Application of grass carp PI4KB as a target molecule in the preparation of grass carp resistant to hemorrhagic disease and / or fast-growing grass carp

Abstract

This invention provides the application of grass carp PI4KB as a target molecule in the preparation of grass carp resistant to hemorrhagic disease and / or fast-growing grass carp, belonging to the fields of genetic engineering and fish molecular breeding technology. The study found that grass carp phosphatidylinositol 4-kinase IIIβ (PI4KB) plays a negative regulatory role in grass carp reovirus (GCRV) infection, and PI4KB can significantly promote the formation of viral inclusion bodies and GCRV replication. This invention involves gene editing of the PI4KB target molecule in commercially farmed grass carp, resulting in a population of juvenile grass carp exhibiting significant heterozygous advantages in growth promotion and hemorrhagic disease resistance. This invention provides a molecular target and method for preparing germplasm resources for grass carp resistant to hemorrhagic disease and fast-growing grass carp.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and fish molecular breeding technology, and particularly relates to the application of grass carp PI4KB as a target molecule in the preparation of grass carp resistant to hemorrhagic disease and / or fast-growing grass carp. Background Technology

[0002] Sustainable development of aquaculture is a crucial component of "establishing a broad food perspective," with fish being the primary aquaculture species. Grass carp is the largest freshwater economic fish species farmed in China, with annual consumption exceeding 2 million tons. However, grass carp is highly susceptible to various diseases during farming, especially hemorrhagic septicemia caused by grass carp reovirus (GCRV), which can have a mortality rate of over 80% in juvenile grass carp, causing significant economic losses to the grass carp farming industry. Furthermore, due to the long sexual maturity cycle of grass carp (4-5 years), traditional breeding methods have resulted in the lack of a newly approved variety. In addition, frequent inbreeding in the grass carp farming industry has led to severe degradation of germplasm and quality. These problems—declining quality, frequent hemorrhagic septicemia, and low coverage of improved varieties—have become major obstacles to the green and efficient development of the grass carp industry. Therefore, it is imperative to utilize cutting-edge biotechnology to create high-quality, hemorrhagic septicemia-resistant new grass carp germplasm resources.

[0003] Phosphatidylinositol (PI) metabolism is a crucial component of the lipid metabolism pathway, playing a vital role in maintaining normal physiological functions and life activities. PI forms the basic framework of phosphatidylinositol. Under the action of kinases, the 3, 4, and 5 hydroxyl groups of PI are reversibly phosphorylated, yielding various types of phosphatidylinositol. The main kinases involved in the PI metabolic pathway include phosphatidylinositol 3-kinase (PI3K), phosphatidylinositol 4-kinase (PI4K), and phosphatidylinositol 4-phosphate 5-kinase (PI5K). Phosphoinositol is a class of negatively charged phospholipids widely distributed on cell membranes and organelle membranes. It is not only an important messenger molecule in organisms but also a crucial component of biological membranes. Phosphoinositol plays a vital role in membrane permeability, signal transduction pathways, membrane translocation, vesicle transport, cytoskeleton regulation, and nuclear activity. Increasing research has revealed that mammalian viruses, during infection, regulate the host's PI metabolic pathway to form viral inclusion bodies or replication sites.

[0004] Four different types of PI4K molecules exist in mammals and zebrafish. Based on their kinase size and catalytic activity, they can be divided into two type II kinases (PI4K2A and PI4K2B) and two type III kinases (PI4KA and PI4KB), which are located on various cellular membrane structures. PI4K2A and PI4K2B are mainly located on endosomes, the plasma membrane, and the Golgi apparatus; PI4K2B is also present on clathrin-coated vesicles. PI4KA is mainly located on the plasma membrane, endoplasmic reticulum, and the Golgi apparatus, while PI4KB is mainly located on the Golgi apparatus, but is also distributed in the nucleus. These four PI4K molecules, in addition to synthesizing phosphatidylinositol 4-phosphate (PI4P) from phosphatidylinositol as a substrate, also have different functions in membrane transport, cell adhesion, and migration. Studies on PI4K in fish have revealed that PI4KA in zebrafish is involved in the development of their pectoral fins, while PI4KB is involved in the formation of cilia in the inner ear's auditory vesicles. Furthermore, a growing body of research has found that mammalian PI4Ks are involved in the infection and replication of various RNA viruses, such as enterovirus A71 (EV-A71) and poliovirus (PV), which can recruit PI4KB to their replication sites to promote viral replication and infection. Studies have also found that plant geminiviruses utilize PI4K2B to promote their own infection and replication. Currently, research on the role of PI4K in viral infection and replication in fish is scarce. Summary of the Invention

[0005] Therefore, the purpose of this invention is to provide an application of grass carp PI4KB as a target molecule in the preparation of grass carp that is resistant to hemorrhagic disease and / or fast-growing.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides the application of grass carp PI4KB as a target molecule in the preparation of grass carp that is resistant to hemorrhagic disease and / or fast-growing.

[0008] Preferably, the reagent for preparing anti-hemorrhagic disease and / or fast-growing grass carp is a grass carp PI4KB inhibitor.

[0009] Preferably, the grass carp PI4KB inhibitor includes a regulator that reduces PI4KB expression, a protease that degrades PI4KB, or a reagent that reduces PI4KB activity.

[0010] Preferably, the regulator that reduces PI4KB expression includes a reagent that knocks down or silences PI4KB expression; the reagent that reduces PI4KB activity includes the PIK-93 compound.

[0011] Preferably, the reagents for knocking down or silencing PI4KB expression include one or more of the CRISPR / Cas9 system, siRNA, shRNA, and miRNA.

[0012] Preferably, the CRISPR / Cas9 system includes a gRNA with reduced PI4KB or knocked-out expression, the nucleotide sequence of which is shown in SEQ ID NO.5.

[0013] This invention provides a CRISPR / Cas9 system for preparing grass carp resistant to hemorrhagic disease and / or fast-growing species. The CRISPR / Cas9 system includes gRNA that reduces or knocks out PI4KB expression, and the nucleotide sequence of the gRNA is shown in SEQ ID NO. 5.

[0014] Preferably, the CRISPR / Cas9 system further includes Cas9 mRNA; the concentration of the Cas9 mRNA is 100–140 ng / μL, the concentration of the gRNA is 500–700 ng / μL, and the volume ratio of the Cas9 mRNA to the gRNA is 1:1. The Cas9 mRNA is derived from pGH7 (T7:zCas9-UTRglobin) (from the National Zebrafish Resource Center, CZRCCatalog 1D:CZP4). This invention does not specifically limit the method for extracting Cas9 mRNA; any method or kit known in the art can be used for extraction and preparation.

