Molecular markers for wheat stripe rust resistance and their applications
By detecting molecular markers at specific nucleotide sites on chromosome 2B of the wheat genome and combining it with KASP primer technology, the problem of detecting wheat stripe rust resistance was solved, efficient breeding assistance was achieved, and wheat stripe rust resistance was improved.
Patent Information
- Application Number
- CN202410470456.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-18
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2044-04-18
AI Technical Summary
Existing technologies make it difficult to effectively detect and utilize wheat stripe rust resistance genes, resulting in limited resistance genes in breeding and difficulty in cultivating long-lasting disease-resistant varieties.
A molecular marker for a specific nucleotide site on chromosome 2B of the wheat genome is provided. KASP primers are used to detect wheat stripe rust resistance. High-throughput automated detection is performed using KASP labeling technology, and fluorescence signal analysis is performed in combination with the KASP primer reaction system to achieve rapid identification of wheat stripe rust resistance.
It has achieved efficient detection and identification of wheat stripe rust resistance, which can assist breeding to improve wheat stripe rust resistance, reduce detection costs and improve breeding efficiency.
Smart Images

Figure BDA0004798747760000071 
Figure BDA0004798747760000081 
Figure BDA0004798747760000091
Abstract
Description
Technical Field
[0001] The present invention relates to a molecular marker for wheat stripe rust resistance and an application thereof in the field of biotechnology. Background Art
[0002] Wheat stripe rust, also known as jaundice and the "cancer" of wheat, is an airborne fungal disease caused by the wheat-transforming form of the fungus Puccinia striiformis (Puccinia striiformis West. f. sp. tritici Eriks. & Henn, abbreviated as Pst). It primarily infects wheat leaves, but can also infect nearly all above-ground vegetative organs, including leaf sheaths, spikes, culms, glumes, and awns. In my country, with the exception of the spring wheat regions of Northeast China, wheat stripe rust occurs in nearly all other wheat-producing areas. It is particularly frequent and severe in key wheat-producing regions such as the Northwest, Southwest, and Huanghuaihai regions. Historically, numerous wheat stripe rust pandemics have occurred, each resulting in significant economic and yield losses. Controlling wheat stripe rust has always been a difficult task. Field control measures primarily include appropriate planting density, ensuring a balanced population structure, and balanced fertilization, but these methods can only mitigate the disease to a certain extent. Chemical control methods, including spraying and seed dressing, are costly and can cause environmental pollution over time. At present, breeding wheat stripe rust-resistant varieties is the most economical, safe, effective and environmentally friendly prevention and control method.
[0003] Wheat stripe rust resistance genes primarily originate from common wheat (T. aestivum), but some also originate from closely related species. To date, 89 stripe rust resistance genes have been formally named, distributed across 86 loci (Yr1-Yr86) on 20 chromosomes other than chromosome 1A. Yr18, Yr29, Yr30, and Yr46 belong to the durable, pleiotropic resistance loci Lr34 / Yr18 / Pm38 / Sr57 (7DS), Lr46 / Yr29 / Pm39 / Sr58 (1BL), Lr27 / Yr30 / Sr2 / Sb3 (3BS), and Lr67 / Yr46 / Pm46 / Sr55 (4DL), respectively. These loci confer resistance to multiple diseases, aligning with the goal of improving comprehensive disease resistance and cultivating durable disease-resistant varieties in wheat breeding. They are currently the most highly valued and widely used disease resistance loci. Furthermore, over 300 QTLs for adult resistance to stripe rust have been mapped, encompassing 115, 207, and 62 loci on the A, B, and D subgenomes, respectively. Subgenome B has the most loci and exhibits a concentrated distribution. These loci are derived from 79 different populations, and over 230 have explained phenotypic variance (PVE) exceeding 10%, representing a rich genetic resource for stripe rust resistance. Currently, 11 stripe rust genes have been cloned, including eight seedling resistance genes (Yr5, Yr7, YrSP, Yr10, Yr15, Yr28 (YrAS2388), YrU1, and YrNAM) and three adult resistance genes (Yr18, Yr36, and Yr46). Due to the rapid mutation rate of wheat stripe rust, some genes are prone to losing resistance, and some genes are linked to undesirable traits. Consequently, the number of genes truly useful for improving stripe rust resistance in wheat breeding is very limited. Therefore, discovering new stripe rust resistance genes (QTLs) and developing molecular markers closely linked to them are of great significance for disease resistance breeding.
