A sulfonamide compound, a preparation method and use thereof

By developing sulfonamide compounds with MDH2 inhibitory activity, the problem of insufficient quantity and efficacy of existing anti-aging drugs has been solved, achieving significant anti-aging effects and life extension.

CN118255698BActive Publication Date: 2026-01-02HAINAN UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410352305.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-03-26
Publication Date
2026-01-02
Estimated Expiration
2044-03-26

AI Technical Summary

Technical Problem

The number of existing anti-aging drugs is limited and their effects are not significant, failing to effectively slow down the aging process.

Method used

A sulfonamide compound with significant MDH2 inhibitory activity is provided for the preparation of malate dehydrogenase inhibitors and anti-aging products, which delay aging by inhibiting malate dehydrogenase (MDH2).

Benefits of technology

It significantly extends lifespan and alleviates aging, improves physiological parameters, and has good safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118255698B_ABST
    Figure CN118255698B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to a sulfonamide compound and a preparation method and application thereof. It is found for the first time that malate dehydrogenase is closely related to aging, and inhibiting malate dehydrogenase can achieve a significant anti-aging effect. Based on this, the application provides a sulfonamide compound, the compound has a significant inhibitory effect on malate dehydrogenase, can prolong the life of nematodes, achieves a significant anti-aging effect, and has good safety, thereby providing more safe compounds for anti-aging drugs.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine. More particularly, it relates to a sulfonamide compound and a preparation method and use thereof. BACKGROUND

[0002] Senescence is accompanied by the loss of homeostasis and physiological degradation, and is the main inducement of most chronic diseases in the elderly. It is estimated that by 2050, more than 20% of the world's population will be elderly. Although aging is an irreversible process, research shows that the aging process can be slowed down through some interventions. For example, Chinese patent application CN112022862A found that sulfonylurea hypoglycemic drugs (such as glibenclamide, chlorpropamide, glimepiride, tolbutamide, etc.) can prolong the life of nematodes, but the specific target of action is unclear, and the anti-aging effect is limited, which greatly affects its wide application. Therefore, there is an urgent need to provide more compounds with anti-aging effect for research and development and clinical application. SUMMARY

[0003] The technical problem to be solved by the present application is to overcome the defects and deficiencies of the limited number and effect of existing anti-aging drugs, and to provide a sulfonamide compound with significant anti-aging effect.

[0004] The purpose of the present application is to provide a preparation method of the sulfonamide compound.

[0005] Another purpose of the present application is to provide the use of the sulfonamide compound in the preparation of malate dehydrogenase inhibitors.

[0006] Still another purpose of the present application is to provide the use of the sulfonamide compound in the preparation of anti-aging products.

[0007] The above purposes of the present application are achieved by the following technical solutions:

[0008] Malate dehydrogenase (MDH) is an important oxidoreductase in the tricarboxylic acid cycle (TCA), and MDH isoenzyme mitochondrial MDH2 is one of the important enzymes in the TCA cycle of the human body. Mutation of MDH2 can cause obstruction of the TCA cycle, thereby affecting cellular energy metabolism and causing early-onset mitochondrial phenotype diseases such as psychomotor retardation and intractable epilepsy. The present application found that the expression level of MDH2 in senescent cells is significantly increased, and glibenclamide can inhibit the activity of MDH2, thereby effectively alleviating cell and mouse senescence, improving physiological parameters, and significantly prolonging lifespan. It is first proved that inhibiting the activity of MDH2 can achieve the anti-aging effect of improving physiological parameters and prolonging lifespan.

[0009] Based on this, the application provides a sulfonamide compound with significant MDH2 inhibitory activity and anti-aging effect, the sulfonamide compound having formula I A Structure:

[0010]

[0011] wherein R 1 is adamantyl or substituted adamantyl; the substituent of the substituted adamantyl is hydroxyl or methyl;

[0012] R 2 , R 3 , R 4 , R 5 , R 6 are each independently selected from hydrogen, halogen, hydroxyl, -COOR7, C 1~6 alkoxy or substituted C 1~6 alkoxy; the substituent of the substituted C 1~6 alkoxy is C 3~6 cycloalkyl; R7 is C 1~6 alkyl;

[0013] n is an integer from 0 to 5.

[0014] Preferably, R 1 is adamantyl or substituted adamantyl; the substituent of the substituted adamantyl is hydroxyl;

[0015] R 2 , R 3 , R 5 , R 6 are each independently selected from hydrogen, halogen, hydroxyl, C 1~3 alkoxy;

[0016] R 4 is selected from hydrogen, halogen, -COOR7, C 1~6 alkoxy or substituted C 1~6 alkoxy; the substituent of the substituted C 1~6 alkoxy is C 3~6 cycloalkyl; R7 is C 1~3 alkyl;

[0017] n is 1, 2 or 3.

[0018] More preferably, R 1 is adamantyl or substituted adamantyl; the substituent of the substituted adamantyl is hydroxyl;

[0019] R 2 , R 3 , R 5 , R 6each independently selected from hydrogen, chloro, hydroxyl, methoxy;

[0020] R 4 selected from hydrogen, fluorine, chlorine, iodine, -COOCH3, C 2~6 alkyl or substituted C 1~3 alkyl; the substituents of the substituted C 1~3 alkyl are C 3~6 cycloalkyl;

[0021] n is 1, 2 or 3.

[0022] In particular, R 1 is adamantyl or substituted adamantyl; the substituents of the substituted adamantyl are hydroxyl;

[0023] R 2 , R 3 , R 5 , R 6 each independently selected from hydrogen, chloro, hydroxyl, methoxy;

[0024] R 4 selected from hydrogen, fluorine, chlorine, iodine, -COOCH3, C 2~6 alkyl or substituted C 1~3 alkyl; the substituents of the substituted C 1~3 alkyl are C 3~6 cycloalkyl; and R 4 is not methoxy when R 2 is -COOCH3.

[0025] n is 1, 2 or 3.

[0026] Further, the sulfamides also include pharmaceutically acceptable salts, isotopic variants or stereoisomers of the structure of formula I. The isotopic variants of the compounds are equivalent to the compounds of formula (I) A but one or more atoms are replaced by atoms having an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes which can be incorporated into the compounds of the application include isotopes of hydrogen, carbon, nitrogen, oxygen, fluorine and chlorine, for example 2 H, 3 H, 13 C, 11 C, 14 C, 15 N, 18 O, 17 O, 18 F and 36 Cl.

[0027] Preferably, the pharmaceutically acceptable salts are salts of the structure of formula I with a pharmaceutically acceptable acid or base.

[0028] Compounds of the present application containing the above-mentioned isotopes and / or other isotopes of atoms are within the scope of the present application, as are prodrugs, salts, solvates and stereoisomers of such compounds.

[0029] The present application discloses a sulfonamide compound, and the sulfonamide compound or a combination thereof in the preparation of a malate dehydrogenase inhibitor.

[0030] Preferably, the malate dehydrogenase is malate dehydrogenase type 2 (MDH2).

[0031] In addition, based on the fact that the malate dehydrogenase inhibitor has significant anti-aging activity, the present application also provides the sulfonamide compound or a combination thereof in the preparation of an anti-aging product.