[0015] This invention provides a method for preparing grass carp resistant to hemorrhagic disease and / or fast-growing grass carp, comprising the steps of using the above-mentioned grass carp PI4KB inhibitor or the above-mentioned CRISPR / Cas9 system to reduce or knock out the expression level and / or activity of PI4KB in grass carp, thereby obtaining grass carp resistant to hemorrhagic disease and / or fast-growing grass carp.

[0016] Preferably, the method includes the step of introducing the above-mentioned CRISPR / Cas9 system into grass carp to obtain grass carp resistant to hemorrhagic disease and / or fast-growing.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] This invention provides the application of grass carp PI4KB as a target molecule in the preparation of grass carp resistant to hemorrhagic disease and / or fast-growing grass carp. The study found that grass carp phosphatidylinositol 4-kinase IIIβ (PI4KB) plays a negative regulatory role in grass carp reovirus (GCRV) infection, and PI4KB can significantly promote the formation of viral inclusion bodies and GCRV replication. This invention involves gene editing of the PI4KB target molecule in commercially farmed grass carp, resulting in a population of juvenile grass carp exhibiting significant heterozygous advantages in growth promotion and hemorrhagic disease resistance. This invention provides a molecular target and method for preparing new germplasm resources of grass carp resistant to hemorrhagic disease and fast-growing grass carp. Attached Figure Description

[0019] Figure 1 In the image, A represents the sequence characteristics of grass carp PI4KB; B represents the electrophoresis diagram of the protein expressed by the gcPI4KB-FLAG recombinant expression vector.

[0020] Figure 2 The effect of gcPI4KB-FLAG overexpression in CIK cells on GCRV infection and viral replication is shown in Figure A, which shows the lesion severity of gcPI4KB-FLAG-overexpressing CIK cells after GCRV infection; and Figure B shows the viral titer of gcPI4KB-FLAG-overexpressing CIK cells after GCRV infection.

[0021] Figure 3 The effects of inhibition of grass carp PI4KB kinase activity before or after GCRV infection on cell survival and viral replication are shown in Figure A, which shows the crystal violet staining results of the effect of inhibition of grass carp PI4KB kinase activity before GCRV infection on cell survival; Figure B shows the statistical results of the effect of inhibition of grass carp PI4KB kinase activity before GCRV infection on GCRV virus titer; Figure C shows the crystal violet staining results of the effect of inhibition of grass carp PI4KB kinase activity after GCRV infection on cell survival; and Figure D shows the statistical results of the effect of inhibition of grass carp PI4KB kinase activity after GCRV infection on GCRV virus titer.

[0022] Figure 4 To investigate the effect of inhibition of PI4KB kinase activity in grass carp before GCRV infection on viral inclusion body formation, A shows the results of viral inclusion body formation detected by NS80 antibody 12 hpi after GCRV infection; B shows the results of viral inclusion body formation detected by NS38 antibody 12 hpi after GCRV infection; C shows the results of viral inclusion body formation detected by NS80 antibody 24 hpi after GCRV infection; D shows the results of viral inclusion body formation detected by NS38 antibody 24 hpi after GCRV infection; E shows the quantification results of the average fluorescence intensity of immunofluorescence of viral inclusion bodies in each group.

[0023] Figure 5 To illustrate the effect of inhibition of PI4KB kinase activity in grass carp after GCRV infection on viral inclusion body production, A shows the results of viral inclusion body production detected by NS80 antibody 12 hpi after GCRV infection; B shows the results of viral inclusion body production detected by NS38 antibody 12 hpi after GCRV infection; C shows the results of viral inclusion body production detected by NS80 antibody 24 hpi after GCRV infection; D shows the results of viral inclusion body production detected by NS38 antibody 24 hpi after GCRV infection; E shows the quantification results of the average fluorescence intensity of immunofluorescence for each group of viral inclusion bodies 12 hpi or 24 hpi after GCRV infection.

[0024] Figure 6 The effect of PI4KB gene editing on the growth of grass carp larvae is shown in Figure A, where wild-type grass carp and PI4KB-edited grass carp are observed at the second week after hatching. + / - The weight of F0 generation grass carp; B represents the weight of wild-type grass carp and PI4KB at 4 weeks post-hatching. + / - The weight of F0 generation grass carp; C represents the weight of wild-type grass carp and PI4KB at 6 weeks post-hatching. + / - The weight of F0 generation grass carp; D represents the weight of wild-type grass carp and PI4KB in the 3rd month after hatching. + / - F0 generation grass carp body length and weight; E represents wild-type grass carp and PI4KB in the 5th-6th month after hatching. + / - The weight of F0 generation grass carp;

[0025] Figure 7 For wild-type grass carp and PI4KB + / - F0 generation grass carp sequencing peak diagram, A represents wild-type grass carp and PI4KB. + / - F0 generation grass carp genome sequencing peak diagram, B represents PI4KB. + / - Sequencing peak diagram of F0 generation grass carp with sense mutation type 1, C is PI4KB + / - Sequencing peak diagram of F0 generation grass carp with sense mutation type 2, D is PI4KB + / - Sequencing peak diagram of sense mutation type 3 in F0 generation grass carp;

[0026] Figure 8 The effects of PI4KB gene editing on juvenile fish survival after infection and on signaling pathways significantly affected by GCRV infection are shown in Figure A, where A represents the effects of PI4KB gene editing on wild-type grass carp and juvenile grass carp after GCRV injection infection. + / - F0 generation grass carp infection survival rate at different time points; B represents the PI4KB at 5 days after GCRV injection infection. + / - The F0 generation grass carp gut showed significantly enriched differentially expressed gene upregulation in signaling pathways compared to the wild-type grass carp gut; C represents the upregulation of differentially expressed genes in wild-type grass carp and PI4KB at 5 days after GCRV injection infection. + / -Heatmap of differentially expressed genes related to apoptosis signaling pathways in the intestinal tissue of F0 generation grass carp; D represents the expression of wild-type grass carp and PI4KB genes 5 days after GCRV injection infection. + / - Heatmap of differentially expressed genes related to cellular senescence in the intestinal tissue of F0 generation grass carp; E represents the expression of wild-type grass carp and PI4KB genes 5 days after GCRV injection infection. + / - Heatmap of differentially expressed genes related to cell cycle in the intestinal tissue of F0 generation grass carp. Detailed Implementation

[0027] This invention provides the application of grass carp PI4KB as a target molecule in the preparation of grass carp that is resistant to hemorrhagic disease and / or fast-growing.

