:100 and 1:200. Therefore, a powder-to-water ratio of 1:(100-200), or even higher, is preferable, but should be lower than 1:20. That is, the dissolution is effective, stable, and close to saturation when the ratio of honeysuckle to extract is in the range of 1:(100-200) to 1:20.

[0061]

[0062] 2.3 Study on leaching temperature

[0063] The study investigated the effects of two process temperatures, 70℃ and boiling water, on the dissolution of MIR2911. Boiling water showed a significant advantage in dissolution (Table 6).

[0064]

[0065] 2.4 Comparison of boiling and soaking methods

[0066] Front-end process research suggests that simply steeping in boiling water is sufficient to meet the leaching requirements of MIR2911 in the product, and the leaching effect is good. To find a better method, the leaching difference of MIR2911 was compared between soaking and boiling. Data (Table 7) shows that there is no difference in the leaching amount of MIR2911 between the two methods. Considering ease of use and extraction cost, the boiling water steeping process was selected.

[0067] 2.5 Study on soaking time

[0068] Based on the selected method of use, namely brewing with boiling water, the effect of steeping time on the extraction of MIR2911 from the product was studied. Data (Table 7) showed that steeping time within 4 minutes significantly improved product dissolution. Therefore, the optimal steeping time was selected as 2–8 minutes.

[0069]

[0070] Within the optimal soaking time range, extreme values ​​were taken for multiple sample retests to observe the process stability. The test data (Table 8) showed that the process was stable with small differences; therefore, it is recommended to soak the powder in boiling water for 2-8 minutes.

[0071]

[0072] This embodiment confirms that the preliminary optimal extraction process conditions based on honeysuckle as a single raw material include: the raw material particle size is not less than 200 mesh, the ratio of raw material to leachate is greater than 1:(100-200) and less than 1:20, and the extraction temperature and time are preferably soaking in boiling water for 2-8 minutes.

[0073] Example 3: Study on the combination and its preparation process

[0074] In this embodiment, under the preliminary optimal extraction process conditions, the formulation was studied, and the final selected combination ratio was: honeysuckle 82%, stevia leaf 2%, wild chrysanthemum 10%, indigo leaf 2%, and osmanthus 4%; and the preparation process of the combination was further determined.

[0075] 3.1. Research on Combination Formulations

[0076] Based on the findings in section 2.2, the upper limit of extraction of honeysuckle, the main ingredient, in 200 ml of extract was further verified, and the results are shown in Table 9. The results show that the optimal weight of honeysuckle in the compound formulation remains 4 g.

[0077]

[0078] Based on the above results, further research was conducted on various formulation combinations with honeysuckle weighing 4g and other ingredients weighing different amounts. The results are shown in Table 10. The results showed that when the honeysuckle content was 4g, the combination of 0.1g stevia leaves, 0.5g wild chrysanthemum, 0.1g indigo leaves, and 0.2g osmanthus flowers resulted in the best dissolution effect of active ingredients.

[0079]

[0080] To maximize the dissolution of the active ingredient MIR2911 in the combination, the preparation process was further verified and optimized based on the preliminary dissolution preparation process of honeysuckle. The research content included:

[0081] 3.2 Selection of raw material particle size

[0082] Weigh out the composition of "honeysuckle (4g) + stevia leaf (0.1g) + wild chrysanthemum (0.5g) + indigo leaf (0.1g) + osmanthus (0.2g)", pulverize for 10s, 15s, 20s, and 30s, then place in a tea bag, add 200ml of 100℃ pure water, and soak for 20min. The extract was then subjected to MIR2911 extraction and detection. The results are shown in Table 11. The results show that the active ingredient dissolution effect was best when pulverized for 10s.

[0083]

[0084] 3.3 Selection of Leaching Solution Ratio

[0085] Weigh the above-mentioned composition, pulverize it for 20 seconds, place it in a tea bag, and add 100ml, 150ml, 200ml, 250ml, 300ml, and 1600ml of pure water at 100℃. After soaking for 20 minutes, extract and detect MIR2911 in the extract. The detection results are shown in Table 12. The results show that when the ratio of honeysuckle composition to extract is 1:20 to 1:60, the components dissolve effectively, stably, and nearly to saturation. This result is consistent with previous conclusions.

