A method for breeding silky yellow chicken

Abstract

The invention discloses a breeding method for silk feather yellow chicken, and hybridizes GC piece feather heterozygous roosters and GC piece feather heterozygous hens in the initial breeding yellow chicken population to obtain an F1 generation population; the silk feather individuals of the F1 generation population are screened by appearance characteristics, and the feather genotypes of the remaining individuals are detected, and the F1 generation silk feather roosters are used as male parents and the F1 generation silk feather hens are used as female parents to hybridize to obtain an F2 generation population; the mitochondrial DNA D-loop sequences of F0 and F2 generation individuals are measured, haplotypes and haplotype groups are defined, the haplotypes and group compositions and their proportions of the F2 generation silk feather chicken population and the non-silk feather population are compared, and the F2 generation silk feather roosters are used as male parents, and the silk feathers or GC piece feather heterozygous hens of the genotypes that are not compared with the F2 generation silk feather population are hybridized as female parents to obtain an F3 generation silk feather population. The present invention purifies and amplifies the silk feather traits from the original yellow chicken population, and obtains a new silk feather yellow chicken population without changing the genetic attributes and genetic potential of the breeding population, which can create greater economic value.

Description

Technical Field

[0001] The invention relates to the technical field of poultry breeding, and in particular to a breeding method for silky yellow chickens. Background Art

[0002] Yellow chicken, also known as yellow-feathered chicken or yellow-feathered broiler, refers to a chicken breed with a beautiful appearance of "three yellows" (yellow hair, yellow feet, and yellow skin) or yellow jute feathers, a unique meat flavor, and is widely welcomed by consumers. It has long occupied half of my country's broiler market. my country has a rich variety of local yellow chickens (also known as high-quality broilers), which are important livestock and poultry genetic resources and characteristic broiler breeds with great industrial advantages. There are more than 60 recorded in the "China Livestock and Poultry Genetic Resources: Poultry" alone.

[0003] Silky-feather chicken or silky-feather chicken is a relatively rare chicken breed. There are only three types of silky-feather chicken (Taihe black-bone chicken), Jinyang silky-feather chicken and Lanping down-feather chicken included in the "Chinese Livestock and Poultry Genetic Resources: Poultry". Silky-feather is an autosomal recessive trait. Research results show that it is caused by a base mutation upstream of the start codon of the PDSS2 gene on chromosome 3 of chicken (chr3:70486623, C→G) (Feng CG, Gao Y, Song C, et al. A cis-regulatory mutation of PDSS2 causessilky-feather in chickens. PLoS genetics, 2014, 10(8):e1004576). This mutation reduces the promoter activity of the PDSS2 gene, resulting in a significant decrease in the expression level of the skin during the embryonic period, resulting in the failure of the feather hook to form normally. Based on the research results, a method for SNP detection and screening of silk feather traits in chickens was formed. This method detects single nucleotide polymorphisms at the 70486623bp site on chromosome 3 of chickens, and determines the feather traits of chickens based on genotypes: GG is a silk feather genotype, showing silk feathers; while genotypes CC and GC both show flake feathers (Hu Xiaoxiang, Feng Chungang, Song Chi, et al. Method for SNP detection and screening of silk feather traits in chickens. ZL201210348358.4). Genotype GC is a heterozygous type, which provides a theoretical basis for the identification of genetic materials for breeding silk feather chicken varieties.

[0004] Competitive allele-specific PCR (KASP) is a competitive allele-specific PCR based on fluorescent signals, which can accurately determine the double alleles of SNPs (Single Nucleotide Polymorphisms) and InDels (Insertion and Deletion) at specific sites in a wide range of genomic DNA samples. Compared with traditional PCR, it has the advantages of high throughput, low cost, high efficiency, strong flexibility, high accuracy and good stability. Therefore, the development of molecular markers for identifying silk feather traits based on KASP technology for screening heterozygous silk feather genotypes is of great value to improving the breeding efficiency of silk feather yellow chickens. Summary of the invention

[0005] In view of the fact that there are few silk-feather chicken / silky chicken varieties in the prior art and that existing silk-feather chicken breeding methods are all based on hybridization and breeding between different varieties, the present invention provides a method for breeding silk-feather yellow chickens from a single yellow-feather chicken variety.