[0028] In this invention, the grass carp PI4KB refers to grass carp phosphatidylinositol 4-kinase IIIβ. The nucleotide sequence of the grass carp PI4KB can be or includes the NCBI reference sequence: Gene ID: 127497169. The nucleotide sequence of PI4KB can be, or includes but is not limited to, a nucleotide sequence having at least 80%, 85%, 90%, or 95% identity with the NCBI reference sequence: Gene ID: 127497169, and an amino acid sequence having the characteristics or function of PI4KB.

[0029] This invention has discovered that grass carp PI4KB has a negative regulatory effect on GCRV infection. Inhibiting the activity of grass carp PI4KB, such as by adding the PIK-93 compound, or inhibiting the expression of grass carp PI4KB, such as by editing the PI4KB gene using CRISPR / Cas9 technology, can suppress grass carp reovirus infection and promote grass carp growth. Therefore, the reagent for preparing grass carp PI4KB inhibitors for treating hemorrhagic disease and / or fast-growing grass carp is preferably a grass carp PI4KB inhibitor. More preferably, the grass carp PI4KB inhibitor comprises a regulator that reduces PI4KB expression, a protease that degrades PI4KB, or a reagent that reduces PI4KB activity. The regulator that reduces PI4KB expression preferably includes a reagent that knocks down or silences PI4KB expression; the reagent that reduces PI4KB activity preferably includes the PIK-93 compound. The reagent that knocks down or silences PI4KB expression preferably includes one or more of the following: CRISPR / Cas9 system, siRNA, shRNA, and miRNA. The CRISPR / Cas9 system preferably includes a gRNA that reduces or knocks out PI4KB expression, the nucleotide sequence of which is shown in SEQ ID NO. 5.

[0030] In this invention, the hemorrhagic disease is preferably caused by grass carp reovirus (GCRV) infection. The fast-growing grass carp refers to grass carp that grows faster than wild-type grass carp, or whose body length and weight are significantly greater than wild-type grass carp at the same stage.

[0031] Furthermore, this invention provides a CRISPR / Cas9 system for preparing grass carp resistant to hemorrhagic disease and / or fast-growing species. The CRISPR / Cas9 system includes a gRNA that reduces or knocks out PI4KB expression, the nucleotide sequence of which is shown in SEQ ID NO. 5. The CRISPR / Cas9 system also includes Cas9 mRNA; the concentration of the Cas9 mRNA is preferably 100–140 ng / μL, more preferably 110–130 ng / μL, and even more preferably 120 ng / μL; the concentration of the gRNA is preferably 500–700 ng / μL, more preferably 550–650 ng / μL, and even more preferably 600 ng / μL; the volume ratio of the Cas9 mRNA to the gRNA is preferably 1:1. The final concentration of the Cas9 mRNA is preferably 50–70 ng / μL, more preferably 55–65 ng / μL, and even more preferably 60 ng / μL; the concentration of the gRNA is preferably 250–350 ng / μL, more preferably 260–340 ng / μL, and even more preferably 300 ng / μL. The Cas9 mRNA is derived from pGH7(T7:zCas9-UTRglobin) (from the National Zebrafish Resource Center, CZRC Catalog 1D:CZP4). The CRISPR / Cas9 system of this invention can effectively edit the PI4KB gene, thereby efficiently utilizing the CRISPR / Cas9 system to prepare grass carp resistant to hemorrhagic disease and / or fast-growing species.

[0032] This invention provides a method for preparing grass carp resistant to hemorrhagic disease and / or fast-growing grass carp, comprising the steps of using the above-mentioned grass carp PI4KB inhibitor or the above-mentioned CRISPR / Cas9 system to reduce or knock out the expression level and / or activity of PI4KB in grass carp, thereby obtaining grass carp resistant to hemorrhagic disease and / or fast-growing grass carp.

[0033] In this invention, the reduction of PI4KB expression and / or activity in grass carp can be achieved by introducing the aforementioned CRISPR / Cas9 system. As a preferred embodiment, this includes the step of introducing the aforementioned CRISPR / Cas9 system into grass carp to obtain grass carp resistant to hemorrhagic disease and / or fast-growing.

[0034] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0035] Example 1

[0036] Sequence characteristics of grass carp PI4KB and electrophoresis experiments of proteins expressed by the gcPI4KB-FLAG recombinant expression vector

[0037] In this embodiment, the nucleotide sequence of grass carp PI4KB (named gcPI4KB) was queried and downloaded from the NCBI database, and then based on its sequence and the eukaryotic expression vector p3×FLAG-CMV, the sequence was analyzed. TM Multiple cloning sites were identified at -14, and primers were designed using Clone Manager software. The CDS region of gcPI4KB was amplified using wild-type grass carp cDNA as a template, while simultaneously targeting gcPI4KB and p3×FLAG-CMV. TM -14 was double-digested, and gcPI4KB was inserted into FLAG-CMV via ligation. TM The *G. coli* PI4KB vector was used to transform *E. coli* DH5α competent cells. Single clones were selected for culture and sequencing verification. The correctly sequenced gcPI4KB nucleotide sequence was translated into a protein sequence, and the protein domains of gcPI4KB were analyzed in the NCBI database. The protein domain map of gcPI4KB was constructed using Illustrator for Biological Sequences (IBS) software. Simultaneously, strains with correct sequencing results were selected for amplification culture. Plasmids were extracted using the OMEGA kit, and the concentration and purity of the plasmids were detected using a micro-ultraviolet spectrophotometer. The grass carp PI4KB plasmid was named gcPI4KB-FLAG and transfected into CIK cells. After 48 hours of transfection, cells were collected, and cellular proteins were extracted using RIPA lysis buffer and verified for expression by Western blotting.

[0038] Experimental results are as follows Figure 1 As shown, the grass carp PI4KB fully encodes 835 amino acids and contains two domains: PI4KB_NTD and PI3_PI4_Kinase. Figure 1 (A) The protein size detected by Western blotting matched the predicted gcPI4KB-FLAG protein size, and the band was single, located between 80 and 115 kDa (the calculated molecular weight of gcPI4KB-FLAG is approximately 99 kDa). Figure 1 (B in the middle).