[0086]

[0087] 3.4 Selection of Leachate Temperature

[0088] Weigh the above-mentioned composition, pulverize it for 10 seconds, place it in a tea bag, add 200 ml of pure water at 100℃, 95℃, 90℃, 85℃, and 80℃, soak for 5 minutes, and then extract and detect MIR2911 in the extract. The detection results are shown in Table 13. The results show that the temperature of the extract has no significant effect on the extraction of active ingredients within the range of 80℃ to 100℃.

[0089]

[0090] 3.5 Selection of leaching time

[0091] Weigh the above-mentioned composition, pulverize it for 10 seconds, place it in a tea bag, add 200 ml of 100°C pure water, and soak for 5 min, 10 min, 15 min, 20 min, and 25 min. Then, extract and detect MIR2911 in the extract. The results are shown in Table 14. The results show that increasing the soaking time did not significantly contribute to the extraction of the active ingredient; a 5-minute soaking time yielded the best results, which is consistent with previous conclusions.

[0092]

[0093] This embodiment confirms that the optimized preparation process parameters include: raw material particle size of 200 mesh to 20 mesh, leaching material-to-liquid ratio of 1:(20~60)-1:320, soaking temperature of 80℃ to 100℃, and soaking time of 5 to 10 minutes. Under these process conditions, the extraction effect is optimal and stable.

[0094] Example 4. Comparison of extraction effects of honeysuckle alone and compound preparation MIR2911

[0095] Weigh out the compound formula containing "honeysuckle (4g) + stevia leaf (0.1g) + wild chrysanthemum (0.5g) + indigo leaf (0.1g) + osmanthus (0.2g)" and the single formula containing "honeysuckle (4.9g)". Grind each ingredient for 10 seconds, place them in tea bags, add 200ml of 100℃ pure water, and steep for 5 minutes. Then, extract and detect the MIR2911 in the extract. The results are shown in Table 15. The results show that the compound formula is superior to the single formula.

[0096]

[0097] As can be seen from this embodiment, when the same weight of the above-mentioned composition and honeysuckle are extracted using the same process, the extraction effect of the composition is better than that of honeysuckle alone.

[0098] Example 5: Preparation of Tea Bags and Product Quality Standards and Stability

[0099] This embodiment prepares tea bags using the following raw material formula: 4-8g honeysuckle, 0.1-0.2g stevia leaves, 0.5-1g wild chrysanthemum, 0.1-0.2g indigo leaves, and 0.2-0.4g osmanthus flowers. The above raw materials are uniformly pulverized to the particle size range described in Example 3, placed in a clean packaging bag, and sealed. The packaging bag can be filter paper or a nylon filter bag with a pore size of not less than 120μm, with a nylon filter bag being the most preferred. The tea bag is used by placing it in 200ml of boiling water, steeping for 5-10 minutes, and drinking at once.

[0100] 5.1 Effect of different packaging bags on the dissolution of MIR2911

[0101] This study investigated three commonly used packaging bag materials in the market: non-woven fabric, nylon, and filter paper. Bags with a mesh size of approximately 120 mesh were selected for the experiment. Twelve tea bags of each material were prepared and steeped for 2 minutes, and the MIR2911 content was measured. Data (Table 17) showed that nylon filter bags performed best, followed by filter paper, with non-woven fabric showing the worst performance. Based on the material characteristics, all three materials are considered suitable for filter bags, with filter paper and nylon filter bags having the best pore size (at least 120 μm) being preferred, and nylon filter bags being the most optimal choice.

[0102]

[0103] 5.2 Comparison of effects of different usage methods

[0104] The above formula was steeped in boiling water of different volumes for 5 minutes, and the MIR2911 content was then measured. The data (Table 16) show that steeping in boiling water up to 200 ml can maintain a stable near-saturation state, while the concentration is lower after steeping in 1600 ml.

[0105]

[0106] 5.3 Quality Standards and Stability of Tea Bags

[0107] After a month of repeated extractions by multiple operators, 36 tea bag data sets (Table 18) were collected, and the factory inspection index MIR2911 was set to be less than 16.79 CT+2 SD.

[0108]

[0109] The study lasted four months (Table 19). The tea bag content remained stable in the first two months. The content began to decrease in the third and fourth months, which may be due to a shift in the overall data caused by a decrease in the system background.