[0004] Gene chips, also known as DNA chips, work by designing specific probe sequences based on SNP variants identified through sequencing, affixing them to the chip. Sample DNA is then extracted and fluorescently labeled. After hybridization with the probes, the DNA is amplified multiple times, and ultimately, genotypes are distinguished based on differences in fluorescence. Currently, gene chip technology has become the most important method for SNP detection. KASP markers have been widely used to detect SNP loci in crops such as wheat, rice, and corn. KASP offers a certain degree of flexibility, facilitating high-throughput and automated detection. Furthermore, it utilizes universal probes that can be used with a variety of gene-specific primers, eliminating the need for probe synthesis for each specific locus, significantly reducing experimental reagent costs. Genotyping data from wheat SNP chips is used for QTL mapping and genome-wide association analysis, converting linked SNPs into KASP markers for direct application in molecular marker-assisted selection breeding. Currently, KASP marker technology is highly mature and widely used in wheat genetic breeding.
[0005] Jimai 22 is a high-yield, multi-resistant, high-quality medium-gluten wheat variety. It passed national approval for the northern Huanghuai region in 2006 and completed registration for introduction into Anhui and Henan provinces in 2010 and 2011, respectively. It is suitable for cultivation in the northern and southern Huanghuai winter wheat regions of Henan and Anhui provinces. Zhongmai 578 is a high-yield, multi-resistant, high-quality strong-gluten wheat variety. It passed national approval in June 2021 and is suitable for cultivation in irrigated areas in the northern Huanghuai winter wheat region. Summary of the Invention
[0006] The technical problem to be solved by the present invention is how to detect wheat stripe rust resistance.
[0007] To solve the above technical problems, the present invention first provides an application of a substance for detecting a molecular marker of wheat stripe rust resistance in detecting or assisting in detecting wheat stripe rust resistance;
[0008] The wheat stripe rust resistance molecular marker is the nucleotide at position 36 on chromosome 2B of the wheat genome corresponding to SEQ ID No. 4 in the sequence list, which is C or T.
[0009] In the above application, the substance for detecting the wheat stripe rust resistance molecular marker may include: a primer set capable of amplifying the DNA fragment shown at position 36 of SEQ ID No. 4 in the sequence listing.
[0010] In the above application, the primer set can be composed of three single-stranded DNAs named upstream primer F1, upstream primer F2 and downstream primer R, wherein the upstream primer F1 contains the single-stranded DNA shown at positions 22-43 of SEQ ID No.1, the upstream primer F2 contains the single-stranded DNA shown at positions 22-43 of SEQ ID No.2, and the downstream primer R is the single-stranded DNA shown in SEQ ID No.3.
[0011] Specifically, the upstream primer F1 may be a single-stranded DNA shown in SEQ ID No. 1, and the upstream primer F2 may be a single-stranded DNA shown in SEQ ID No. 2.
[0012] The present invention also provides a method for detecting wheat stripe rust resistance, which comprises: detecting the nucleotide corresponding to the 36th position of SEQ ID No. 4 in the sequence list in the genomic DNA of the wheat to be tested, and the stripe rust resistance of the homozygous wheat to be tested in which the nucleotide corresponding to the 36th position of SEQ ID No. 4 in the sequence list in the genomic DNA is C is lower than or is a candidate lower than that of the homozygous wheat to be tested in which the nucleotide corresponding to the 36th position of SEQ ID No. 4 in the sequence list in the genomic DNA is T.