[0039] The correctly sequenced gcPI4KB nucleotide sequence is shown in SEQ ID NO.1; the amino acid sequence of gcPI4KB is shown in SEQ ID NO.2.

[0040] Example 2

[0041] Effects of gcPI4KB overexpression in CIK cells on GCRV infection and viral replication

[0042] In this embodiment, CIK cells were divided into 5×10 5Cells were evenly seeded in 12-well plates. After 12 hours, 1 μg of empty FLAG plasmid or gcPI4KB-FLAG plasmid prepared in Example 1 was transfected into CIK cells. The experiment included an uninfected group (Mock) and a GCRV-infected group, with three replicates per group. 36 hours after transfection, GCRV-infected cells were added to each well of GCRV-infected group (MOI: 1) diluted with 500 μL serum-free MEM medium; the uninfected group was added to each well of 500 μL serum-free MEM medium. Both groups of cells were incubated at 25°C. In the GCRV-infected group, the 12-well plates were gently shaken every 15 minutes. After 1 hour of incubation, the medium was removed; after washing the cells with PBS, 1 mL of MEM medium containing 2% FBS was added, and the cells were continued to culture at 25°C. 18 hours after infection, the cells were observed under a microscope. Once cytopathic effects appeared, 500 μL of supernatant was collected from each well of the infected group and placed in a 1.5 mL EP tube, which was then stored at -80°C. Add 250 μL of 4% paraformaldehyde to each well of all cells and fix the cells at room temperature for 30 min. Remove the fixative. Then add 300 μL of 1% crystal violet solution and incubate overnight at room temperature. Remove the crystal violet solution and air dry for photography.

[0043] In addition, CIK cells were prepared at a ratio of 1×10 5 Cells were seeded in 96-well plates. Collected GCRV virus supernatant was serially diluted with serum-free MEM medium, and 100 μL of the diluted virus suspension was added to each well. The plates were incubated at 25°C for 1 hour, after which the virus dilution was removed. Cells were washed with PBS, and 100 μL of MEM medium containing 2% FBS was added to each well. Columns 11 and 12 of the 96-well plate each contained 100 μL of MEM medium containing 2% FBS as a negative control. Cells were incubated at 25°C. On day 3, the presence of lesions in each well was observed under a microscope and compared with the negative control. The number of positive wells in each row was recorded. The TCID of GCRV was calculated using the Reed-Muench formula. 50 The values ​​were then converted to GCRV viral titers, expressed in PFU / mL. Graphs were plotted using Graphpad Prism 9.0, and the effects of overexpression of the empty FLAG plasmid and the gcPI4KB-FLAG plasmid on GCRV infection and replication were compared and analyzed.

[0044] The results are as follows Figure 2 As shown, compared with the control group overexpressing the empty FLAG plasmid, CIK cells overexpressing gcPI4KB-FLAG showed significantly enhanced lesion severity after GCRV infection (see Figure 1). Figure 2 In A), the viral titer increased significantly (see A). Figure 2 (B) The viral titer in the FLAG transfection group was 6.15 ± 0.06 Log.10 PFU / mL; the viral titer in the gcPI4KB-FLAG transfection group was 7.58 ± 0.09 Log. 10 PFU / mL; the viral titer in the gcPI4KB-FLAG transfection group was 26.7 times that in the FLAG transfection group. This result indicates that grass carp PI4KB plays a negative regulatory role in GCRV infection.

[0045] Example 3

[0046] The effect of inhibiting PI4KB kinase activity in grass carp before or after GCRV infection on cell survival and viral replication

[0047] Previous studies have shown that many viruses can utilize the host's PI4P to promote their own infection and replication, and the kinase activity of PI4KB is crucial for their synthesis of PI4P. The compound PIK-93 has been reported to specifically inhibit the kinase activity of PI4KB. This example will investigate the effect of PIK-93 treatment before or after GCRV incubation on GCRV infection and replication. The specific steps are as follows:

[0048] (1) Dissolve the ordered PIK-93 (purchased from Selleck, S1489) in DMSO to prepare a 10 mM stock solution, and dispense it into 1.5 mL EP tubes. Store at -80°C. When cells are ready for treatment, take an appropriate amount of the stock solution and dilute it with MEM medium containing 2% FBS to prepare different concentrations (1, 2 and 4 μM) of PIK-93 working solution.

[0049] (2) CIK cells were prepared at a concentration of 2.5 × 10⁻⁶. 5 Cells were evenly seeded in 24-well plates, designated as PIK-93 pretreatment plates before GCRV infection and PIK-93 posttreatment plates after GCRV adhesion infection. Within these two groups of plates, there were four subgroups: untreated (Mock), DMSO treated, 1 μM PIK-93 treated, 2 μM PIK-93 treated, and 4 μM PIK-93 treated, with three replicates for each treatment group.

[0050] (3) For PIK-93 pretreatment plates before GCRV infection, 500 μL of MEM medium containing DMSO or different working concentrations of PIK-93 working solution with 2% FBS was added to the cells. After 4 h, the cells were washed with PBS. Then, 200 μL of GCRV diluted with serum-free MEM medium (MOI=1) was added to each well, and the plates were placed in a 25°C incubator. The plates were gently shaken every 15 min. After GCRV adhesion for 1 h, the medium was removed. After washing the cells with PBS, 500 μL of MEM medium containing 2% FBS was added to each well, and the plates were cultured in a 25°C cell culture incubator. At the same time, 500 μL of MEM medium containing 2% FBS was added to each well of the untreated group. After 18 h of GCRV infection, the cells were observed under a microscope. After the cells showed cytopathic effects, 200 μL of the medium supernatant was taken from each well and placed in a 1.5 mL EP tube, which was then stored at -80°C for virus titer determination.

[0051] (4) For PIK-93-treated GCRV adhesion infection plates, 200 μL of GCRV diluted in serum-free MEM medium (MOI=1) was added to each well, and the plates were placed in a 25°C incubator. The plates were gently shaken every 15 min to mix. One h after GCRV adhesion, the cells were washed with PBS, and then treated with DMSO or different working concentrations of PIK-93. The cells were then cultured in a 25°C cell culture incubator. Meanwhile, 500 μL of MEM medium containing 2% FBS was added to each well of the untreated group. Eighteen h after infection, the cells were observed under a microscope. Once cytopathic effects were observed, 200 μL of the supernatant was aspirated from each well into a 1.5 mL EP tube and stored at -80°C for virus titer determination.