[0032] Further, the anti-aging is prolonging life and / or delaying aging.

[0033] Preferably, the anti-aging product further comprises a pharmaceutically acceptable excipient.

[0034] Further, the anti-aging product is a pharmaceutical product or a cosmetic product.

[0035] Preferably, the dosage form of the pharmaceutical product is an injection or an oral agent. More preferably, the oral agent comprises a tablet, a capsule, a granule, a suspension, a pill, a solution or a syrup.

[0036] The present application has the following beneficial effects:

[0037] The present application first discovers that malate dehydrogenase is closely related to aging, and inhibiting malate dehydrogenase can achieve a significant anti-aging effect. Based on this, the present application provides a sulfonamide compound, which has a significant inhibitory effect on malate dehydrogenase, can prolong the life of nematodes, achieve a significant anti-aging effect, and has good safety, thereby providing more safe compounds for anti-aging drugs. BRIEF DESCRIPTION OF DRAWINGS

[0038] Figure 1 Western blotting (left) and quantitative statistics (right) of MDH2 expression levels in senescent cells with changes in cell aging.

[0039] Figure 2 Data statistics chart of the inhibitory activity of glibenclamide on MDH2.

[0040] Figure 3Figure 1 is a graph of the statistical data of the cell anti-aging activity and mechanism experiment of glibenclamide; wherein, the graph of the statistical data of the effect of glibenclamide on the expression of SA-β-gal (A) or p16 (C) in the adriamycin-induced human embryonic lung fibroblast MRC-5 aging model, and the graph of the statistical data of the effect of glibenclamide on the expression of SA-β-gal (B) or p16 (D) in the replicative senescence of mouse primary fibroblast MEF aging model.

[0041] Figure 4 Figure 2 is a graph of the statistical data of the effect of glibenclamide on the levels of SASP factors: MMP1 (A), IL-6 (B), IL-1β (C), TNF-α (D) in the adriamycin-induced human embryonic lung fibroblast MRC-5 aging model, and the graph of the statistical data of the effect of glibenclamide on the expression levels of SASP (MMP3, CXCL-1, CXCL-2, CXCL-3) in the replicative senescence of mouse primary fibroblast MEF aging model (E).

[0042] Figure 5 Figure 3 is a graph of the statistical data of the glibenclamide delaying aging experiment in mice; the graphs of the statistical data of the urea content (A) and the uric acid content (B) in the serum of mice, and the graphs of the statistical data of the exercise capacity (C), the aging-related weakness phenotype (D), and the lifespan (E) of 16-month-old mice.

[0043] Figure 6 Figure 4 is a graph of the statistical data of the NAD+ level changes in MRC-5 cells after glibenclamide acts on MRC-5 cells with or without MDH2 knockdown for one day (A), the NAD+ content after glibenclamide acts on MRC-5 cells with or without MDH2 knockdown for three days (B), and the NAD+ content after glibenclamide acts on MEF cells with or without MDH2 knockdown for one day (C). + + +

[0044] Figure 7 Figure 5 is a graph of the statistical data of the anti-aging activity experiment of glibenclamide (A) or the sulfonamide compounds 23a (B), 24a (C), and 25a (D) of the present application on wild-type C. elegans. DETAILED DESCRIPTION

[0045] The present application will be further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present application in any form. Unless otherwise specified, the reagents, methods, and equipment used in the present application are conventional reagents, methods, and equipment in the technical field.

[0046] Among them, the MEF cells with MDH2 knockdown can be purchased or prepared according to the following method:

[0047] ​​​Logarithmic phase growth of MEF cells were seeded into 6-well plates at a density of 1 x 10^5 cells per well, after the cells adhered, the lentivirus particles were added, the MOI value was 60, and the eGFP fluorescence expression was observed under a fluorescence microscope every 12 h. After one day of lentivirus incubation, the original culture medium was removed, and fresh culture medium was added for continuous culture for one day, and then the cells were collected for Western blotting experiment to detect the expression of MDH2, and then obtained.

[0048] Among them, the construction of lentivirus particles and MDH2 shRNA is responsible for Shanghai Tailu Biological Technology Co., Ltd. The MDH2 knockdown sequence is as follows: sh-Scramble: 5' GAGCAAATGTGAAAGGCTACC 3'; sh-MDH2: 5' GAGCAAATGTGAAAGGCTACCGCTGTGCTTGCTGGTAGCCTTTCACATTTGCTC 3'.

[0049] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0050] Example 1 Expression of MDH2 in senescent cells

[0051] In the MEF cell model in vitro which is replicated to senescence (wherein the MEF cells are extracted from C57BL / 6J mouse embryos, which belong to a limited cell line and will senesce after multiple passages, and the proliferative growth ability decreases), the whole protein in the 7th, 9th and 11th generation cells was extracted, and the MDH2 protein content in the cells was detected by Western blotting experiment.

[0052] The results are shown in Figure 1 As can be seen from the figure, the expression of MDH2 increases significantly with cell senescence, which indicates that MDH2 is involved in the process of cell senescence and is positively correlated with the degree of senescence.

[0053] Example 2 Inhibitory activity of glibenclamide on MDH2

[0054] MDH2 protein was diluted with 100 mM HEPES buffer to a final concentration of 1 nM, and 100 mM HEPES buffer was used to prepare NADH solution with a final concentration of 0.8 mM, oxaloacetate solution with a final concentration of 2.4 mM, and glibenclamide (Gli) solution with a final concentration of 200 μM; 100 μL of NADH solution, glibenclamide solution and MDH2 protein diluent were mixed in a 1.5 mL centrifuge tube, and then 90 μL of each was added to each well of a 96-well plate, with a total of 3 replicate wells; finally, 30 μL of oxaloacetate solution was added to each well, and the absorbance value was detected at OD = 340 nM by an enzyme marker; the amount of substrate oxaloacetate consumed by the protein was detected within 30 min.

[0055] The results are shown in Figure 2As shown in the figure, the inhibition rate of glibenclamide on MDH2 reached 47% at 200 μM, indicating that glibenclamide can significantly inhibit the activity of MDH2 protein.

[0056] Example 3 Cell anti-aging activity and mechanism of glibenclamide

[0057] 1. Doxorubicin-induced human embryonic lung fibroblast MRC-5 aging model: MRC-5 cells were cultured in a medium containing 100 nM doxorubicin to induce them into an aging state; uninduced MRC-5 cells were used as a young control (Young), and a blank control group containing 0.5% DMSO (Dox), a 100 μM glibenclamide group (Dox-Gli), and a 100 μM metformin positive control group (Dox-Met) were set up, and the drugs were administered in the cell complete medium, and SA-β-gal and p16 expression level detection was performed on the 7th day of administration.

[0058] 2. Replicative senescent mouse primary fibroblast MEF aging model: MEF cells were cultured to the 7th passage after primary extraction; a blank control group containing 0.5% DMSO (DMSO), a 100 μM glibenclamide group (Gli), and a 100 μM metformin positive control group (Met) were set up, and the drugs were administered in the cell complete medium, and p16 level detection was performed on the 5th day of administration, and SA-β-gal detection was performed on the 15th day of administration.