[0013] In the above method, the detection of the nucleotide corresponding to position 36 of SEQ ID No. 4 in the sequence list in the genomic DNA of the wheat to be tested can be performed using the substance for detecting the wheat stripe rust resistance molecular marker.
[0014] In the above method, the detection of the nucleotide corresponding to position 36 of SEQ ID No. 4 in the sequence listing in the genomic DNA of the wheat to be tested can be completed by direct sequencing, or by amplifying the three single-stranded DNAs represented by SEQ ID No. 1, SEQ ID No. 2, and SEQ ID No. 3 in a reaction system of KASP primers and then detecting the fluorescent signal in the reaction system.
[0015] In one embodiment of the present invention, the reaction system may contain KASP 2x Master Mix (LGC, Catalog No.: 13448166). The fluorescent signal in the reaction system is displayed as FAM, and the nucleotide at position 36 corresponding to SEQ ID No. 4 in the sequence list of the wheat to be tested is C (i.e., the wheat to be tested is homozygous for C); the fluorescent signal in the reaction system is displayed as HEX, and the nucleotide at position 36 corresponding to SEQ ID No. 4 in the sequence list of the wheat to be tested is T (i.e., the wheat to be tested is homozygous for T); the fluorescent signal in the reaction system is displayed as FMA and HEX, and the nucleotide at position 36 corresponding to SEQ ID No. 4 in the sequence list of the wheat to be tested is C and T (i.e., the wheat to be tested is heterozygous for C and T).
[0016] The substance for detecting the wheat stripe rust resistance molecular marker also falls within the protection scope of the present invention.
[0017] The substance for detecting the wheat stripe rust resistance molecular marker can be a kit.
[0018] The DNA molecule shown in SEQ ID No. 4 also falls within the scope of protection of the present invention.
[0019] The present invention also provides any of the following applications of the wheat stripe rust resistance molecular marker or the DNA molecule shown in SEQ ID No. 4:
[0020] X1) Detecting or assisting in detecting wheat stripe rust resistance;
[0021] X2) Compare the resistance of different wheat varieties to stripe rust;
[0022] X3) Breeding wheat with strong resistance to stripe rust;
[0023] X4) Screening or eliminating wheat with weak stripe rust resistance;
[0024] X5) Wheat breeding.
[0025] The present invention also provides any of the following applications of the substance for detecting the wheat stripe rust resistance molecular marker:
[0026] Y1) preparing a product for detecting or assisting in detecting wheat stripe rust resistance;
[0027] Y2) Compare the resistance of different wheat varieties to stripe rust;
[0028] Y3) preparing a product to compare the stripe rust resistance of different wheat varieties;
[0029] Y4) Breeding wheat with strong resistance to stripe rust;
[0030] Y5) preparing products for breeding wheat with strong stripe rust resistance;
[0031] Y6) screening or eliminating wheat with weak stripe rust resistance;
[0032] Y7) preparing a product for screening or eliminating wheat with weak stripe rust resistance;
[0033] Y8) Wheat breeding.
[0034] The present invention also provides a wheat breeding method, which comprises: detecting the nucleotide corresponding to the 36th position of SEQ ID No. 4 in the sequence list in the wheat genomic DNA, selecting homozygous wheat whose 36th position corresponding to SEQ ID No. 4 in the sequence list in the genomic DNA is T as a parent for breeding, and screening the homozygous wheat whose 36th position corresponding to SEQ ID No. 4 in the sequence list in the genomic DNA is T in the offspring to obtain wheat with stripe rust resistance.
[0035] In the present invention, the wheat can be selected from the hybrid offspring of Zhongmai 578 and Jimai 22, or the 109 wheat materials in Table 2 or their offspring.