[0006] Yellow feathers and silky feathers are characteristics favored by consumers. If the appearance characteristics of the two can be combined without changing their production performance and genetic potential, a new breed (strain) for both egg and meat can be cultivated, or it can be put on the market as a pet chicken, which can create greater economic value. Therefore, the present invention fixes the appearance characteristics of yellow feathers and silky feathers through intra-breed hybrid breeding, thereby maintaining the original production performance and genetic potential of yellow chickens.

[0007] In order to achieve the above object, the present invention provides a method for breeding silky yellow chickens, comprising the following steps:

[0008] (1) using competitive allele-specific PCR to detect the feather genotype of individuals in the initial breeding group of yellow chickens, obtaining GC-feather heterozygous roosters and GC-feather heterozygous hens to form an F0 generation group, and hybridizing the GC-feather heterozygous roosters and GC-feather heterozygous hens to obtain an F1 generation group;

[0009] (2) screening the silk-feathered individuals in the F1 generation population by appearance characteristics, and detecting the feather genotypes of the remaining individuals to obtain F1 generation silk-feathered roosters and F1 generation silk-feathered hens; avoiding inbreeding, using the F1 generation silk-feathered roosters as the male parent and the F1 generation silk-feathered hens as the female parent for crossbreeding, and obtaining an F2 generation population;

[0010] (3) Screening the F2 generation population by appearance characteristics, forming the F2 generation silky-feathered chicken population with the silky-feathered individuals and the remaining individuals forming the non-silky-feathered population;

[0011] (4) Determine the mitochondrial DNA D-loop sequence of F0 generation individuals and F2 generation individuals, define DNA haplotypes and haplotype groups, compare the mitochondrial DNA haplotypes and group composition and their proportions between the F2 generation silk-feather chicken population and the non-silk-feather population, use the F2 generation silk-feather rooster as the male parent to avoid inbreeding, and use the GC-flap-feather heterozygous hens or silk-feather hens of a genotype that is not present in the F2 generation silk-feather population as the female parent for hybridization to obtain the F3 generation population.

[0012] In the step (1), KASP primers are used to detect whether the non-silk feather individuals of the F0 generation have the silk feather genotype GC:

[0013] silkyF1:

[0014] 5'- GAAGGTGACCAAGTTCATGCT GGAGAGCCGCGCTGCCTCGCTTTAG-3', where the underlined part is the FAM fluorescent tag sequence;

[0015] silkyF2:

[0016] 5'- GAAGGTCGGAGTCAACGGATT GGAGAGCCGCGCTGCCTCGCTTTAC-3', where the underlined part is the HEX fluorescent tag sequence;

[0017] silkyR: 5'-GGGGCAGCCATCTTGCGCGTCGCACACGG-3';

[0018] If the fluorescence signal is FAM, the molecular marker of the amplified product is of GG type, and the sample to be tested is identified as a silk feather homozygote, showing silk feather traits; if it is HEX, the molecular marker of the amplified product is of CC type, and it is identified as a leaf feather homozygote, showing leaf feather traits; if it is FAM and HEX, the molecular marker of the amplified product is of GC type, and it is identified as a leaf feather heterozygote, showing leaf feather traits.

[0019] Furthermore, in the step (1), selecting a group in which silky feather individuals have appeared as the initial breeding group of yellow chickens can improve the breeding success rate and accelerate the breeding speed.

[0020] Furthermore, in step (1), in order to speed up the breeding process, the roosters are tested for the presence of the silky feather gene before being kept for breeding, and the GC-feather heterozygous roosters are kept as breeding roosters.

[0021] Furthermore, in step (2), if there are limited silky-feather individuals in the F1 generation group, a silky-feather rooster can be used as the male parent and a GC-feather heterozygous hen can be used as the female parent for hybridization, and the silky-feather individuals can be selected by their appearance characteristics, which can speed up the breeding process.

[0022] In the step (3), primers for PCR amplification of the chicken mtDNA D-loop partial sequence are:

[0023] L16750: 5'-AGGACTACGGCTTGAAAAGC-3';

[0024] H522: 5'-ATGTGCCTGACCGAGGAACCAG-3'.