[0059] Results are shown in Figure 3 As shown in the figure, glibenclamide can reduce the SA-β-gal positive cell rate (A, B) and p16 protein expression (C, D) in the doxorubicin-induced aging MRC-5 aging model and the replicative senescent mouse primary fibroblast MEF cell aging model. Figure 3 Figure 3

[0060] 3. For the above-mentioned doxorubicin-induced human embryonic lung fibroblast MRC-5 aging model, the cells and culture supernatant were collected on the 7th day of administration for SASP factor level detection; for the above-mentioned replicative MRC-5 aging model, SASP factor level detection was performed using QPCR method on the 5th day of administration after natural passage when the MRC-5 cells grew slowly.

[0061] Results are shown in Figure 4 As shown in the figure, glibenclamide significantly down-regulated the SASP factors MMP1 (A), IL-6 (B), IL-1β (C), and TNF-α (D) in the chemically induced aging human fibroblast MRC-5 aging model. Figure 4 Figure 4 Figure 4 Figure 4 ​​​​​D) levels in the cells; and down-regulating the transcriptional levels of expression of MMP-3, CXCL-1 and CXCL-3 in the MRC-5 cell senescence model of replicative senescence Figure 4 E) in the cells; the above results show that glibenclamide achieves an anti-aging effect by down-regulating SASP factors.

[0062] Example 4 Anti-aging activity of glibenclamide in animals

[0063] Twelve-month-old C57BL / 6J male mice were administered for three months, with NAD+ precursor NMN (beta-nicotinamide mononucleotide) as a positive control. There were 30 mice in each of the blank group (vehicle), glibenclamide group (Gil-10 mg / kg), and NMN group (NMN, 500 mg / kg); the blank group and glibenclamide group were administered by gavage every day, and NMN was dissolved in drinking water to a final concentration of 500 mg / kg (the amount of drinking water consumed by each mouse was recorded every day for one week, the average amount of drinking water consumed by each mouse was calculated, and the NMN solution of 500 mg / kg was prepared according to the body weight and drinking water consumption of the mice, which was drunk by the mice every day); the vehicle for the blank group and the glibenclamide group was consistent, which was 15% PEG400 + 85% (0.9% physiological saline). After three months of administration, the urea and uric acid in the serum of the mice in each group, the exercise capacity, the frailty phenotype, and the survival rate were determined.

[0064] The instrument used for the determination of exercise capacity was a mouse and rat rotarod fatigue instrument (model XR-6C (mouse) Shanghai Xinsoft), and the determination of exercise capacity in the Pharmacological Experimental Methodology was referred to. The specific testing method was as follows: on the day of testing, the mice were kept in their own cages and adapted to the test room for 15 minutes, the body weight of each mouse was weighed and recorded on the data table; in order to facilitate identification in the subsequent test, the mice were marked with non-toxic ink before the test, and there were corresponding stripe marks at the bottom of the tail, and then the rotarod device was turned on.

[0065] Test phase: consisting of three trials with an inter-trial interval (ITI) of 15 minutes. It is possible to run the next batch of mice consecutively in one trial, followed by the next trial. There is no training period prior to the test phase. The apparatus is set to an accelerating mode from 4 to 40 revolutions in 300 seconds. The instrument displays a “speed up wait” at 4 rpm constant speed until the start (Strat) button is pressed.

[0066] Test 1 (T1): Mice are placed on the runway (if mice are difficult to handle, leave an empty runway between two mice, only 3 mice are measured per run). Try to get the mice on the bar to walk forward to maintain balance. The bar is initially rotated at a constant speed of 4 rpm to allow all mice to be positioned in the respective runways. Once all mice are "ready" (i.e. check if they can walk forward at a speed of 4 rpm for a few seconds), press the start button, and the bar will accelerate from 4 rpm to 40 rpm within 300 seconds. The whole experiment process is automatically recorded by the rotarod, including the latency of each mouse falling off the bar, the speed at the time of falling, the movement distance, and the reason for the end of the test (falling, jumping, passive rotation).

[0067] If the mouse clings to the bar and rotates completely passively, stop the timing of this mouse by pressing the control switch and record the delay time. Take out the mouse and put it back in its home cage. Be careful not to disturb other mice still running on adjacent runways. At the same time, pay attention to the passive rotation of other mice on the rotarod. Clean the equipment with water, then with 50% ethanol, and dry it. Test the next group of mice, repeat the test 1 test.

[0068] Results are shown in Figure 5 As can be seen from the figure, the administration of glibenclamide for two months can significantly reduce the content of urea and uric acid in the serum of mice Figure 5 A and B in the figure); and significantly improve the exercise capacity of middle-aged mice (after two months of administration), the drug effect is better than that of the NMN group Figure 5 C in the figure). Further extension of the administration time found that glibenclamide can significantly alleviate the weakness phenotype Figure 5 D in the figure) appearing in the natural aging process of mice, and significantly prolong the life span of mice Figure 5 E in the figure).

[0069] Example 5 Knockdown of MDH2 loses the promotion of NAD + activity

[0070] NAD + The detection of NAD content specifically includes the following steps: 200 μL NAD detection solution is added to a 6 cm cell culture dish, and the NAD content in the cells is detected by using a NAD detection kit. +Extract (produced by Biyun Tian Company, product number S0175) was collected into a 1.5 mL EP tube after blow-digested; centrifuged at 13000 rpm for 10 minutes at 4°C, and the supernatant was taken into a new EP tube; 30 μL of 150 kU / mL ADH (alcohol dehydrogenase) was added to each well of a 96-well plate; NAD standard curve (0, 3.125, 6.25, 12.5, 25, 50 μM) was prepared with a mixed salt solution of tris-hydroxymethyl aminomethane, magnesium chloride, potassium chloride with pH adjusted to 7.5, and was added to each well of the 96-well plate; 30 μL of 4X diluted sample to be tested was added to each well of a group with 3 replicates; detection working solution containing 45 mM ethanol, 0.6 mM PMS (N-methyl phenazine sulfate methyl), and 0.6 mM INT (iodine nitro blue tetrazolium chloride) was prepared before detection; the program was set on the enzyme marker, and the absorbance at 500 nm was detected continuously for 30 minutes, once every 1 minute, and the plate was shaken for 5 seconds before each detection; the prepared detection working solution was added to each well using a row gun, and the detection was started immediately after the plate was put into the enzyme marker; after the detection was completed, the NAD + level.

[0071] The experimental groups were as follows: cells without knocking out MDH2 protein (Scram-DMSO), cells without knocking out MDH2 protein treated with glibenclamide (Scram-Gli 100 μM), cells without knocking out MDH2 protein treated with NMN (Scram-NMN 100 μM), cells with knocking down MDH2 (RNAi-DMSO), cells with knocking down MDH2 treated with glibenclamide (RNAi-Gli-100 μM), and cells with knocking down MDH2 treated with NMN (RNAi-NMN-100 μM); the cells involved were MRC-5 or MEF cells.