[0036] In a specific embodiment of the present invention, the strength of the stripe rust resistance is reflected by the MDS level of the leaves. A high MDS of the leaves indicates weak stripe rust resistance, while a low MDS of the leaves indicates strong stripe rust resistance.
[0037] The wheat stripe rust resistance molecular marker of the present invention is associated with wheat stripe rust resistance. Homozygous wheat in which the nucleotide at position 36 corresponding to SEQ ID No. 4 in the sequence listing is C has lower stripe rust resistance than homozygous wheat in which the nucleotide at position 36 corresponding to SEQ ID No. 4 in the sequence listing is T. The wheat stripe rust resistance molecular marker can be used to detect wheat stripe rust resistance and further used in molecular marker-assisted breeding. The present invention is of great significance for breeding wheat with enhanced stripe rust resistance.
[0038] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] Figure 1 This is the QYr.caas-2B curve mapped in the Zhongmai 578×Jimai 22RIL population.
[0040] Figure 2The genotyping results of 109 wheat accessions using the KASP marker Kasp_2B_YR are shown in Figure 1. The red color represents the Zhongmai 578 genotype (TT homozygous), the blue color represents the Jimai 22 genotype (CC homozygous), and the pink color represents the blank control. DETAILED DESCRIPTION
[0041] Unless otherwise noted, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in literature in the field or in accordance with product specifications. Materials, reagents, and instruments used in the following examples are commercially available unless otherwise noted. In the following examples, unless otherwise noted, the first position of each nucleotide sequence in the sequence listing refers to the 5′-terminal nucleotide of the corresponding DNA / RNA, and the last position refers to the 3′-terminal nucleotide of the corresponding DNA / RNA.
[0042] Example 1. Discovery of Stripe Rust Resistance QTL in Zhongmai 578×Jimai 22 RIL Population and Acquisition and Application of KASP Markers
[0043] 1. Acquisition of phenotypic data
[0044] Using Zhongmai 578 as the female parent and Jimai 22 as the male parent, an F5 RIL population containing 262 families was constructed using the single-seed transmission method. Plants were planted in Chengdu, Sichuan, and Qingshui, Gansu, in 2021-2022 and 2022-2023, using a completely randomized block design with three replicates, a single-row plot, a row length of 2m, a row width of 0.25m, and 30 seeds per row. Throughout the wheat growth process, field management was carried out in accordance with local conventional cultivation techniques. When the stripe rust disease was most severe (i.e., when the leaves of the susceptible control Mingxian 169 were almost covered with stripe rust summer spores), a field disease survey was conducted on the population and its parents. The survey indicator was the maximum severity (MDS), which was the percentage of the stripe rust spore area on the leaf to the total leaf area.
[0045] Genomic DNA from young leaves of 262 families was extracted using the CTAB method. DNA concentration was measured using a NanoDrop 2000c spectrophotometer, and DNA samples were adjusted to a standard concentration of 50 ng / μl. DNA quality was then tested on a 0.8% agarose gel. DNA of acceptable quality was used for SNP typing. SNP analysis was performed using a 50K SNP array developed in collaboration between the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, and Affymetrix Axiom.
[0046] 2. Construction of linkage map
[0047] The RILs and both parents were genotyped using the CapitalBio Corporation (http: / / www.capitalbio.com) wheat 50K SNP array, encompassing a total of 55,224 SNPs. Genotype data were filtered to exclude non-polymorphic markers, families with marker loss rates greater than 20%, and markers with a minor allele frequency less than 30%. The remaining 9354 high-quality polymorphic markers were used for subsequent analysis. The filtered polymorphic markers were processed using the BIN function in IciMapping v4.2 (http: / / www.isbreeding.net / ; Meng et al. 2015), grouping markers with identical genotypes into a single bin. Thirty-four linkage groups, comprising 1501 bins, were constructed. Genetic linkage maps were constructed using JoinMap v4.0 and MapChart v2.32 software (https: / / www.wur.nl / en / show / Mapchart.htm; Voorrips, 2002).