[0110]

[0111] This embodiment confirms that the tea bags prepared and used according to the method have a product quality standard of MIR2911 CT value not greater than 16.79 CT + 2 SD and a stable shelf life of 2 months.

[0112] Example 6: Preparation of Beverages and Product Quality Standards and Stability

[0113] In this embodiment, the beverage is prepared using the same raw material formula as in Example 3. The preparation method includes: crushing the raw materials to the range described in Example 3, then extracting them according to the optimal extraction process parameters described in Example 3, and finally adjusting the volume, sterilizing at high temperature and pressure, and bottling to obtain the beverage.

[0114] The high-temperature and high-pressure sterilization process used in this embodiment can effectively preserve the active ingredient MIR2911.

[0115] 6.1 The effect of sterilization on active ingredients

[0116] Considering that beverages generally employ post-sterilization processes, requiring the product to undergo a high-temperature and high-pressure process, an experiment was designed to study the impact of this process on the composition of MIR2911. Data (Table 20) shows that high-temperature and high-pressure sterilization at 121℃ for 30 minutes has almost no effect on the composition.

[0117]

[0118] This embodiment does not use flavor additives to avoid damaging the active ingredient MIR2911.

[0119] 6.2 Effects of flavoring blends on active ingredients

[0120] Flavoring additives A and B were added to the beverage concentrate for flavoring. After stirring evenly, the MIR2911 content was measured. The results showed that the flavoring additives had a significant impact on the detection and could not properly assess the MIR2911 content (Table 21). Therefore, the beverage preparation process uses a compound of traditional Chinese herbal medicine slices, terminal sterilization, and no food additives are added.

[0121]

[0122] Quality standards and stability of beverage products:

[0123] Over a period of two months, 54 samples were studied, with multiple participants involved in the testing. The final standard for beverages was established as a MIR2911 CT value of less than 17.84CT + 1.2SD.

[0124]

[0125] Beverage stability: A 3-month study (Table 23) confirmed that the MIR2911 content in the beverage remained stable during the first three months.

[0126]

[0127] The beverage product prepared in this embodiment is preferably produced by compounding Chinese herbal medicine slices, terminal sterilization, and without adding food additives; the factory standard is that the MIR2911 CT value is not greater than 17.84CT+1.2SD, and the product can remain stable for 3 months.

[0128] Example 7: Detection of MIR2911 content in commercially available products

[0129] Sample preparation method: For all drugs, the single oral dose was dissolved in 200ml of water. For traditional Chinese medicine, 1g was dissolved in 300ml of boiling water and pulverized. (250μl extraction, 60μl elution). The test results are shown in Table 24.

[0130]

[0131] The results showed that honeysuckle has an absolute advantage in MIR2911 content. Among the food / medicines on the market, only cold medicine tablets have a considerable content, but the MIR2911 content is at least 10 times lower than that of honeysuckle slices. Moreover, compared with the tea bags or tea beverages prepared by this invention, the MIR2911 content is significantly insufficient.

[0132] Example 8: The MIR2911 contained in the formulation can effectively enter the animal body.

[0133] Six SD rats were randomly divided into two groups. The control group was fed a standard diet, while the experimental group received drinking water containing the formulation of this invention. After three consecutive days of administration, the rats were sacrificed, and ocular blood and lung tissue samples were collected. Total RNA was extracted from the samples using the TRIZOL method, and the content of MIR2911 was detected by qPCR. The results are as follows:

[0134] Table 25

[0135]

[0136] This embodiment confirms that MIR2911 contained in the formulation of the present invention can be effectively administered to animals via oral administration.

[0137] Example 9: Verification of the inhibitory effect on Ebola virus

[0138] Reporter plasmids for Ebola virus GP and VP40 luciferase were prepared. The recombinant luciferase plasmid and the β-galactosidase reporter plasmid were co-transfected into 293T cells (the β-galactosidase reporter plasmid was used to determine transfection efficiency). Simultaneously, RNA extracted from the formulation of this invention (rich in MIR2911) was co-transfected into 293T cells. After 24 hours, luciferase activity was detected using a luciferase activity assay kit. The inhibition of luciferase activity was 53.4% ​​± 1.3% and 56.1% ± 3.2%, confirming the anti-Ebola virus potential of MIR2911 in the formulation of this invention.