[0072] The specific experimental process was as follows: glibenclamide and NMN were respectively prepared into 100 μM application liquid with cell complete culture medium, and each group of MRC-5 or MEF cells was incubated. NAD + level or relative level change.

[0073] The experimental results are shown in Figure 6 As shown in the figure, the cells without knocking out MDH2 protein showed significant promotion of NAD+ activity after being treated with glibenclamide, while after knocking out MDH2 protein, glibenclamide lost the promotion of NAD + activity, while NMN still maintained the promotion of NAD + activity.

[0074] As shown above, glibenclamide promotes NAD +active.

[0075] Example 6 Synthesis of sulfonamide compounds

[0076] 1. The synthesis route of compounds 1a~3a is as follows:

[0077]

[0078] Specifically includes the following steps:

[0079] 5-chloro-2-methoxy-N-phenethylbenzamide (intermediate I) is obtained by amide condensation reaction for 2~3 hours using 5-chloro-2-methoxybenzoic acid and 2-phenylethan-1-amine as raw materials, then 4-(2-phenylacetamidoethyl)benzenesulfonyl chloride (intermediate II) is obtained by adding excess chlorosulfonic acid at 60°C for 1 hour, then reacted with different amino compounds R a -NH2 under alkaline conditions at room temperature for 12 hours to obtain the target compounds 1a~3a.

[0080]

[0081] 5-chloro-N-(4-(N-cyclohexylaminosulfonyl)phenethyl)-2-methoxybenzamide (compound 1a): 1 HNMR (400 MHz, Methanol-d4) δ 8.34-8.27 (m, 1H), 7.92 (d, J = 8.0 Hz, 2H), 7.81 (d, J = 2.8 Hz, 1H), 7.54-7.49 (m, 2H), 7.47-7.40 (m, 1H), 7.14-7.05 (m, 1H), 3.83 (s, 3H), 3.74-3.65 (m, 2H), 3.46-3.37 (m, 1H), 3.08-2.98 (m, 2H), 1.76-1.54 (m, 5H), 1.35-1.17 (m, 5H).

[0082]

[0083] N-(4-(N-((3R,5R)-adamantan-1-yl)aminosulfonyl)phenethyl)-5-chloro-2-methoxybenzamide (compound 2a): 1H NMR (400 MHz, DMSO-d6) δ 7.91 (d, J = 8.0 Hz, 2H), 7.81 (d, J = 2.8 Hz, 1H), 7.60 (d, J = 2.8 Hz, 1H), 7.52 - 7.47 (m, 1H), 7.47 - 7.41 (m, 3H), 7.18 - 7.13 (m, 1H), 3.82 (s, 3H), 3.59 - 3.50 (m, 2H), 2.92 (t, J = 7.2 Hz, 2H), 1.93 - 1.84 (m, 3H), 1.71 - 1.64 (m, 6H), 1.54 - 1.41 (m, 6H).

[0084]

[0085] 5-Chloro-N-(4-(N-((3S,5S)-3-hydroxyadamant-1-yl)sulfamoyl)phenethyl)-2- methoxybenzamide (Compound 3a): 1 H NMR (400 MHz, Methanol-d4) δ 7.91 (d, J = 8.0 Hz, 2H), 7.82 - 7.79 (m, 1H), 7.51 (d, J = 8.0 Hz, 2H), 7.47 - 7.43 (m, 1H), 7.13 - 7.08 (m, 1H), 3.84 (s, 3H), 3.76 - 3.67 (m, 2H), 3.08 - 3.00 (m, 2H), 2.29 - 2.11 (m, 3H), 1.84 - 1.75 (m, 6H), 1.69 - 1.57 (m, 6H).

[0086] 2. The synthesis route of compounds 4a-13a is as follows:

[0087]

[0088] Specifically includes the following steps:

[0089] with carboxylic acid compound R b -COOH and 2-phenylethan-1-amine as raw materials, coupling for 3 hours at room temperature with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, then reacting with excess chlorosulfonic acid at 60°C for 1 hour to obtain different phenylsulfonyl chloride compounds (III), and finally reacting with adamantylamine under alkaline conditions at room temperature for 12 hours to obtain target compounds 4a-15a; R b groups and the structures of 4a-15a are as follows:

[0090]

[0091] N-(4-(N-((3R,5R)-adamantan-l-yl)aminosulfonyl)phenethyl)-3-chloro-4- methoxybenzamide (Compound 4a) 1 H NMR (400 MHz, DMSO-d6) δ 8.55-8.48 (m, 1H), 7.86 (d, J = 2.0 Hz, 1H), 7.78 (dd, J = 8.4, 2.0 Hz, 1H), 7.73 (d, J = 8.0 Hz, 2H), 7.42 (d, J = 2.0 Hz, 2H), 7.40-7.38 (m, 1H), 7.20 (d, J = 8.8 Hz, 1H), 3.90 (s, 3H), 3.55-3.49 (m, 2H), 2.91 (t, J = 7.2 Hz, 2H), 1.91-1.82 (m, 3H), 1.68-1.61 (m, 6H), 1.54-1.40 (m, 6H).

[0092]

[0093] N-(4-(N-((3R,5R)-adamantan-l-yl)aminosulfonyl)phenethyl)-3-chloro-5- methoxybenzamide (Compound 5a) 1 H NMR (400 MHz, DMSO-d6) δ 8.67-8.56 (m, 1H), 7.79-7.66 (m, 2H), 7.50-7.35 (m, 4H), 7.30-7.26 (m, 1H), 7.19-7.12 (m, 1H), 3.81 (s, 3H), 3.56-3.47 (m, 2H), 2.92 (t, J = 7.2 Hz, 2H), 1.90-1.80 (m, 3H), 1.68-1.60 (m, 6H), 1.53-1.40 (m, 6H).

[0094]

[0095] N-(4-(N-((3R,5R)-adamantan-l-yl)aminosulfonyl)phenethyl)-4-chlorobenzamide (Compound 6a) 1 H NMR (400 MHz, DMSO-d6) δ 8.65-8.56 (m, 1H), 7.76 (dd, J = 24.0, 8.0 Hz, 4H), 7.51 (d, J = 8.4 Hz, 2H), 7.44-7.35 (m, 3H), 3.57-3.50 (m, 2H), 2.92 (t, J = 7.2 Hz, 2H), 1.90-1.81 (m, 3H), 1.68-1.61 (m, 6H), 1.54-1.36 (m, 6H).

[0096]

[0097] N-(4-(N-((3R,5R)-adamantan-l-yl)aminosulfonyl)phenethyl)-2-chlorobenzamide (Compound 7a) 1 H NMR (400 MHz, DMSO-d6) δ 8.50 - 8.44 (m, 1H), 7.76 (d, J = 8.0 Hz, 2H), 7.47 - 7.42 (m, 4H), 7.42 - 7.32 (m, 2H), 7.32 - 7.27 (m, 1H), 3.56 - 3.48 (m, 2H), 2.92 (t, J = 7.2 Hz, 2H), 1.92 - 1.86 (m, 3H), 1.70 - 1.64 (m, 6H), 1.53 - 1.42 (m, 6H).