[0052] (5) Remove the culture medium from the 24-well plate from steps (3) and (4), add 150 μL of 4% paraformaldehyde solution to each well, fix at room temperature for 30 min, and then remove the fixative. Add 200 μL of 1% crystal violet solution to each well and incubate at room temperature overnight. After removing the crystal violet solution, air dry and take a picture.

[0053] (6) CIK cells were prepared at a rate of 1×10 5Cells were seeded in 96-well plates. The GCRV virus supernatant collected in steps (3) and (4) was taken out and serially diluted with serum-free MEM medium. Then, 100 μL of diluted virus suspension was added to each well, and the plates were incubated at 25°C for 1 h. After incubation, the virus dilution was removed. After washing the cells with PBS, 100 μL of MEM medium containing 2% FBS was added to each well. In the 96-well plates, 100 μL of MEM medium containing 2% FBS was added to columns 11 and 12 as negative controls. The cells were then cultured in a 25°C cell culture incubator. On day 3, the presence of lesions in each well was observed under a microscope and compared with the negative controls. The number of positive wells in each row of samples was recorded. The TCID of GCRV was calculated according to the Reed-Muench formula. 50 The values ​​were then converted to GCRV viral titers in PFU / mL. Graphs were plotted using Graphpadprism 9.0, and the effects of PIK-93 treatment on GCRV infection and replication before or after infection were compared and analyzed.

[0054] The results are as follows Figure 3 The results showed that treating cells with different working concentrations of PIK-93 before GCRV infection had no significant effect on GCRV infection or viral titer compared to the untreated group or the DMSO-treated group (see [link to study].) Figure 3 (A and B in the text). After GCRV adhesion infection, treatment with different working concentrations of PIK-93 significantly enhanced resistance to GCRV infection compared to the untreated group or the DMSO-treated group (see A and B in the text). Figure 3 (C in the text), and significantly reduced viral proliferation within cells (see C). Figure 3 (D in the original text). This result indicates that the inhibition of PI4KB kinase activity by PIK-93 is reversible. If PIK-93 is used to treat cells before infection to inhibit PI4KB kinase activity, and then PIK-93 is not replenished after changing the medium, the PI4KB kinase activity will recover. In this case, PIK-93 treatment will not affect GCRV invasion and proliferation. If different working concentrations of PIK-93 are added after GCRV infection, GCRV proliferation in cells can be significantly inhibited.

[0055] Example 4

[0056] Effects of inhibition of PI4KB kinase activity in grass carp on viral inclusion body formation prior to GCRV infection

[0057] In this embodiment, CIK cells were prepared at a ratio of 2.5 × 10⁻⁶. 5Cells were evenly seeded onto slides in 24-well plates, with three replicates per plate: untreated, DMSO-treated, and PIK-93-treated. 500 μL of MEM medium containing 2% FBS and DMSO or 4 μM PIK-93 was added to each well of the DMSO-treated or PIK-93-treated group, respectively. 500 μL of MEM medium containing 2% FBS was added to each well of the untreated group. After 4 hours, cells were washed with PBS. Then, 200 μL of GCRV diluted with serum-free MEM medium (MOI = 1) was added to each well, and the plates were incubated at 25°C for 1 hour, after which the medium was removed. After washing the cells with PBS, 500 μL of MEM medium containing 2% FBS was added to each well, and the plates were incubated at 25°C. Cells were fixed 12 or 24 hours after infection by adding 4% paraformaldehyde to each well and fixing at room temperature for 1 hour. After removing the fixative, the cells were washed three times with PBS. Each well was permeated with PBS containing 0.1% Triton X-100 for 10 min at room temperature. After three PBS washes, each well was blocked with PBS containing 5% BSA for 1 h at room temperature, followed by three more PBS washes. NS80 rabbit antibody or NS38 mouse antibody was diluted with PBST solution containing 2.5% BSA at an appropriate ratio and incubated overnight at 4°C. After three PBST washes, the secondary antibody (fluorescence 594 conjugated to anti-rabbit IgG, 1:500) or 488 conjugated to anti-mouse IgG, 1:500, was diluted with PBST solution containing 2% BSA and incubated at room temperature in the dark for 2 h. After three PBST washes, each slide was mounted with 10 μL of mounting medium containing DAPI, taking care to avoid air bubbles, and mounted overnight at room temperature in the dark. Finally, the cells were observed and photographed using a fluorescence inverted microscope, and the average fluorescence intensity of NS80 or NS38 was analyzed using ImageJ software.

[0058] The results are as follows Figure 4 As shown, NS38 and NS80 antibodies were used to indicate the production of GCRV viral inclusion bodies. Immunofluorescence revealed that PIK-93 treatment of cells before GCRV infection had no significant effect on viral inclusion body production compared to the untreated control group and the DMSO-treated control group.

[0059] Example 5

[0060] Effects of inhibition of PI4KB kinase activity in grass carp on viral inclusion body formation after GCRV infection

[0061] In this embodiment, CIK cells were prepared at a ratio of 2.5 × 10⁻⁶. 5Cells were evenly seeded onto slides in 24-well plates, with three replicates per plate: untreated, DMSO-treated, and PIK-93-treated. 200 μL of GCRV diluted with serum-free MEM medium (MOI = 1) was added to each well, and the plates were incubated at 25°C. After GCRV adhesion for 1 h, cells were washed with PBS. 500 μL of MEM medium containing DMSO or 4 μM PIK-93 in 2% FBS was added to each well of the DMSO-treated or PIK-93-treated group, respectively. 500 μL of MEM medium containing 2% FBS was added to each well of the untreated group, and the cells were incubated at 25°C. Cells were fixed 12 h or 24 h after infection by adding 4% paraformaldehyde to each well and fixing at room temperature for 1 h, then removing the fixative. After washing the cells three times with PBS, each well was permeabilized with PBS containing 0.1% Triton X-100 at room temperature for 10 min. Cells were then washed three times with PBS, and each well was blocked for 1 hour at room temperature with PBS solution containing 5% BSA. After washing three times with PBS, NS80 rabbit antibody or NS38 mouse antibody was diluted with 2.5% BSA in PBST solution at an appropriate ratio and incubated overnight at 4°C. After washing three times with PBST, fluorescent 594-conjugated anti-rabbit IgG (1:500) secondary antibody or fluorescent 488-conjugated anti-mouse IgG (1:500) secondary antibody was diluted with 2% BSA in PBST solution and incubated for 2 hours at room temperature in the dark. After washing three times with PBST for 5-10 minutes each time, each slide was mounted with 10 μL of mounting medium containing DAPI, taking care to avoid air bubbles, and mounted overnight at room temperature in the dark. Finally, the cells were observed and photographed using a fluorescence inverted microscope, and the average fluorescence intensity of NS80 or NS38 was analyzed using ImageJ software.