[0048] 3. QTL Analysis
[0049] QTLs were detected using the complete interval mapping method of QTL Cartographer v2.5, with an LOD threshold of 2.5. A relatively stable QTL was located on chromosome 2B and named QYr.caas-2B ( Figure 1 The flanking markers are AX-95089819 and AX-95661759, with a physical interval of 741.1–770.6 Mb. Under different environmental conditions, 4.02–6.32% of the phenotypic variation can be explained (see Table 1, Figure 1 The closely linked marker AX-179558984 was converted to Kasp_2B_YR, and the genotypes of 109 wheat materials were detected.
[0050] Table 1. QYr.caas-2B of Zhongmai 578×Jimai 22 RIL population detected by composite interval mapping
[0051] Genetic position (cM) Marking interval Physical location (Mb) LOD value PVE (%) Add 135.41 AX-95089819-AX-95661759 741.1-770.6 2.80-3.13 4.02-6.32% -4.14--2.82
[0052] 4. Design and Utilization of KASP Primers
[0053] 1. Design of KASP primers
[0054] The SNP AX-179558984, corresponding to the Kasp_2B_YR marker, is located at 751.5 Mb in the wheat reference genome (chromosome 2B) Chinese Spring RefSeq v1.0 (reference genome website: https: / / urgi.versailles.inra.fr / blast_iwgsc / ). The SNP variants at marker AX-179558984 (sense strand), which is tightly linked to QYr.caas-2B, between Zhongmai 578 and Jimai 22, and the surrounding nucleotide sequences are shown in SEQ ID No. 4 (Y represents C or T).
[0055] The KASP marker primer sequence was designed based on the antisense strand of the SNP site marker AX-179558984 as follows:
[0056] Upstream primer F1: 5'- GAAGGTGACCAAGTTCATGCT GTTTTAACTCCATCCGGGTATCTG-3' (SEQ ID No. 1, the underlined part is the specific fluorescent tag sequence FAM);
[0057] Upstream primer F2: 5'- GAAGGTCGGAGTCAACGGATT GTTTTAACTCCATCCGGGTATCTA-3' (SEQ ID No. 2, the underlined part is the specific fluorescent tag sequence HEX);
[0058] Downstream primer R: 5'-TCCAGAAGATGTTCTCGAGC-3' (SEQ ID No. 3).
[0059] The last base at the 3' end of the two upstream primers corresponds to the SNP site AX-179558984 (antisense strand). The SNP site AX-179558984 on wheat chromosome 2B corresponds to position 36 of SEQ ID No. 4 (sense strand), which is C or T (represented by Y in SEQ ID No. 4).
[0060] The upstream primer F1 is used to amplify the case where the nucleotide at the SNP site AX-179558984 (antisense chain) on wheat chromosome 2B is G (corresponding to the sense chain, the nucleotide at this SNP site is C), and the upstream primer F2 is used to amplify the case where the nucleotide at the SNP site AX-179558984 (antisense chain) on wheat chromosome 2B is A (corresponding to the sense chain, the nucleotide at this SNP site is T); the downstream primer R is a universal primer.
[0061] The single-stranded DNA molecules shown in SEQ ID No. 1 and SEQ ID No. 3 amplify a fragment in which the nucleotide at the SNP site AX-179558984 (antisense strand) on wheat chromosome 2B is homozygous for G (corresponding to the sense strand, the genotype of the SNP site is homozygous for C:C).
[0062] The single-stranded DNA molecules shown in SEQ ID No. 2 and SEQ ID No. 3 amplify a fragment in which the nucleotide at the SNP site AX-179558984 (antisense strand) on wheat chromosome 2B is homozygous for A (corresponding to the sense strand, the genotype of the SNP site is T:T homozygous).