[0098]

[0099] N-(4-(N-((3R,5R)-adamantan-l-yl)aminosulfonyl)phenethyl)-3-chlorobenzamide (Compound 8a) 1 H NMR (400 MHz, DMSO-d6) δ 8.69 - 8.60 (m, 1H), 7.82 - 7.78 (m, 1H), 7.77 - 7.71 (m, 3H), 7.60 - 7.56 (m, 1H), 7.51 - 7.45 (m, 1H), 7.44 - 7.38 (m, 3H), 3.59 - 3.50 (m, 2H), 2.92 (t, J = 7.2 Hz, 2H), 1.91 - 1.83 (m, 3H), 1.68 - 1.62 (m, 6H), 1.54 - 1.39 (m, 6H).

[0100]

[0101] N-(4-(N-((3R,5R)-adamantan-l-yl)aminosulfonyl)phenethyl)-3-fluorobenzamide (Compound 9a) 1 H NMR (400 MHz, DMSO-d6) δ 8.66 - 8.60 (m, 1H), 7.74 (d, J = 8.0 Hz, 2H), 7.66 - 7.61 (m, 1H), 7.58 - 7.47 (m, 2H), 7.44 - 7.40 (m, 3H), 7.39 - 7.33 (m, 1H), 3.58 - 3.52 (m, 2H), 2.94 (t, J = 7.2 Hz, 2H), 1.90 - 1.84 (m, 3H), 1.68 - 1.63 (m, 6H), 1.54 - 1.39 (m, 6H).

[0102]

[0103] N-(4-(N-((3R,5R)-adamantane-1-yl)aminosulfonyl)phenethyl)-3-bromobenzamide (compound 10a) 1 H NMR(400MHz,DMSO-d6)δ8.69-8.64(m,1H),7.96-7.93(m,1H),7.80-7.70(m,4H),7.45-7.39(m,4H) ,3.58-3.51(m,2H),2.93(t,J=7.2Hz,2H),1.90-1.84(m,3H),1.68-1.63(m,6H),1.52-1.40(m,6H).

[0104]

[0105] N-(4-(N-((3R,5R)-adamantane-1-yl)aminosulfonyl)phenethyl)-3-iodobenzamide (compound 11a) 1 H NMR (400MHz, DMSO-d6) δ8.64-8.59(m,1H),8.13-8.10(m,1H),7.87(d,J=8.0Hz,1H),7.78(d,J=8.0Hz,1H),7.74(d,J=8.0Hz,2H),7.4 4-7.39(m,3H),7.28-7.22(m,1H),3.57-3.49(m,2H),2.92(t,J=7.2Hz,2H),1.88-1.82(m,3H),1.66-1.62(m,6H),1.53-1.40(m,6H).

[0106]

[0107] N-(4-(N-((3R,5R)-adamantane-1-yl)aminosulfonyl)phenethyl)-2-methoxybenzamide (compound 12a) 1 H NMR (400MHz, DMSO-d6) δ8.19-8.13(m,1H),7.77(d,J=8.0Hz,2H),7.72-7.67(m,1H),7.48-7.41(m,4H),7.11(d,J=8.4Hz,1H),7. 04-6.97(m,1H),3.81(s,3H),3.59-3.51(m,2H),2.92(t,J=7.2Hz,2H),1.92-1.84(m,3H),1.69-1.64(m,6H),1.54-1.40(m,6H).

[0108]

[0109] N-(4-(N-((3R,5R)-adamantan-l-yl)aminosulfonyl)phenethyl)-2,5-dimethoxybenzamide (Compound 13a) 1 H NMR (400 MHz, DMSO-d6) δ 8.23-8.18 (m, 1H), 7.77 (d, J = 8.0 Hz, 2H), 7.47-7.41 (m, 3H), 7.27 (d, J = 2.8 Hz, 1H), 7.07-6.99 (m, 2H), 3.75 (s, 3H), 3.72 (s, 3H), 3.60-3.52 (m, 2H), 2.92 (t, J = 7.2 Hz, 2H), 1.91-1.84 (m, 3H), 1.69-1.61 (m, 6H), 1.54-1.40 (m, 6H).

[0110] 3. The synthesis route of Compounds 14a-15a is as follows:

[0111]

[0112] Specifically, the following steps are included: 4-hydroxy-3- (methoxycarbonyl) benzoic acid and 2-phenethylamine are used as starting materials, and the amide compound (Intermediate V) is obtained by EDCI condensation reaction at room temperature for 3 hours, then the left side of the phenyl naked hydroxyl group is protected by methyl under alkaline conditions at room temperature for 5 hours (Intermediate VI), and then the sulfonated reaction is carried out at 60°C for 1 hour, and then the target compound 3-((4-(N-((3R,5R)-adamantan-l-yl) aminosulfonyl)phenethyl)carbamoyl)-4-methoxybenzoic acid methyl ester (Compound 14a) is obtained by reacting with adamantan-l-amine at room temperature for 3 hours. The target compound 3-((4-(N-((3R,5R)-adamantan-l-yl) aminosulfonyl)phenethyl)carbamoyl)-4-hydroxybenzoic acid methyl ester (Compound 15a) is obtained by demethylation reaction of boron tribromide at room temperature for 0.5-1.5 hours.

[0113]

[0114] 3-((4-(N-((3R,5R)-adamantan-l-yl)aminosulfonyl)phenethyl)carbamoyl)-4- methoxybenzoic acid methyl ester (Compound 14a) 1H NMR (400MHz, DMSO-d6) δ8.29-8.20(m,2H),8.07-7.99(m,1H),7.77(d,J=8.0Hz,2H),7.51-7.42(m,3H),7.24(d,J=8.8Hz,1H) ,3.89(s,3H),3.84(s,3H),3.60-3.53(m,2H),2.92(t,J=7.2Hz,2H),1.89-1.83(m,3H),1.70-1.62(m,6H),1.52-1.39(m,6H).

[0115]

[0116] 3-((4-(N-((3R,5R)-adamantane-1-yl)aminosulfonyl)phenethyl)carbamoyl)-4-hydroxybenzoate (compound 15a) 1 H NMR (400MHz, DMSO-d6) δ13.19(s,1H),9.16-9.12(m,1H),8.51-8.49(m,1H),7.96(dd,J=8.8,2.0Hz,1H),7.75(d,J=8.0Hz,2H),7.46-7.42(m ,3H),6.99(d,J=8.8Hz,1H),3.84(s,3H),3.64-3.56(m,2H),2.97(t,J =7.2Hz,2H),1.91-1.84(m,3H),1.68-1.63(m,6H),1.52-1.40(m,6H).

