An Asian corn borer Ofur03G000560 gene and its application
By screening the Ofur03G000560 gene unique to females of Asian corn borer and designing specific primers, the rapid, simple and low-cost molecular marker identification of Asian corn borer gender is achieved, breaking through the limitations of the existing technology and suitable for gender identification of various insect states.
Patent Information
- Application Number
- CN202410512992.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-26
- Publication Date
- 2025-08-19
- Estimated Expiration
- 2044-04-26
AI Technical Summary
There is a lack of reliable molecular markers in the prior art for the identification of the sex of Asian corn borer. The morphological identification method is inconvenient to operate and is limited by the development stage. The molecular identification method is costly and complex, making it difficult to quickly and accurately identify the gender of larvae and eggs below the fifth instar.
Ofur03G000560 gene unique to females of Asian corn borer was screened out, specific primers were designed for PCR amplification, and gender was judged by agarose gel electrophoresis, and probes, chips or kits were provided for gender detection.
It achieves accurate gender identification at each growth stage, is simple to operate and low cost, is suitable for large-scale inspection, and the results are accurate and reliable.
Smart Images
Figure CN118222689B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of molecular marker technology and relates to an Asian corn borer. Ofur03G000560 Genes and their applications. Background Art
[0002] Asian corn borer ( Ostrinia furnacalis ) is one of the major pests of corn. Its larvae feed on the heart leaves, stems, cobs, silks and bracts of corn, and at the same time bring various diseases, seriously affecting the safe cultivation and production of corn.
[0003] Basic research in insect physiology and biochemistry often requires sex identification, and modern pest control methods also rely on this process. The Asian corn borer (Ostrinia nubilalis) has a ZZ / ZW sex determination system, with the W chromosome being specific to female individuals. However, the possibility exists that the W chromosome shares homologous genes with other chromosomes in the genome. Therefore, identifying reliable W chromosome-specific genes (i.e., female-specific genes) could enable the development of molecular markers for sex identification across all stages of the Asian corn borer. However, no reliable W chromosome-specific genes have yet been reported in the Asian corn borer.
[0004] Currently, the main methods for sexing the Asian corn borer are morphological and molecular. Morphological identification is primarily used for fifth-instar larvae, pupae, and adults. However, this method is inconvenient, requires a microscope, and is limited to the developmental stages of the Asian corn borer, making it unsuitable for rapid identification of larvae and eggs below the fifth instar. Existing molecular identification methods use quantitative PCR targeting Z chromosome and autosomal genes, which is more complex and expensive than standard PCR. Summary of the Invention
[0005] Based on the limitations of the morphological identification method itself and the lack of reliable molecular markers for sex identification of Asian corn borer in the prior art, the present invention provides a method for sex identification of Asian corn borer. Ofur03G000560 The gene and its application are used to accurately identify the sex of the Asian corn borer. To achieve this technical purpose, the present invention specifically adopts the following technical solutions.
[0006] Through bioinformatics analysis, the inventors identified and screened an Asian corn borer Ofur03G000560 gene, the Asian corn borer Ofur03G000560 The gene is a specific gene of female Asian corn borer individuals, the gene is present in chromosome W, and the nucleotide sequence thereof is shown in SEQ ID NO: 1.
[0007] Based on this, the present invention provides a molecular marker for identifying the sex of Asian corn borer, wherein the molecular marker is the Asian corn borer Ofur03G000560 Gene. Using specific primers, it is possible to amplify Ofur03G000560The Asian corn borer with the gene fragment is a female insect; using specific primers, it is impossible to amplify Ofur03G000560 The Asian corn borer individuals with the gene fragment are males.
[0008] Furthermore, in the molecular marker, the upstream primer of the specific primer is shown as SEQ ID NO: 2; the downstream primer of the specific primer is shown as SEQ ID NO: 3.
[0009] In addition, the present invention also provides a molecular identification method for the sex of each stage of the Asian corn borer, comprising: extracting the genomic DNA of the Asian corn borer, using specific primers, Ofur03G000560 The gene was amplified by PCR, and the PCR amplification product was subjected to agarose gel electrophoresis to determine the sex of the Asian corn borer based on the electrophoresis results.
[0010] Specifically, in the above identification method, it is possible to amplify Ofur03G000560 The Asian corn borer individual with the gene fragment is a female; Ofur03G000560 The Asian corn borer individuals with the gene fragment are males.