[0025] In the present invention, the breeding process is carried out according to the family succession breeding method to avoid inbreeding, and wing numbers are worn when the eggs are hatched, while the growth, reproduction and other data are recorded.

[0026] In the steps (1) to (4) of the present invention, in the process of screening hybrid offspring, individuals that do not match the appearance characteristics of the breeding group, such as feather color, are first eliminated. Then, according to the breeding goal, such as dual-purpose meat and egg type, individuals with growth performance and egg-laying performance not lower than the average level are selected. The selection direction of pet chickens is preferably small in size, but with growth performance and egg-laying performance not lower than the bottom 20%.

[0027] The present invention also includes a population expansion step, i.e., repeating steps (2) to (4) 1-2 times according to the breeding goal, to obtain a population of no less than 10 families, a male-to-female ratio of 1:8, and mitochondrial DNA haplotypes and haplotype groups comparable to those of the initial breeding population.

[0028] The present invention uses KASP genetic marker technology to purify and amplify the silk feather trait from the original population, and uses family selection breeding method, mitochondrial DNA haplotype detection and other technologies to obtain a new silk feather yellow chicken population without changing the genetic attributes and genetic potential of the breeding population, which can create greater economic value. This method can also be applied to other chicken breeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Design diagram of primers for silk feather KASP identification;

[0030] The bold G / C is the diagnostic site for silk feather traits, and the underlined parts are the upstream and downstream primer design regions, respectively.

[0031] Figure 2 Allelic typing diagram for silk feather traits;

[0032] Blue represents the GG genotype, red represents the CC genotype, and green represents the GC genotype.

[0033] Figure 3 Sequencing peak diagram of silk feather trait mutation sites;

[0034] A is the GG genotype, B is the GC genotype, and C is the CC genotype.

[0035] Figure 4 Embodiment 2 of the present invention provides images of a rooster and a hen of a Wuhua three-yellow chicken with a patch of feathers.

[0036] Figure 5 Images of roosters and hens of the silk-feathered Wuhua Sanhuang chicken bred in Example 2 of the present invention.

[0037] Figure 6 An image of a population of silk-feathered Wuhua Sanhuang chickens bred in Example 2 of the present invention. DETAILED DESCRIPTION

[0038] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention.

[0039] Example 1: Establishment of KASP Identification Technology for Silk Feather Type

[0040] The 200 bp sequence of the upstream base mutation (chr3:67850419:C / G) site of the start codon of the PDSS2 gene on chromosome 3 was obtained from the NCBI website (https: / / www.ncbi.nlm.nih.gov / genome / gdv / ?org=gallus-gallus) (reference genome version number is GRCg6a, GCF_000002315.6), and competitive primers for the mutation site were designed according to the KASP technical principle ( Figure 1 ).

[0041] KASP primers for silk feather trait detection:

[0042] silkyF1:

[0043] 5'-GAAGGTGACCAAGTTCATGCTGGAGAGCCGCGCTGCCTCGCTTTAG-3', where the underlined part is the FAM fluorescent tag sequence;

[0044] silkyF2:

[0045] 5′-GAAGGTCGGAGTCAACGGATTGGAGAGCCGCGCTGCCTCGCTTTAC-3′, where the underlined part is the HEX fluorescent tag sequence;

[0046] silkyR: 5'-GGGGCAGCCATCTTGCGCGTCGCACACGG-3'.

[0047] The newly synthesized primers were dissolved and diluted to 50 μM in TE buffer (pH 8.0), and then mixed with upstream typing primer 1 (silkyF1), upstream typing primer 2 (silkyF2) and downstream universal primer (silkyR) in a volume ratio of 1:1:3 and loaded onto the machine. The total reaction system for PCR amplification was 10 μL: 1 μL of the sample template DNA to be tested, 0.125 μL of primer mixture, 5 μL of FLU-ARMSfor KASP 2X PCR mix (STO Rox), ddH 2 O 3.875μL. The reaction procedure of PCR amplification was: pre-denaturation at 94℃ for 10min; denaturation at 95℃ for 20s, annealing and extension at 61℃~55℃ for 60s, 10 cycles, the temperature of annealing and extension decreased by 0.6℃ in each cycle; denaturation at 94℃ for 20s, annealing and extension at 55℃ for 60s, 30 cycles. The PCR product was detected by fluorescence signal using the fluorescence quantitative PCR instrument TIANLONG TL988: fluorescence reading at 37℃ for 1min.