[0117] 4. The synthetic routes for 16a to 26a are as follows:

[0118]

[0119] Specifically, the following steps are included:

[0120] Starting with 4-(2-acetaminoethyl)benzenesulfonyl chloride, it was first reacted with adamantaneamine under alkaline conditions at room temperature for 12 hours to obtain N-(4-(N-((3R,5R)-adamantane-1-yl)aminosulfonyl)phenethyl)acetamide (intermediate VIII). Then, under strongly alkaline conditions at 120°C for 12 hours, the acetyl group was removed to obtain intermediate N-((3R,5R)-adamantane-1-yl)-4-(2-aminoethyl)benzenesulfonamide (intermediate X). Using methyl 3-hydroxybenzoate as a starting material, it was reacted with different halogenated hydrocarbons R under strongly alkaline conditions at 60°C. c-Br reaction for 12-18 hours, followed by hydrolysis reaction at 120 °C for 5-7 hours to give different carboxylic acid compound intermediates XI. Different carboxylic acid compounds (IX) were again coupled with intermediate amine (IX) via EDCI coupling reaction for 3 hours to give compounds 16a-26a. R c The groups and 16a-26a structures are as follows:

[0121]

[0122] N-(4-(N-((3R, 5R)-adamantane-1-yl) aminosulfonyl)phenethyl)-3- ethoxybenzamide (Compound 16a) 1 H NMR (400 MHz, DMSO-d6) δ 8.53-8.46 (m, 1H), 7.75 (d, J = 8.0 Hz, 2H), 7.46-7.38 (m, 3H), 7.37-7.28 (m, 3H), 7.06 (dd, J = 6.0, 2.8 Hz, 1H), 4.11-4.02 (m, 2H), 3.57-3.48 (m, 2H), 2.93 (t, J = 7.2 Hz, 2H), 1.94-1.83 (m, 3H), 1.72-1.61 (m, 6H), 1.56-1.38 (m, 6H), 1.34 (t, J = 6.8 Hz, 3H).

[0123]

[0124] N-(4-(N-((3R, 5R)-adamantane-1-yl) aminosulfonyl)phenethyl)-3- ethoxybenzamide (Compound 16a) 1 H NMR (400 MHz, DMSO-d6) δ 8.53-8.46 (m, 1H), 7.75 (d, J = 8.0 Hz, 2H), 7.46-7.38 (m, 3H), 7.37-7.28 (m, 3H), 7.06 (dd, J = 6.0, 2.8 Hz, 1H), 4.11-4.02 (m, 2H), 3.57-3.48 (m, 2H), 2.93 (t, J = 7.2 Hz, 2H), 1.94-1.83 (m, 3H), 1.72-1.61 (m, 6H), 1.56-1.38 (m, 6H), 1.34 (t, J = 6.8 Hz, 3H).

[0125]

[0126] N-(4-(N-((3R, 5R)-adamantane-1-yl) aminosulfonyl)phenethyl)-3- ethoxybenzamide (Compound 16a) 1H NMR (400 MHz, DMSO-d6) δ 8.51 - 8.45 (m, 1H), 7.74 (d, J = 8.0 Hz, 2H), 7.45 - 7.39 (m, 3H), 7.35 - 7.27 (m, 3H), 7.10 - 7.01 (m, 1H), 3.99 (t, J = 6.4 Hz, 2H), 3.56 - 3.49 (m, 2H), 2.92 (t, J = 7.2 Hz, 2H), 1.89 - 1.84 (m, 3H), 1.74 - 1.67 (m, 2H), 1.67 - 1.63 (m, 6H), 1.52 - 1.40 (m, 8H), 0.94 (t, J = 7.6 Hz, 3H).

[0127]

[0128] N-(4-(N-((3R,5R)-adamantan-l-yl)sulfamoyl)phenethyl)-3-(pentyloxy)benzamide (Compound 19a) 1 H NMR (400 MHz, DMSO-d6) δ 8.51 - 8.45 (m, 1H), 7.74 (d, J = 8.0 Hz, 2H), 7.45 - 7.39 (m, 3H), 7.35 - 7.27 (m, 3H), 7.10 - 7.01 (m, 1H), 3.99 (t, J = 6.4 Hz, 2H), 3.56 - 3.49 (m, 2H), 2.92 (t, J = 7.2 Hz, 2H), 1.89 - 1.84 (m, 3H), 1.74 - 1.67 (m, 2H), 1.67 - 1.63 (m, 6H), 1.52 - 1.40 (m, 8H), 0.94 (t, J = 7.6 Hz, 3H).

[0129]

[0130] N-(4-(N-((3R,5R)-adamantan-l-yl)sulfamoyl)phenethyl)-3-(pentyloxy)benzamide (Compound 19a) 1H NMR (400 MHz, DMSO-d6) δ 8.52 - 8.45 (m, 1H), 7.73 (d, J = 8.0 Hz, 2H), 7.44 - 7.39 (m, 3H), 7.35 - 7.27 (m, 3H), 7.07 - 7.02 (m, 1H), 3.98 (t, J = 6.4 Hz, 2H), 3.60 - 3.44 (m, 2H), 2.92 (t, J = 7.2 Hz, 2H), 1.94 - 1.82 (m, 3H), 1.76 - 1.68 (m, 2H), 1.67 - 1.59 (m, 6H), 1.53 - 1.38 (m, 8H), 1.36 - 1.26 (m, 4H), 0.95 - 0.79 (m, 3H).

[0131]

[0132] N-(4-(N-((3R,5R)-adamantan-l-yl)aminosulfonyl)phenethyl)-3-(hex-5-yn-l- yloxy)benzamide (Compound 21a) 1 H NMR (400 MHz, Chloroform-d) δ 7.84 (d, J = 8.0 Hz, 2H), 7.35 (d, J = 8.0 Hz, 2H), 7.32 - 7.27 (m, 2H), 7.15 (d, J = 7.6 Hz, 1H), 7.01 (dd, J = 8.4, 2.4 Hz, 1H), 6.18 - 6.04 (m, 1H), 4.02 (t, J = 6.0 Hz, 2H), 3.76 - 3.69 (m, 2H), 3.01 (t, J = 6.8 Hz, 2H), 2.28 (td, J = 7.2, 2.8 Hz, 2H), 2.04 - 1.98 (m, 3H), 1.98 - 1.95 (m, 1H), 1.95 - 1.89 (m, 2H), 1.80 - 1.76 (m, 6H), 1.76 - 1.68 (m, 2H), 1.64 - 1.56 (m, 6H).

[0133]

[0134] N-(4-(N-((3R,5R)-adamantan-l-yl)aminosulfonyl)phenethyl)-3-(cyclopropylmethoxy)benzamide (Compound 22a) 1H NMR (400 MHz, Chloroform-d) δ 7.84 (d, J = 8.4 Hz, 2H), 7.34 (d, J = 8.0 Hz, 2H), 7.33 - 7.27 (m, 2H), 7.15 (d, J = 8.0 Hz, 1H), 7.03 (dd, J = 8.4, 2.4 Hz, 1H), 6.15 - 6.07 (m, 1H), 3.84 (d, J = 6.8 Hz, 2H), 3.75 - 3.66 (m, 2H), 3.01 (t, J = 7.2 Hz, 2H), 2.04 - 1.96 (m, 3H), 1.81 - 1.75 (m, 6H), 1.64 - 1.57 (m, 6H), 1.29 - 1.25 (m, 1H), 0.69 - 0.59 (m, 2H), 0.42 - 0.30 (m, 2H).