[0063] The single-stranded DNA molecules shown in SEQ ID No. 1, SEQ ID No. 2, and SEQ ID No. 3 amplify a fragment in which the nucleotides at the SNP site AX-179558984 (antisense chain) on wheat chromosome 2B are hybridized with G and A (corresponding to the sense chain, the genotype of the SNP site is T:C heterozygous).
[0064] 2. Establishment of KASP detection method
[0065] The principle of KASP: two forward competitive primers (the 5' end of the primer has a base sequence that is complementary to the fluorescent groups HEX and FAM, and the other sequences differ only at the SNP at the 3' end) and a reverse common primer; the PCR reaction system contains a universal sequence modified with fluorescent groups and quenching groups (Master Mix provided by LGC). The two forward primers can emit two different colors of light. If the site is homozygous, a single fluorescence is emitted; if it is heterozygous, two fluorescences can be emitted simultaneously.
[0066] The KASP marker PCR amplification system was as follows: 2.0 μl KASP 2x Master Mix (LGC, Catalog No. 13448166), 0.048 μl KASP primers (a mixture of three primers, total concentration 50 μM, with a molar ratio of two upstream primers to one downstream primer of 2:2:5), and 1.952 μl template DNA (50 ng / μl). Amplification was performed using a 384-well PCR instrument (BIO-RAD, S1000™ Thermal Cycler) with the following program: 94°C for 15 min; 10 cycles of 94°C for 20 s, followed by 63-55°C for 1 min (1°C decrease between cycles); and 32 cycles of 94°C for 20 s, followed by 55°C for 60 s. The PCR amplification products were placed in an automatic focusing fluorescence multifunctional microplate reader (PHERAstarplus SNP, BMG LABTECH) to read the final fluorescence data, and then the data were imported into Klustercallerv3.4 (LGC, Hoddesdon, UK) for genotyping.
[0067] For the Kasp_2B_YR marker (SNP site AX-179558984): If the fluorescence signal data of the amplified product is close to the Y-axis (FAM fluorescence signal) after analysis by the genotyping software KlusterCaller, it means that the genotype of the site (sense chain) is CC homozygous; if the fluorescence signal data of the amplified product is close to the X-axis (HEX fluorescence signal) after analysis by the genotyping software KlusterCaller, it means that the genotype of the site (sense chain) is TT homozygous; if the fluorescence signal data of the amplified product is located between the X-axis and the Y-axis (with both FAM and HEX signals) after analysis by the genotyping software KlusterCaller, it means that the genotype of the site (sense chain) is TC heterozygous.
[0068] 3. KASP detection
[0069] The experimental materials were 109 wheat materials from the Huanghuai wheat region (Liu JD, He ZH, Rasheed A, Wen WE, Yan J, Zhang PZ, Wan YX, Zhang Y, Xie CJ, Xia XC (2017) Genome wide association mapping of black point reaction in common wheat (Triticum aestivum L.). BMC Plant Biology, https: / / doi.org / 10.1186 / s12870-017-1167-3.), see Table 2 for details.
[0070] A total of 109 wheat accessions from the Huanghuai wheat region were planted in Tianshui, Gansu (2020-2021) and Chengdu, Sichuan (2021-2022). All experiments used a randomized block design with three replicates, three rows, 2 m row length, 25 cm row spacing, and 50 grains per row. Field management followed local regulations, and stripe rust resistance was assessed. At the jointing stage, wheat was inoculated with a mixed strain (CYR29, CYR31, CYR32, and CYR33). The strains and inoculation methods were described in Lan CX, Liang SS, Wang ZL, Yan J, Zhang Y, Xia XC, and He ZH. Quantitative trait loci mapping for adult-plant resistance against powdery mildew in Chinese wheat cultivar Bainong 64. Phytopathology, 2009, 99:1121–1126.
[0071] Field disease surveys were conducted on the population and its parents when stripe rust was at its most severe. The survey metric was maximum severity (MDS), defined as the percentage of stripe rust spore area on a leaf to the total leaf area. The mean values for the two environments are shown in Table 2.