[0062] The results are as follows Figure 5 As shown, immunofluorescence revealed that DMSO treatment had no significant effect on the production of viral inclusion bodies compared to the untreated control group. However, compared to both the untreated and DMSO-treated control groups, PIK-93 treatment significantly reduced the production of viral inclusion bodies after GCRV adhesion infection.

[0063] Example 6

[0064] Effects of PI4KB gene editing on juvenile growth in grass carp

[0065] With the development of the global economy and food security, establishing a comprehensive food perspective and a diversified food supply system is a current consensus among humankind. Aquatic products are a crucial source of animal protein for residents, providing nearly 20% of the animal protein intake for approximately 3.1 billion people worldwide, thus occupying a vital position in the broader food system. However, given the limited space available for aquaculture, how to improve the growth rate of aquatic animals and increase the supply of aquatic animal protein is a pressing problem that needs to be solved. This embodiment utilizes CRISPR Cas9 technology to edit the PI4KB gene of grass carp. By tracking and recording the body length and weight of wild-type grass carp and grass carp with the PI4KB gene edited at various growth stages, the impact of PI4KB gene editing on the growth and development of grass carp is revealed. The specific operation is as follows:

[0066] (1) Based on the grass carp PI4KB genome information (Gene ID: 127497169), the target site of PI4KB was predicted on the ZIFIT website and gRNA primers were designed; gRNA-F: GTAATACACTCACTATA GCTCAATATGTACATCCACATGG TTTTAGAGCTAGAAATAGC (SEQ ID NO.3); gRNA-R: AAAAAAAGCACCGACTCGGTGCCAC (SEQ ID NO.4), the target site of PI4KB is inserted into the gRNA by PCR.

[0067] (1) After recovering and purifying the PCR product, use the MEGAshortscript™ Kit (Invitrogen) TM (#AM1354) Transcribe gRNA according to the instructions. After obtaining the transcript, extract the gRNA using LiCl (final concentration 2.5 nmol). After measuring the concentration, aliquot and store at -80°C. The nucleotide sequence of the gRNA is GUAAUACGACUCACUAUA. GCUCAA UAUGUACAUCCACAUGG UUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUUUU (SEQ ID NO. 5).

[0068] (2) pGH7(T7:zCas9-UTRglobin) (from the National Zebrafish Resource Center, CZRC Catalog 1D:CZP4) was linearized with Xba I restriction enzyme, placed in a PCR instrument at 37°C for more than 4 hours, and after confirming complete linearization by electrophoresis with a small amount, the Cas9 linearized product was directly recovered.

[0069] (3) Use T7 mMESSAGE Kit (Invitrogen) TM Linearized Cas9 was transcribed in vitro (#AM1345). After obtaining the transcript, the Cas9 transcript was extracted with LiCl (final concentration of 2.5 nmol). After the concentration was measured, the transcript was aliquoted and stored at -80℃ to obtain the mRNA of Cas9 protein.

[0070] (4) Dilute the synthesized gRNA and Cas9 mRNA with DEPC water to 120 ng / μL and 600 ng / μL, respectively. After dilution, mix them at a volume ratio of 1:1 to make the final concentrations of gRNA and Cas9 60 ng / μL and 300 ng / μL, respectively.

[0071] (5) The diluted gRNA and Cas9 mixture was injected into the animal pole of grass carp embryos in the 1-2 cell stage using a microinjector (Eppendorf) at a dose of 2 nL.

[0072] (6) After injection, wild-type grass carp embryos and F0 generation grass carp embryos injected with PI4KB gRNA-Cas9 mixture were placed in an embryo incubation cycle device for incubation. After all the grass carp fry hatched 4 days after fertilization, the fry were transferred to an economic fish farming system with a stocking density of 200 fish / tank. Sufficient live brine shrimp were fed twice a day.

[0073] (7) Wild grass carp and PI4KB were randomly caught at 2, 4 and 6 weeks after fertilization. + / - Ten F0 generation grass carp juveniles were selected. 5 mg of MS222 (Sigma, #E10521) powder was added to 500 mL of culture water to achieve a final concentration of 10 mg / L. The grass carp were placed in the culture water containing the anesthetic. When the grass carp were observed to be unable to swim normally, they were quickly removed, and their body length was measured with a ruler. The surface moisture of the fish was wiped off, and their weight was measured using an analytical balance and recorded.

[0074] (8) When the grass carp fry reach 6 weeks of age, wild-type and PI4KB + / - All F0 generation grass carp fry were transferred to ponds to ensure adequate oxygenation in the aquaculture water, and fed twice daily with Haida feed.

[0075] (9) When the grass carp have grown to 3 months old, wild grass carp and PI4KB are randomly caught. + / - Twenty F0 generation grass carp juveniles were anesthetized with MS222 (final treatment concentration 10 mg / L). The body length of the juveniles was measured with a tape measure, the surface moisture was wiped off, and the weight was measured using an analytical balance and recorded. Photos of 3-month-old wild-type grass carp and PI4KB images were also taken. + / -Photos of F0 generation grass carp fry. Finally, they were quickly placed in the culture water, and after the fry recovered, they were put back into the culture system. Each operation did not cause the fish to become sick or die.

[0076] (8) When the grass carp grow to 5-6 months old, randomly catch wild grass carp and PI4KB. + / - Approximately 210 F0 generation grass carp juveniles were anesthetized using MS222 (final treatment concentration 10 mg / L). The weight of the juveniles was measured using an analytical balance and recorded.

[0077] (9) PI4KB was extracted for 5-6 months using the high-salt sodium chloride method. + / - The genome of the caudal fins of F0 generation grass carp (30 fish randomly selected) was analyzed. Identification primers were designed within 200 bp around the PI4KB-gRNA target site [Identification primers PI4KB-F: GCAGCTCCTGGCTCCTGCGTC (SEQ ID NO. 9); PI4KB-R: CTGGCTGGAGGGCTTGAG (SEQ ID NO. 10)]. High-fidelity PCR amplification was performed using a high-fidelity enzyme. The PCR products were then subjected to first-generation DNA sequencing to determine whether the grass carp PI4KB gene sequence had changed near the target site, thus identifying the PI4KB gene. + / - The mutation rate of heterozygous individuals.