[0011] Furthermore, in the above identification method, the upstream primer of the specific primer is shown as SEQ ID NO: 2; the downstream primer of the specific primer is shown as SEQ ID NO: 3.
[0012] The present invention also claims protection of the Asian corn borer Ofur03G000560 Application of the gene in preparing a probe, chip or kit for identifying the sex of Asian corn borer.
[0013] To expand the scope of the Asian corn borer Ofur03G000560 The present invention also claims protection for a probe, chip or kit for detecting Ofur03G000560 Gene expression, genotyping: can detect Ofur03G000560 The Asian corn borer with the gene fragment is a female; it cannot be detected Ofur03G000560 The Asian corn borer individual with the gene fragment is a male insect. Ofur03G000560 The nucleotide sequence of the gene is shown in SEQ ID NO: 1.
[0014] Compared with the prior art, the present invention "A kind of Asian corn borer Ofur03G000560 Genes and their applications have the following beneficial effects:
[0015] The present invention screens out a female Asian corn borer-specific gene by extracting Asian corn borer genomic DNA and using bioinformatics analysis. Ofur03G000560 PCR amplification was performed to confirm Ofur03G000560The gene is indeed present only in female individuals. Based on this, Ofur03G000560 The gene is used as a reliable molecular marker to accurately identify the sex of Asian corn borer. Ofur03G000560 Gene-specific primers and the insects to be tested Ofur03G000560 PCR amplification and electrophoresis verification of the gene can be used to quickly determine the sex of the Asian corn borer based on the electrophoresis results.
[0016] The present invention screened Ofur03G000560 The gene is a gene that only exists on the W chromosome and ensures the accuracy of sex identification of Asian corn borer.
[0017] The sex identification method provided by the present invention breaks through the limitations of conventional morphological identification methods and can be used for sex identification of Asian corn borers at various growth stages.
[0018] The gender identification method provided by the present invention is simple to operate, highly accurate, and has a simple method for distinguishing test results, making it suitable for non-professionals to operate; the detection time is short, the cost is low, and large-scale detection can be carried out. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Picture 1 Asian corn borer female and male Ofur03G000560 Electrophoresis results of gene PCR products. Picture 1 Lane M is DL2000 DNA Maker, and the band sizes from top to bottom are: 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp; Lanes 1 to 7 are female worms Ofur03G000560 Gene PCR results; lanes 8 to 14 are male insects Ofur03G000560 Gene PCR results. DETAILED DESCRIPTION
[0020] The technical solutions of the present invention are described clearly and completely below with reference to the embodiments. It is obvious that the embodiments described are only a portion of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are also within the scope of protection of the present invention.
[0021] Example 1
[0022] This example provides the extraction of genomic DNA (gDNA) from Asian corn borer.
[0023] 1. Place a single larva of the Asian corn borer in 200 μL of cetyltrimethylammonium bromide (CTAB) mixture, grind thoroughly, and then add 800 μL of CTAB mixture.
[0024] 2. Place the tube in a water bath at 65°C for 30 minutes, inverting it every 10 minutes. After the water bath, centrifuge at 25°C, 12,000 rpm for 10 minutes.
[0025] 3. Transfer the supernatant to a new centrifuge tube and add an equal volume (1 mL) of chloroform-isoamyl alcohol mixture (chloroform:isoamyl alcohol ratio: 24:1) to the CTAB mixture. Place the tube on a horizontal shaker for 5 minutes. Centrifuge at 12,000 rpm at 25°C for 10 minutes.
[0026] 4. Transfer the supernatant to a new centrifuge tube, add 1 mL of chloroform-isoamyl alcohol mixture, centrifuge at 25°C, 12,000 rpm for 10 min, and collect all the supernatant (about 600 μL).
[0027] 5. Add 1 mL of isopropanol to the supernatant from step 4, gently invert to mix, and incubate at -80°C for 10 min or at -20°C for 1 h.
[0028] 6. After standing, centrifuge at 25°C, 12000 rpm for 10 min and discard the supernatant.
[0029] 7. Add 1 mL of 70% ethanol pre-cooled at -20°C to the precipitate to precipitate the DNA. Centrifuge at 25°C, 12,000 rpm for 10 min. Repeat the ethanol addition and centrifugation steps once more.