[0072] Extract genomic DNA from all experimental materials and use it as a template to detect using the KASP primers designed in step 2. For specific operations, see step 2.
[0073] The results are shown in Table 2 and Figure 2 Of the 109 wheat accessions, 47 were of the Zhongmai 578 genotype (TT) and 62 were of the Jimai 22 genotype (CC). The mean MDS values of the TT homozygous wheat accessions were 5.30% lower than those of the CC homozygous wheat accessions, a significant difference at the 0.05 level (Table 3). This indicates that the Kasp_2B_YR marker of the present invention is associated with resistance to wheat stripe rust.
[0074] Table 2. Genotype detection results of 109 wheat materials
[0075]
[0076]
[0077]
[0078]
[0079]
[0080] Note: TT: Zhongmai 578 genotype; CC: Jimai 22 genotype.
[0081] Table 3. MDS effects of 109 natural populations of QYr.caas-2B
[0082]
[0083] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.
Claims
1. Application of substances for detecting molecular markers of wheat stripe rust resistance in detecting or assisting in detecting wheat stripe rust resistance; The wheat stripe rust resistance molecular marker is the nucleotide at position 36 on the wheat chromosome 2B corresponding to SEQ ID No. 4 in the sequence list, which is C or T.
2. The use according to claim 1, characterized in that: The substance for detecting the wheat stripe rust resistance molecular marker comprises: a primer set capable of amplifying a DNA fragment represented by position 36 of SEQ ID No. 4 in the sequence table; The primer set consists of three single-stranded DNAs named upstream primer F1, upstream primer F2 and downstream primer R, wherein the upstream primer F1 is the single-stranded DNA shown in SEQ ID No.1, the upstream primer F2 is the single-stranded DNA shown in SEQ ID No.2, and the downstream primer R is the single-stranded DNA shown in SEQ ID No.
3.
3. Methods for detecting resistance to wheat stripe rust, comprising: The nucleotide corresponding to the 36th position of SEQ ID No. 4 in the sequence list is detected in the genomic DNA of the wheat to be tested. The stripe rust resistance of the homozygous wheat to be tested in which the nucleotide corresponding to the 36th position of SEQ ID No. 4 in the sequence list in the genomic DNA is C is lower than or candidate lower than that of the homozygous wheat to be tested in which the nucleotide corresponding to the 36th position of SEQ ID No. 4 in the sequence list in the genomic DNA is T.
4. The method according to claim 3, wherein: The nucleotide corresponding to position 36 of SEQ ID No. 4 in the sequence list in the genomic DNA of the wheat to be tested is detected using the substance for detecting the wheat stripe rust resistance molecular marker as claimed in claim 1 or 2.
5. Any of the following uses of the substance for detecting the wheat stripe rust resistance molecular marker according to claim 1 or 2: Y1) Preparation of products for detecting or assisting in detecting resistance to wheat stripe rust; Y2) Compare the resistance of different wheat varieties to stripe rust; Y3) Prepare products to compare the stripe rust resistance of different wheat varieties; Y4) Breeding wheat with strong stripe rust resistance; Y5) Preparation of products for breeding wheat with strong stripe rust resistance; Y6) Screening or culling wheat with weak stripe rust resistance; Y7) preparing products for screening or culling wheat with weak stripe rust resistance; Y8) Wheat breeding, breeding trait for wheat stripe rust resistance.
6. Wheat breeding methods, including: The nucleotide corresponding to the 36th position of SEQ ID No. 4 in the sequence list is detected in the wheat genomic DNA, and the homozygous wheat whose 36th position corresponding to the SEQ ID No. 4 in the sequence list is T is selected as the parent for breeding. The homozygous wheat whose 36th position corresponding to the SEQ ID No. 4 in the sequence list is T in the genomic DNA is screened in the offspring to obtain wheat with stripe rust resistance.