[0048] The classification results are as follows Figure 2 As shown, the red fluorescence is FAM, which is the GG type of silk feather traits; the blue HEX is the homozygous CC type of leaf feathers; the green is the heterozygous GC type, of which 18 are GG, 23 are GC, and 51 are CC. The KASP identification results are consistent with the sequencing typing results ( Figure 3 ).

[0049] Embodiment 2: the breeding of silk feather type Wuhua three yellow chicken

[0050] Wuhua Sanhuang Chicken is the only excellent local chicken breed in Meizhou, the Soviet area. It has the "three yellow" characteristics, namely yellow hair, yellow feet, yellow skin, and white tail feathers, and has a unique appearance and high-quality flavor ( Figure 4 ). During the process of resource protection, very few silky feathered offspring of Wuhua Sanhuang chicken were found. According to the genetic formation mechanism of silky feather traits, it is shown that both parents have silky feather heterozygous individuals, which provides a theoretical basis for breeding silky feathered Wuhua Sanhuang chicken.

[0051] 1. Preparation of breeding population

[0052] (1) A core group of 1058 12-week-old Wuhua Sanhuang chickens was used as the initial breeding group, venous blood was collected, and genomic DNA was extracted. Typing was performed using the judgment method established in Example 1, and the obtained GC piece-feather heterozygous roosters and GC piece-feather heterozygous hens constituted the F0 generation group. During the process, the presence of the silk feather gene was detected in the breeding roosters before they were kept for breeding, and the GC piece-feather heterozygous roosters were kept as breeding roosters.

[0053] The GC leaf-feather heterozygous individuals screened out above, namely GC leaf-feather heterozygous roosters and GC leaf-feather heterozygous hens, were used as parents for the hybridization experiment. Through a series of work such as artificial insemination, hybridization, egg picking, hatching, brooding, rearing, growth and reproductive performance recording, the hybrid breeding offspring of Wuhua Sanhuang Chicken were statistically analyzed to obtain the F1 generation group.

[0054] (2) Screening the silk-feathered individuals in the F1 generation population by appearance characteristics, and detecting the feather genotypes of the remaining individuals to obtain F1 generation silk-feathered roosters and F1 generation silk-feathered hens; avoiding inbreeding, using the F1 generation silk-feathered roosters as the male parent and the F1 generation silk-feathered hens as the female parent for hybridization to obtain an F2 generation population.

[0055] If there are limited silky-feather individuals in the F1 generation population, hybridization is performed using the silky-feather rooster as the male parent and the GC piece-feather heterozygous hen as the female parent.

[0056] (3) The F2 generation population was screened by appearance characteristics, and the silk-feathered individuals were organized into the F2 generation silk-feathered chicken population, and the remaining individuals were organized into the non-silk-feathered population.

[0057] (4) Determine the mitochondrial DNA D-loop sequence of F0 generation individuals and F2 generation individuals, define DNA haplotypes and haplotype groups, and compare the mitochondrial DNA haplotypes and group composition and their proportions of the F2 generation silk feather chicken group and the non-silk feather group. Use the F2 generation silk feather rooster as the male parent to avoid inbreeding, and use the GC piece-feather heterozygous hens or silk feather hens with a genotype that is not present in the F2 generation silk feather group as the female parent to obtain the F3 generation group. In steps (1) to (4), in the process of screening hybrid offspring, first eliminate individuals that do not match the appearance characteristics of the breeding group, and then select individuals whose growth performance and egg-laying performance are not lower than the average level according to the breeding goals.