[0030] 8. After centrifugation, place the precipitate on filter paper to dry, add 20μL ddH2O to dissolve it, and store it at -20℃.
[0031] Example 2
[0032] This embodiment provides Ofur03G000560 Screening of gene molecular markers.
[0033] Filter by:
[0034] ① Homology screening: Extract the full gene sequence of the W chromosome in the Asian corn borer genome, and then use blast comparison to compare the W chromosome genes with other non-W chromosome genes to screen out W chromosome genes without homologous genes.
[0035] ② Expression screening: Using the differentially expressed gene set between male and female individuals, W chromosome genes that are only expressed in female individuals were screened.
[0036] W chromosome genes that met both criteria ① and ② were identified as W chromosome-specific genes. After screening, 19 genes meeting these criteria were identified. Specific primers were designed for each of these genes. Primer design methods: Using the NCBI online primer design tool (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ), input the nucleotide fragment of the gene sequence to generate specific primers for these genes.
[0037] by Ofur03G000560 Taking genes as an example, Ofur03G000560 The gene is a W chromosome-specific gene that was screened out, and its nucleotide sequence is shown in SEQ ID NO: 1. Ofur03G000560 Specific primers were designed based on the nucleotide sequence of the gene. The primer sequences are as follows:
[0038] Ofur03G000560 -F:GCAAGTGTGTGGCACAGAAG(SEQ ID NO:2);
[0039] Ofur03G000560 -R:TTTGTTCCGGCGTGTATGGA (SEQ ID NO: 3).
[0040] by Ofur03G000560 gene as a template, using the above-mentioned specific primers, Ofur03G000560 The PCR amplification of the gene is then used to determine the sex of the Asian corn borer. Ofur03G000560 The gene is a W chromosome-specific gene. Theoretically, if the above-mentioned specific primers can be used to amplify Ofur03G000560 If the gene fragment is present, it is a female Asian corn borer; if not, it is a male Asian corn borer.
[0041] Example 3
[0042] This example provides Asian corn borer with known sex. Ofur03G000560 Gene PCR amplification results, used to verify the use of Ofur03G000560 Feasibility of genetically determining the sex of the Asian corn borer.
[0043] According to the amplification system given in Table 1, the Ofur03G000560 The gene was amplified by PCR. The PCR amplification procedure is shown in Table 2.
[0044] Table 1. Ofur03G000560 Gene PCR amplification system
[0045]
[0046] Table 2. Ofur03G000560 Gene PCR amplification procedure
[0047]
[0048] The PCR amplification products were electrophoresed on a 1% agarose gel at 120 V for 22 min. The electrophoretic bands were visualized using a gel imaging system, and the PCR products were sequenced (Shanghai Sangon Biotechnology Co., Ltd.).
[0049] PCR amplification results are as follows Picture 1 shown. Picture 1 Lane M is DL2000 DNA Maker, and the band sizes from top to bottom are: 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp; Lanes 1 to 7 are female worms Ofur03G000560 Gene PCR results; lanes 8 to 14 are male insects Ofur03G000560 Gene PCR results. Picture 1 It can be seen that gene fragments were detected in lanes 1 to 7 around 500 bp, while no gene fragments were cloned in lanes 8 to 14 around 500 bp. Ofur03G000560 Gene, which can be used to accurately identify the sex of Asian corn borer.
[0050] The embodiments described above are only some of the embodiments of the present invention, not all of them. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention as claimed, but merely represents selected embodiments of the present invention. All other embodiments obtained without creative effort and through deduction and substitution by a person of ordinary skill in the art based on the concept of the present invention are within the scope of protection of the present invention.
Claims
1. A specific primer pair, characterized in that: The upstream primer of the specific primer pair is shown as SEQ ID NO: 2, and the downstream primer is shown as SEQ ID NO:
3.
2. A method for identifying the sex of different stages of the Asian corn borer, characterized in that: include: Extract genomic DNA of the Asian corn borer, and perform PCR amplification on the Ofur03G000560 gene of the Asian corn borer using the specific primer pair described in claim 1. The Asian corn borer individual in which the Ofur03G000560 gene can be amplified is a female; the Asian corn borer individual in which the Ofur03G000560 gene cannot be amplified is a male; the nucleotide sequence of the Ofur03G000560 gene is shown in SEQ ID NO:
1.
3. A detection kit, characterized in that Comprising the specific primer pair according to claim 1.