[0139] Example 10: Verification of the inhibitory effect on the novel coronavirus

[0140] After resuscitation, 293T cells were cultured to the logarithmic growth phase, then plated and seeded into 96-well plates at a density of 1.25 x 10⁶ cells per well. 4 293T cells were transfected with 2.5 μg / well of SARS-CoV-2 N-protein particles every other day. 24 hours after transfection, RNA extracted from the preparation at different concentrations (0-160 ng) was added. The content of MIR2911 in the cells was detected by qPCR at different time points of 0h, 6h, 24h and 48h to determine whether MIR2911 from the preparation effectively entered the cells. Then, the SARS-CoV-2 N-protein in the 293T cells was detected by ELISA kit to verify the anti-SARS-CoV-2 effect of MIR2911 in the preparation.

[0141] The results of the detection of MIR2911 content in cells are shown in the table below:

[0142] Table 26

[0143]

[0144] The results showed that the intracellular concentration of MIR2911 exhibited a certain transfection dose-dependent effect. Within the transfection range of 10-160 ng, higher transfection concentrations resulted in more nucleic acids entering the cells. In the single-dose group, the MIR2911 concentration also showed a decreasing trend with prolonged transfection time.

[0145] The results of ELISA detection of N protein expression levels in cells are shown in the table below:

[0146] Table 27

[0147]

[0148] The results showed that RNA transfection significantly inhibited N protein expression, and the inhibitory effect was correlated with both transfection concentration and time.

[0149] This embodiment confirms that the formulation of the present invention can effectively inhibit the novel coronavirus.

[0150] Example 11: Verification of the inhibitory effect on influenza A virus

[0151] After resuscitation, 293T cells were cultured to the logarithmic growth phase, then plated and seeded into 96-well plates at a density of 1.25 x 10⁶ cells per well. 4 293T cells were transfected with 2.5 μg / well of H1N1 influenza virus M2 protein particles every other day. 24 hours after transfection, RNA extracted from the preparation (rich in MIR2911) at different concentrations (0-160 ng) was added. The content of MIR2911 in the cells was detected by qPCR at different time points of 0h, 6h, 24h and 48h to determine whether MIR2911 from the preparation effectively entered the cells. Then, the H1N1 influenza virus M2 protein was detected in 293T cells using an ELISA kit to verify the anti-H1N1 influenza virus effect of MIR2911 in the preparation.

[0152] The detection results of MIR2911 in cells are shown in the table below:

[0153] Table 28

[0154]

[0155] The results of ELISA detection of M2 protein expression levels are shown in the table below:

[0156] Table 29

[0157]

[0158] The results showed that RNA transfection significantly inhibited M2 protein expression, and the inhibitory effect was correlated with both transfection concentration and time.

[0159] This embodiment confirms that the formulation of the present invention can effectively inhibit influenza A virus.

[0160] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of a traditional Chinese medicine composition in the preparation of antiviral drugs, wherein the traditional Chinese medicine composition comprises the following components in parts by weight: Honeysuckle 4 parts, stevia leaves 0.1 parts, wild chrysanthemum 0.5 parts, indigo leaves 0.1 parts, and osmanthus 0.2 parts; The antiviral agents mentioned are those against Ebola virus, COVID-19 virus, or influenza A virus.

2. The application according to claim 1, characterized in that, The traditional Chinese medicine composition also includes water; the dosage form of the medicine is tea bags, extracts, mixtures, oral liquids, syrups, granules, tablets, pills, or capsules.

3. The application according to claim 2, characterized in that, The preparation method of the drug is as follows: the composition according to claim 1 is pulverized to a mesh size of not less than 200 to obtain the contents of tea bags.

4. The application according to claim 2, characterized in that, The preparation method of the drug is as follows: the composition according to claim 1 is pulverized to a mesh size of not less than 200 mesh, then extracted with 20 to 60 times its weight of water at 80°C to 100°C for 5 to 40 minutes, and then concentrated to obtain an extract.

5. The application according to claim 4, characterized in that, The preparation method further includes the step of mixing the extract with water.

6. The application according to any one of claims 3 to 5, characterized in that, The preparation method of the drug also includes a sterilization step, wherein the sterilization conditions include high temperature and high pressure sterilization at 121°C for 3-30 minutes.

Images