[0058] 2. Detection of genetic diversity of breeding population

[0059] In order to evaluate the genetic potential of the breeding population, it is necessary to detect the mitochondrial DNA D-loop sequence of the breeding population, that is, the F0 generation population and the F2 generation population. The reaction system is 30 μL, including 15 μL Premix Taq (Takara Biotechnology, Dalian), 0.3 μL each of the forward and reverse primers (20 μmol / L), 1 μL template DNA, 13.4 μL sterilized ddH 2 O. The reaction conditions were: 94°C pre-denaturation for 4 min; then 94°C denaturation for 30 s, 58°C annealing for 50 s, 72°C extension for 80 s, 35 cycles; and finally 72°C extension for 7 min. The target band was confirmed by 1.5% agarose gel electrophoresis and then bidirectionally sequenced by Guangzhou Aiji Biotechnology Co., Ltd.

[0060] PCR primers:

[0061] L16750: 5'-AGGACTACGGCTTGAAAAGC-3';

[0062] H522: 5'-ATGTGCCTGACCGAGGAACCAG-3'.

[0063] The sequencing sequence was manually proofread using the software Bioedit, and the complete mtDNA sequence of red junglefowl (GenBank accession number: NC_007235) was used as the reference sequence. After alignment using MEGA7.0, DnaSP 6.12 was used to define haplotypes, extract variable sites, calculate nuclear haplotype diversity, nucleotide diversity, and neutrality tests (Tajima's D and Fu's Fs tests). The software MitoToolPy was used to obtain sequence variation information, and then the sequences were classified into specific haplotype groups.

[0064] 3 Breeding results

[0065] A total of 1,058 Wuhua Sanhuang chickens (148 roosters and 910 hens) were selected for breeding, and 12 roosters and 92 hens were found to have heterozygous feathers. These heterozygous individuals were paired at 1:8 for crossbreeding at 36 weeks of age, and 437 qualified eggs were obtained, with a fertilization rate of 91.99%, a hatching rate of 88.31%, and a healthy chick rate of 95.49%. Finally, 339 healthy individuals were obtained, including 82 silky feather individuals, and the proportion of silky feather individuals in heterozygous breeding was 24.19%.

[0066] Analysis on the characteristics of the 4-silk feather type Wuhua Sanhuang chicken breed

[0067] 4.1 Body shape, appearance, growth and development patterns

[0068] During the growth process of the Silky-feathered Wuhua Three-yellow Chicken, the chicks have yellow down when they are just hatched, and the color of the feathers will fade in the early growth stage, then gradually deepen. The tail feathers change from short and flat to long and curled, and the tail feathers and wing feathers are generally lighter in color. Compared with hens, roosters are larger in size, with darker feathers and longer and curled tail feathers. The Silky-feathered Wuhua Three-yellow Chicken has silky feathers all over its body, and some of the primary wing feathers, secondary wing feathers, and primary tail feathers are incomplete. This is a significant difference from the Flake-feathered Wuhua Three-yellow Chicken ( Figure 5 , 6 The average weight of silk-feathered Wuhua Sanhuang chickens when they hatched was 29.62±2.70g, and the average daily weight gain had two peaks, reaching 17.57g at 10 weeks of age and 14.45g at 14 weeks of age (Table 1).

[0069] Table 1 Body weight and weight gain of silky-feathered Wuhua Sanhuang chickens at different ages

[0070]

[0071] 4.2 Body size measurement

[0072] The body measurements of 43-week-old Wuhua Sanhuang chickens are shown in Table 2. The weights of male and female silk-feathered Wuhua Sanhuang chickens were 2028.00±256.14g and 1439.26±286.94g, respectively, which were lower than those of the flake-feathered type. However, in terms of shank length, chest width and chest depth, male and female silk-feathered chickens were larger than those of the flake-feathered type.

[0073] Table 2 Body size measurement of different strains of Wuhua Sanhuang chicken

[0074]

[0075] 4.3 Egg laying performance

[0076] Through feeding experiments, observation and recording, the egg laying of silk-feathered and flake-feathered Wuhua Sanhuang hens before 52 weeks of age was recorded and counted. The statistical results are shown in Table 3. The earliest laying age of flake-feathered Wuhua Sanhuang chickens was 114, while that of silk-feathered Wuhua Sanhuang chickens was 127, which was 13 days later than that of flake-feathered Wuhua Sanhuang chickens. The average laying age was about 3 days later than that of flake-feathered Wuhua Sanhuang chickens, and the average individual egg laying number of the two was not much different. In terms of egg laying rate, the overall egg laying rate of flake-feathered Wuhua Sanhuang chickens reached 52.77%, the highest individual egg laying rate was 77.33%, and the lowest was 8.67%; while the overall egg laying rate of silk-feathered Wuhua Sanhuang chickens reached 49.59%, and the highest and lowest individual egg laying rates were 76.65% and 7.78% respectively. The eggs of 52-week-old silk-feathered Wuhua Sanhuang chickens were heavier than those of flake-feathered Wuhua Sanhuang chickens.