[0078] The results are as follows Figure 6 As shown, in the second week after hatching, the average body length of wild-type grass carp was 1.201 ± 0.037 cm; PI4KB + / - The average body length of F0 generation grass carp is 1.59±0.051cm; the average weight of wild-type grass carp is 0.036±0.006g; PI4KB + / - The average weight of F0 generation grass carp is 0.053 ± 0.005 g (see...) Figure 6 (A) In the fourth week after hatching, the average body length of wild-type grass carp was 2.245 ± 0.060 cm; PI4KB + / - The average body length of F0 generation grass carp is 2.75±0.047cm; the average weight of wild-type grass carp is 0.214±0.009g; PI4KB + / - The average weight of F0 generation grass carp is 0.32 ± 0.011 g (see...) Figure 6 (B) In the 6th week after hatching, the average body length of wild-type grass carp was 4.11 ± 0.068 cm; PI4KB + / - The average body length of F0 generation grass carp is 4.908±0.074cm; the average weight of wild-type grass carp is 0.511±0.028g; PI4KB + / - The average weight of F0 generation grass carp is 1.015 ± 0.029 g (see...) Figure 6(C) In the third month after hatching, the average body length of wild-type grass carp was 6.985 ± 0.285 cm; PI4KB + / - The average body length of F0 generation grass carp is 10.09±0.340cm; the average weight of wild-type grass carp is 4.301±0.611g; PI4KB + / - The average weight of F0 generation grass carp is 11.895±1.618g (see...) Figure 6 (D) In ​​the 5th to 6th month after hatching, the average weight of 210 wild-type grass carp was 10.743±3.789g; 210 PI4KB + / - The average weight of F0 generation grass carp is 18.259 ± 5.304 g (see...) Figure 6 (E in the text). These results indicate that the grass carp heterozygous population with PI4KB gene editing exhibits a significant growth advantage.

[0079] 30 PI4KB tails were randomly tested + / - The genomes of F0 generation grass carp were analyzed, with 10 fish showing bimodal sequencing results. Figure 7 The result in A) indicates a mutation in the PI4KB gene. The mutation rate of the PI4KB gene is 33%. Further identification of the significance mutation sites in the PI4KB gene was performed: PI4KB + / - At least three sense mutation types exist in F0 generation grass carp. Compared with wild-type grass carp, the PI4KB mutation type 1 has a deletion of 10 nucleotides. Figure 7 In the B), the PI4KB mutation type 2 has a deletion of 2 nucleotides (B). Figure 7 In the C), the PI4KB mutation type 3 inserts two nucleotides (C). Figure 7 (D in the middle).

[0080] Example 7

[0081] The effects of PI4KB gene editing on juvenile fish survival after infection and the signaling pathways significantly affected by GCRV infection.

[0082] This embodiment utilizes CRISPR Cas9 technology to edit the PI4KB gene in grass carp. By studying the survival of grass carp with PI4KB gene editing after GCRV infection, as well as significantly enriched signaling pathways and differentially expressed genes in the intestine, the aim is to reveal the effect and mechanism of PI4KB gene knockout on the resistance of grass carp to hemorrhagic disease. The specific operation is as follows:

[0083] (1) When the grass carp grows to about 6 months old, wild grass carp and PI4KB obtained in Example 6 are randomly caught. + / - F0 generation grass carp, PI4K2B + / -120 each of F0 generation grass carp were placed in a light-proof packaging bag, and then sealed after adding an appropriate amount of aquaculture water and sufficient oxygen. The PI4K2B mentioned above... + / - The F0 generation of grass carp was prepared by editing the PI4K2B gene of grass carp using CRISPR Cas9 technology. The method was as follows: based on the grass carp PI4K2B genome information (Gene ID: 127515484), the target site of PI4K2B was predicted on the ZIFIT website, and gRNA primers were designed. gRNA-F1: GTAATACGACTCACTATACGGGGCAGCGGTCCGGATCTGTTTTAGAGCTAGAAATAG C (SEQ ID NO. 6); gRNA-R1: AAAAAAAGCACCGACTCGGTGCCAC (SEQ ID NO. 7). The sequence of the PI4K2B gRNA is GUAAUACGACUCACUAUACGGGGCAGCGGUCCGGAUCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (SEQ ID NO. 6). NO.8), other specific methods for editing the PI4K2B gene of grass carp using CRISPR Cas9 technology are described in Example 6.

[0084] (2) After transporting the grass carp to the laboratory, place them at room temperature for 1 hour to balance the temperature. Then, put them in the pre-aerated aquaculture water in the packaging bag to balance the water temperature for 30 minutes. Carefully open the packaging bag and wait for all the grass carp to swim into the glass tank.

[0085] (3) Place the grass carp in the system for a week, control the water temperature at around 25℃, and observe the health status of the grass carp at any time.

[0086] (4) After confirming that the grass carp have no stress or symptoms, prepare 6 infection boxes in advance. Each box is equipped with 2 aeration devices, 1 heater (set temperature to 28℃) and 35L of aquaculture water.

[0087] (5) On the day of infection, weigh 50 mg of MS222 and add it to 5 L of aquaculture water, stirring well to prepare anesthetized aquaculture water with a final concentration of 10 mg / L. Wild-type grass carp and PI4K2B... + / - F0 generation and PI4KB + / - F0 generation grass carp were transferred to anesthetized aquaculture water. Ten fish were anesthetized each time, and their body weight was recorded. GCRV-II (GD108 virus strain) suspension was injected into the peritoneum of the grass carp at an infection dose of 5 μL / g.

[0088] (6) Take wild grass carp, PI4KB + / - F0 generation grass carp juveniles and PI4K2B + / - 105 F0 generation grass carp juveniles were injected intraperitoneally with GCRV-II (the remaining 15 fish served as uninfected controls). Each group of 105 grass carp was randomly divided into 3 parallel treatments, with 35 grass carp in each parallel treatment group, and placed in 6 pre-prepared infection boxes.

[0089] (7) Based on the weight recorded in step (5), calculate the total weight of 35 fish in each parallel treatment group, and replenish the culture water in the infection tank according to the total weight (infection volume = [total weight of 35 grass carp / minimum total weight of 35 grass carp] × 35L culture water).

[0090] (8) After the injection, the water temperature should be monitored at any time and kept at 28°C. If there are no deaths within 12 hours after the injection, the effects of human operations such as anesthesia and intraperitoneal injection on the fish body should be ruled out. During the infection process, feed should be provided every day, and the aquaculture water should be changed and the metabolites should be cleaned every two days.