[0135]

[0136] N-(4-(N-((3R,5R)-adamantan-l-yl)aminosulfonyl)phenethyl)-3- (cyclopentylmethoxy)benzamide (Compound 24a) 1 H NMR (400 MHz, Chloroform-d) δ 7.84 (d, J = 8.4 Hz, 2H), 7.34 (d, J = 8.0 Hz, 2H), 7.33 - 7.27 (m, 2H), 7.15 (d, J = 8.0 Hz, 1H), 7.03 (dd, J = 8.4, 2.4 Hz, 1H), 6.15 - 6.07 (m, 1H), 3.84 (d, J = 6.8 Hz, 2H), 3.75 - 3.66 (m, 2H), 3.01 (t, J = 7.2 Hz, 2H), 2.04 - 1.96 (m, 3H), 1.81 - 1.75 (m, 6H), 1.64 - 1.57 (m, 6H), 1.29 - 1.25 (m, 1H), 0.69 - 0.59 (m, 2H), 0.42 - 0.30 (m, 2H).

[0137]

[0138] N-(4-(N-((3R,5R)-adamantan-l-yl)aminosulfonyl)phenethyl)-3- (cyclopentylmethoxy)benzamide (Compound 24a) 1H NMR (400 MHz, DMSO-d6) δ 8.52 - 8.47 (m, 1H), 7.73 (d, J = 8.0 Hz, 2H), 7.42 (d, J = 4.8 Hz, 2H), 7.41 - 7.38 (m, 1H), 7.36 - 7.29 (m, 3H), 7.08 - 7.03 (m, 1H), 3.86 (d, J = 6.8 Hz, 2H), 3.55 - 3.48 (m, 2H), 2.92 (t, J = 7.2 Hz, 2H), 2.35 - 2.27 (m, 1H), 1.91 - 1.84 (m, 3H), 1.82 - 1.74 (m, 2H), 1.67 - 1.63 (m, 6H), 1.62 - 1.52 (m, 4H), 1.51 - 1.40 (m, 6H), 1.38 - 1.30 (m, 2H).

[0139]

[0140] N-(4-(N-((3R,5R)-adamantan-l-yl)aminosulfonyl)phenethyl)-3- benzyloxybenzamide (Compound 26a) 1 H NMR (400 MHz, DMSO-d6) δ 8.52 - 8.47 (m, 1H), 7.73 (d, J = 8.0 Hz, 2H), 7.42 (d, J = 4.8 Hz, 2H), 7.41 - 7.38 (m, 1H), 7.36 - 7.29 (m, 3H), 7.08 - 7.03 (m, 1H), 3.86 (d, J = 6.8 Hz, 2H), 3.55 - 3.48 (m, 2H), 2.92 (t, J = 7.2 Hz, 2H), 2.35 - 2.27 (m, 1H), 1.91 - 1.84 (m, 3H), 1.82 - 1.74 (m, 2H), 1.67 - 1.63 (m, 6H), 1.62 - 1.52 (m, 4H), 1.51 - 1.40 (m, 6H), 1.38 - 1.30 (m, 2H).

[0141]

[0142] N-(4-(N-((3R,5R)-adamantan-l-yl)aminosulfonyl)phenethyl)-3- benzyloxybenzamide (Compound 26a) 1H NMR (400 MHz, DMSO-d6) δ 8.56-8.48 (m, 1H), 7.74 (d, J = 8.0 Hz, 2H), 7.48-7.33 (m, 11H), 7.17-7.11 (m, 1H), 5.13 (s, 2H), 3.57-3.49 (m, 2H), 2.92 (t, J = 7.2 Hz, 2H), 1.89-1.84 (m, 3H), 1.68-1.63 (m, 6H), 1.52-1.40 (m, 6H).

[0143] 5. The synthesis route of compounds 27a~28a is as follows:

[0144]

[0145] Specifically includes the following steps:

[0146] With compound y as the starting material, N-(4-(N-((3R, 5R)-adamantane-1-yl) aminosulfonyl) benzyl) acetamide (XII) is obtained by reacting with adamantylamine under alkaline conditions at room temperature for 12 hours, and then the acetyl group is removed under strong base conditions at 120°C for 12 hours to obtain intermediate XIII, and then compound 27a or 28a is obtained by coupling reaction of XIII with 4-(cyclopropylmethoxy)benzoic acid through EDCI for 3 hours.

[0147]

[0148] N-(4-(N-((3R, 5R)-adamantane-1-yl) aminosulfonyl) benzyl)-4-(cyclopropylmethoxy)benzamide (compound 27a) 1 H NMR (400 MHz, DMSO-d6) δ 9.15-9.05 (m, 1H), 7.79 (d, J = 8.0 Hz, 2H), 7.52-7.42 (m, 5H), 7.42-7.33 (m, 1H), 7.10 (dd, J = 8.0, 3.2 Hz, 1H), 4.58-4.50 (m, 2H), 3.90-3.84 (m, 2H), 1.98-1.83 (m, 3H), 1.71-1.63 (m, 6H), 1.57-1.41 (m, 6H), 1.26-1.21 (m, 1H), 0.61-0.55 (m, 2H), 0.36-0.30 (m, 2H).

[0149]

[0150] N-(3-(4-(N-((3R, 5R)-adamantane-1-yl) aminosulfonyl) phenyl) propyl)-4-(cyclopropylmethoxy)benzamide (compound 28a) 1H NMR (400 MHz, DMSO-d6) δ 8.48-8.43 (m, 1H), 7.74 (d, J = 8.0 Hz, 2H), 7.43 (d, J = 9.6 Hz, 2H), 7.41-7.31 (m, 4H), 7.08-7.04 (m, 1H), 3.85 (d, J = 7.2 Hz, 2H), 3.30-3.23 (m, 2H), 2.70 (t, J = 7.6 Hz, 2H), 1.94-1.88 (m, 3H), 1.84 (t, J = 7.6 Hz, 2H), 1.70-1.65 (m, 6H), 1.55-1.42 (m, 6H), 1.24-1.23 (m, 1H), 0.60-0.54 (m, 2H), 0.36-0.31 (m, 2H).

[0151] Example 7 MDH2 Inhibitory Activity and Cytotoxicity of Sulfonylamide Compounds

[0152] 1. MDH2 inhibitory activity: MDH2 protein was diluted with 100 mM HEPES buffer to a final concentration of 1 nM MDH2 protein dilution, and 100 mM HEPES buffer was used to prepare NADH solution with a final concentration of 0.8 mM, oxaloacetate solution with a final concentration of 2.4 mM, and small molecule compound solution and Gli solution with a final concentration of 200 μΜ; 100 μΐ^of NADH solution, small molecule compound solution or Gli solution, and MDH2 protein dilution were mixed in a 1.5 mL centrifuge tube, and 90 μΐ^of each was added to a 96-well plate, with a total of 3 replicates; finally, 30 μΐ^of oxaloacetate solution was added to each well, and the absorbance was detected at OD = 340 nM by a microplate reader; the amount of oxaloacetate consumed by the protein was detected within 30 min. In addition, the half inhibitory concentration (IC50) of the compound at multiple concentrations (3.13, 6.25, 12.5, 25, 50, 100 μΜ) was detected for MDH2, and the results are shown in Table 1. 50

[0153] 2. Cytotoxicity: the minimum cytotoxicity detected by CCK8 method after incubation of HEK-293 cells for one day, and the results are shown in Table 1.