[0077] Table 3 Egg laying performance data of different strains of Wuhua Sanhuang chicken

[0078]

[0079] 4.4 Egg quality

[0080] 100 and 52 breeding eggs produced by 43-week-old flake-feather and silk-feather Wuhua three-yellow chickens were randomly selected, respectively. The eggshell colors were white, pink and brown, and more than half of them were pink eggs. The relevant egg quality test results are shown in Table 4. It can be seen that compared with the flake-feather Wuhua three-yellow chicken, the silk-feather Wuhua three-yellow chicken has extremely significant differences in egg weight and yolk ratio, and significant differences in eggshell strength. In the four indicators of egg shape index, eggshell thickness, yolk color and Haugh unit, the results of the two are close. The egg shape index is basically consistent with the standard egg shape index of 1.30 to 1.35, indicating that the egg shape is relatively standard and the uniformity is high, the yolk color is bright, and its nutritional value is high. The Haugh unit is an important indicator to measure the freshness of eggs. The larger the Haugh unit, the fresher the egg. Eggs with a Haugh unit higher than 72 are classified as AA grade. The average Haugh unit of eggs is more than 80, indicating that the egg quality is good.

[0081] Table 4 Egg quality determination among different strains of Wuhua Sanhuang chicken

[0082]

[0083] Note: Different lowercase letters indicate significant differences (P<0.05), different uppercase letters indicate extremely significant differences (P<0.01), and the rest without annotation indicate no significant differences (P>0.05).

[0084] 5 Genetic diversity analysis

[0085] 5.1 Genetic diversity

[0086] Using NC_007235 as the reference sequence, the genetic diversity of silk-feathered and leaf-feathered Wuhua Sanhuang chickens was analyzed, and the results are shown in Table 5. The results of MEGA7.0 software analysis showed that after removing the primer sequence, a total of 520 bp tDNA D-loop sequences were obtained. The average contents of T, C, A, and G in the silk-feathered Wuhua Sanhuang chicken were 30.3%, 29.7%, 27.5%, and 12.5%, respectively, the average content of T+A was 57.8%, and the average content of C+G was 42.2%. Analysis by DnaSP6.12 software showed that 16 mutation sites were detected in 152 samples, accounting for only 3.08% of the total analyzed sites. All 16 mutation sites were conversions, without base transversion or deletion, including 12 T and C conversions and 4 A and G conversions. Six haplotypes (Hap1-Hap6) were identified among the 16 mutation sites, all of which were shared haplotypes. Haplotype Hap1 had the highest frequency, followed by haplotype Hap4. The six haplotypes belonged to haplotype groups B, C and E. The haplotypes and haplotype group compositions of the silk-feather type and the leaf-feather type were basically the same.

[0087] The overall haplotype diversity of Wuhua Sanhuang Chicken was 0.744±0.026, and the nucleotide diversity was 0.01147±0.00054. Overall, the haplotype diversity was rich, but compared with the leaf-feather Wuhua Sanhuang Chicken, the haplotype diversity and nucleotide diversity of the silk-feather Wuhua Sanhuang Chicken were lower, with a haplotype diversity of 0.609±0.073 and a nucleotide diversity of 0.00463±0.00151 (Table 6).

[0088] Table 5 Haplotypes, variant sites and distribution of mitochondrial DNA D-loop in varieties

[0089]

[0090] Note: a indicates the position of the variant site corresponding to the reference sequence NC_007235, and the dot indicates the base that is identical to the reference sequence.

[0091] Table 6 Statistics of genetic diversity of mitochondrial DNA D-loop in different species

[0092]

[0093] It can be seen that the new resource of Silky-feathered Wuhua Sanhuang Chicken has obvious characteristics and good prospects for development and utilization.