[0091] (9) Observe the fish's survival status and disease symptoms twice a day, morning and evening. Remove dead fish in time and count the number of dead grass carp in each group until there are no more dead fish. Calculate the daily survival rate and plot the survival curve.

[0092] (10) Based on the disease status of the fish, collect wild-type grass carp PI4K2B injected with GCRV during the peak of infection. + / - F0 generation grass carp juveniles and PI4KB + / - Six F0 generation grass carp juveniles were harvested. After an ice bath, the tail fins of the grass carp were immediately removed and placed in 400 μL of DNA lysis buffer for genome extraction. Intestinal tissue was collected from the grass carp, and after removing the intestinal contents, it was placed in 1.5 mL RNase-free EP tubes, rapidly frozen on dry ice, and then transferred to liquid nitrogen for storage. After being rapidly frozen in liquid nitrogen for 3–5 hours, it was transferred to a -80°C freezer for storage and used for transcriptome sequencing.

[0093] (11) Wild-type grass carp preserved at -80℃ and PI4KB as confirmed by sequencing were used. + / -The livers of heterozygous grass carp individuals were sent to Biomarker Biotech for transcriptome sequencing. Total RNA was extracted from the samples, and the purity and concentration of RNA were determined using a NanoDrop 2000 spectrophotometer; RNA integrity was precisely detected using an Agient2100 / LabChip GX. After the samples passed the tests, eukaryotic mRNA was enriched using magnetic beads with Oligo(dT) and fragmented randomly with Fragmentation Buffer. The first and second strands of cDNA were synthesized using the mRNA as a template, and the cDNA was purified. The purified double-stranded cDNA underwent end repair, A-tailing, and ligation with sequencing adapters. Fragment size selection was then performed using AMPure XP beads, and finally, cDNA libraries were obtained through PCR enrichment.

[0094] (12) After library construction, preliminary quantification was performed using a Qubit 3.0 real-time fluorescence analyzer, with a concentration exceeding 1 ng / µL. Subsequently, the Qsep400 high-throughput analysis system was used to detect the inserted fragments in the library. Once the inserted fragments met expectations, the effective concentration of the library (effective concentration > 2 nM) was accurately quantified using Q-PCR to ensure library quality. After the library passed quality control, PE150 mode sequencing was performed using an Illumina GenomeAnalyzer II.

[0095] (13) After sequencing, data analysis was performed using the bioinformatics analysis workflow provided by BMKCloud (www.biocloud.net). The sequencing data was filtered to obtain Clean Data, which was then aligned with the specified reference genome to obtain Mapped Data. Library quality assessment, structural analysis, differential expression analysis, gene function annotation, and functional enrichment were then performed.

[0096] (14) Based on the sequencing and differential expression analysis results, select appropriate differentially expressed genes and use the BMKCloud platform (www.biocloud.net) to perform clustering heatmap analysis and draw clustering heatmaps.

[0097] The results are as follows Figure 8 As shown, after GCRV injection infection, wild-type grass carp began to die in large numbers from day 4, reaching a peak mortality rate of 84.37% on day 7, with a survival rate of only 15.63%; the survival rate dropped to 6.25% by day 14. PI4KB + / - F0 generation grass carp began to die in large numbers on day 5, reaching peak mortality on day 7, with a survival rate of 54.17%; the survival rate on day 14 was 19.79%. Compared with wild-type grass carp populations, the survival rate increased by 13.54% (see...). Figure 8(A in the text). Unlike PI4KB, another grass carp PI4K molecule, namely the type II kinase PI4K2B, showed no significant difference in resistance to GCRV infection between heterozygous and wild-type grass carp (see A in the text). Figure 8 (A) KEGG enrichment analysis was performed on the total differentially expressed genes (upregulated and downregulated), WT vs PI4KB. + / - No significantly enriched signaling pathways were observed. KEGG enrichment analysis of the upregulated differentially expressed genes revealed that the significantly enriched signaling pathways in the PI4KB gene-edited grass carp heterozygous juveniles mainly involved cell growth and death signaling pathways, including apoptosis, cellular senescence, and cell cycle. Furthermore, the signaling pathway for glycosphingolipid biosynthesis was also significantly enriched (see [link to KEGG analysis]). Figure 8 (B in the text). Specifically, 12, 12, and 9 differentially expressed genes, respectively, were upregulated and involved in apoptosis (see [reference]). Figure 8 C) Cellular senescence (see C) Figure 8 D in the middle) and cell cycle (see D) and cell cycle (see Figure 8 The E in this context includes genes known to affect cell survival, such as p53, perforin, and cysteine ​​aspartate protease Caspase-3.

[0098] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of grass carp PI4KB inhibitor in the preparation of grass carp resistant to hemorrhagic disease and fast-growing species, characterized in that, The hemorrhagic disease mentioned is caused by grass carp reovirus infection; The grass carp PI4KB inhibitor is a CRISPR / Cas9 system, which includes a gRNA that reduces or knocks out PI4KB expression, and the nucleotide sequence of the gRNA is shown in SEQ ID NO.

5.

2. A CRISPR / Cas9 system for preparing grass carp resistant to hemorrhagic disease and fast-growing species, characterized in that, The CRISPR / Cas9 system includes a gRNA that reduces or knocks out PI4KB expression, the nucleotide sequence of which is shown in SEQ ID NO.5; the hemorrhagic disease is a hemorrhagic disease caused by grass carp reovirus infection.

3. The CRISPR / Cas9 system according to claim 2, characterized in that, The CRISPR / Cas9 system also includes Cas9 mRNA; the concentration of the Cas9 mRNA is 100–140 ng / μL, the concentration of the gRNA is 500–700 ng / μL, and the volume ratio of the Cas9 mRNA to the gRNA is 1:

1.

4. A method for preparing grass carp resistant to hemorrhagic disease and exhibiting fast growth, characterized in that, The method includes the step of reducing or knocking out the expression level and / or activity of PI4KB in grass carp using the CRISPR / Cas9 system as described in claim 2 or 3, to obtain grass carp resistant to hemorrhagic disease and fast-growing.

5. The preparation method according to claim 4, characterized in that, The method includes the step of introducing the CRISPR / Cas9 system described in claim 2 or 3 into grass carp to obtain grass carp that are resistant to hemorrhagic disease and grow rapidly.

Images