Claims

1. A method for breeding silky yellow chickens, characterized in that: The following steps are involved: (1) Competitive allele-specific PCR was used to detect the chr3:67850419 site of the PDSS2 gene on chromosome 3 of individuals in the initial breeding yellow chicken population to determine the feather genotype, and the obtained GC-feather heterozygous roosters and GC-feather heterozygous hens constituted the F0 generation population, and the GC-feather heterozygous roosters and GC-feather heterozygous hens were hybridized to obtain the F1 generation population; (2) screening the silk-feathered individuals in the F1 generation population by appearance characteristics, and detecting the feather genotypes of the remaining individuals to obtain F1 generation silk-feathered roosters and F1 generation silk-feathered hens; avoiding inbreeding, using the F1 generation silk-feathered roosters as the male parent and the F1 generation silk-feathered hens as the female parent for crossbreeding, and obtaining an F2 generation population; (3) Screening the F2 generation population by appearance characteristics, forming the F2 generation silky-feathered chicken population with the silky-feathered individuals and the remaining individuals forming the non-silky-feathered population; (4) Determine the mitochondrial DNA D-loop sequence of F0 generation individuals and F2 generation individuals, define DNA haplotypes and haplotype groups, compare the mitochondrial DNA haplotypes and group composition and their proportions between the F2 generation silk-feather chicken population and the non-silk-feather population, use the F2 generation silk-feather rooster as the male parent to avoid inbreeding, and use the GC-flap-feather heterozygous hens or silk-feather hens of a genotype that is not present in the F2 generation silk-feather population as the female parent for hybridization to obtain the F3 generation population.

2. The method for breeding silky yellow chicken according to claim 1, characterized in that: In the step (1), the following KASP primers are used to detect the silk feather traits of F0 generation individuals: silkyF1: 5'-GAAGGTGACCAAGTTCATGCTGGAGAGCCGCGCTGCCTCGCTTTAG-3'; silkyF2: 5'-GAAGGTCGGAGTCAACGGATTGGAGAGCCGCGCTGCCTCGCTTTAC-3'; silkyR: 5'-GGGGCAGCCATCTTGCGCGTCGCACACGG-3'; If the fluorescence signal is FAM, the molecular marker of the amplified product is of GG type, and the sample to be tested is identified as a silk feather homozygote, showing silk feather traits; if it is HEX, the molecular marker of the amplified product is of CC type, and it is identified as a leaf feather homozygote, showing leaf feather traits; if it is FAM and HEX, the molecular marker of the amplified product is of GC type, and it is identified as a leaf feather heterozygote, showing leaf feather traits.

3. The method for breeding silky yellow chicken according to claim 1, characterized in that: In the step (1), a group in which silky feather individuals have appeared is selected as the initial breeding group of yellow chickens.

4. The method for breeding silky yellow chicken according to claim 1, characterized in that: In the step (1), the presence of the silky feather gene is detected in the breeding roosters before they are kept for breeding, and the CG-feather heterozygous roosters are kept as breeding roosters.

5. The method for breeding silky yellow chicken according to claim 1, characterized in that: In the step (2), if the number of silky-feather individuals in the F1 generation population is limited, hybridization is performed using the silky-feather rooster as the male parent and the GC piece-feather heterozygous hen as the female parent.

6. The method for breeding silky yellow chicken according to any one of claims 1 to 5, characterized in that: In the steps (1) to (4), in the process of screening hybrid offspring, individuals that do not match the appearance characteristics of the breeding group are first eliminated, and then individuals whose growth performance and egg-laying performance are not lower than the average level are selected according to the breeding goals.

7. The method for breeding silky yellow chicken according to claim 6, characterized in that: Select individuals with small size but growth performance and egg-laying performance not lower than the bottom 20% of the group as pet chickens.

8. The method for breeding silky yellow chicken according to claim 1, characterized in that: It also includes a population expansion step, that is, repeating steps (2) to (4) 1-2 times according to the breeding goals to obtain a population of no less than 10 families with a male-to-female ratio of 1:8, and the mitochondrial DNA haplotypes and haplotype groups are equivalent to those of the initial breeding population.

Images