[0154] Table 1 MDH2 Inhibitory Activity and Cytotoxicity of Sulfonylamide Compounds

[0155]

[0156]

[0157] Note: n.s. is Not Specified, and no data was detected due to poor solubility of the compound.

[0158] ​As shown in the table, the sulfonamide compounds obtained by the application have different degrees of inhibitory activity on MDH2, and can achieve a significant anti-aging effect.

[0159] Example 8 Anti-aging activity of sulfonamide compounds on nematodes

[0160] L4 stage wild-type C. elegans were cultured on NGM plates with the concentrations of compounds 23a, 24a and 25a being 100 and 400 μM respectively to the seventh day, and the number of nematodes was fixed at the seventh day, with 120 nematodes in each concentration; the death of nematodes was recorded every other day until the last nematode died.

[0161] The results are shown in Table 3. Figure 7 As shown in the figure, the compounds 23a, 24a and 25a of the application can significantly prolong the lifespan of wild-type C. elegans, and the effect is obviously better than that of Gli.

[0162] The above examples are preferred embodiments of the application, but the embodiments of the application are not limited by the above examples, and any changes, modifications, substitutions, combinations and simplifications made without departing from the spirit and principles of the application shall be equivalent replacement methods and shall be included in the protection scope of the application.

Claims

1. A sulfonamide compound, characterized in that, The sulfonamide compounds have formula I A structure: I A Among them, R 1 It is an adamantyl alkyl group or a substituted adamantyl alkyl group; the substituent of the substituted adamantyl alkyl group is a hydroxyl group or a methyl group; R 2 R 3 R 4 R 5 R 6 Each is independently selected from hydrogen, halogen, hydroxyl group, -COOR7, C 1~6 Alkyl or substituted C 1~6 Alkoxy; the substituted C 1~6 The alkoxy group has a C substituent. 3~6 cycloalkyl; R7 is C 1~6 alkyl; n is an integer from 1 to 5; The sulfonamide compounds do not include compounds with the following structures: 。 2. The sulfonamide compound according to claim 1, characterized in that, The R 1 It is an adamantyl alkyl group or a substituted adamantyl alkyl group; the substituent of the substituted adamantyl alkyl group is a hydroxyl group; R 2 R 3 R 5 R 6 Each is independently selected from hydrogen, halogen, hydroxyl, C 1~3 Alkoxy; R 4 Selected from hydrogen, halogens, -COOR7, C 1~6 Alkyl or substituted C 1~6 Alkoxy; the substituted C 1~6 The alkoxy group has a C substituent. 3~6 cycloalkyl; R7 is C 1~3 alkyl; n is 1, 2, or 3.

3. The sulfonamide compound according to claim 2, characterized in that, The R 1 It is an adamantyl alkyl group or a substituted adamantyl alkyl group; the substituent of the substituted adamantyl alkyl group is a hydroxyl group; R 2 R 3 R 5 R 6 Each is independently selected from hydrogen, chlorine, hydroxyl, and methoxy groups; R 4 Selected from hydrogen, fluorine, chlorine, iodine, -COOCH3, C 2~6 Alkyl or substituted C 1~3 Alkoxy; the substituted C 1~3 The alkoxy group has a C substituent. 3~6 cycloalkyl; n is 1, 2, or 3.

4. The sulfonamide compound according to claim 3, characterized in that, The R 1 It is an adamantyl alkyl group or a substituted adamantyl alkyl group; the substituent of the substituted adamantyl alkyl group is a hydroxyl group; R 2 R 3 R 5 R 6 Each is independently selected from hydrogen, chlorine, hydroxyl, and methoxy groups; R 4 Selected from hydrogen, fluorine, chlorine, iodine, -COOCH3, C 2~6 Alkyl or substituted C 1~3 Alkoxy; the substituted C 1~3 The alkoxy group has a C substituent. 3~6 cycloalkyl; and R 4 When it is -COOCH3, R 2 Not methoxylated; n is 1, 2, or 3.

5. The sulfonamide compound according to any one of claims 1 to 4, characterized in that, It also includes pharmaceutically acceptable salts, isotopic variants, or stereoisomers of Formula I.

6. The use of sulfonamide compounds or combinations thereof in the preparation of malate dehydrogenase inhibitors, characterized in that, The malate dehydrogenase is malate dehydrogenase type 2; The sulfonamide compounds have formula I A structure: I A Among them, R 1 It is an adamantyl alkyl group or a substituted adamantyl alkyl group; the substituent of the substituted adamantyl alkyl group is a hydroxyl group or a methyl group; R 2 R 3 R 4 R 5 R 6 Each is independently selected from hydrogen, halogen, hydroxyl group, -COOR7, C 1~6 Alkyl or substituted C 1~6 Alkoxy; the substituted C 1~6 The alkoxy group has a C substituent. 3~6 cycloalkyl; R7 is C 1~6 alkyl; n is an integer from 1 to 5.

7. The application according to claim 6, characterized in that, The R 1 It is an adamantyl alkyl group or a substituted adamantyl alkyl group; the substituent of the substituted adamantyl alkyl group is a hydroxyl group; R 2 R 3 R 5 R 6 Each is independently selected from hydrogen, halogen, hydroxyl, C 1~3 Alkoxy; R 4 Selected from hydrogen, halogens, -COOR7, C 1~6 Alkyl or substituted C 1~6 Alkoxy; the substituted C 1~6 The alkoxy group has a C substituent. 3~6 cycloalkyl; R7 is C 1~3 alkyl; n is 1, 2, or 3.

8. The application according to claim 7, characterized in that, The R 1 It is an adamantyl alkyl group or a substituted adamantyl alkyl group; the substituent of the substituted adamantyl alkyl group is a hydroxyl group; R 2 R 3 R 5 R 6 Each is independently selected from hydrogen, chlorine, hydroxyl, and methoxy groups; R 4 Selected from hydrogen, fluorine, chlorine, iodine, -COOCH3, C 2~6 Alkyl or substituted C 1~3 Alkoxy; the substituted C 1~3 The alkoxy group has a C substituent. 3~6 cycloalkyl; n is 1, 2, or 3.

9. The application according to claim 8, characterized in that, The R 1 It is an adamantyl alkyl group or a substituted adamantyl alkyl group; the substituent of the substituted adamantyl alkyl group is a hydroxyl group; R 2 R 3 R 5 R 6 Each is independently selected from hydrogen, chlorine, hydroxyl, and methoxy groups; R 4 Selected from hydrogen, fluorine, chlorine, iodine, -COOCH3, C 2~6 Alkyl or substituted C 1~3 Alkoxy; the substituted C 1~3 The alkoxy group has a C substituent. 3~6 cycloalkyl; and R 4 When it is -COOCH3, R 2 Not methoxylated; n is 1, 2, or 3.

10. The application according to any one of claims 6 to 9, characterized in that, The sulfonamide compounds also include pharmaceutically acceptable salts, isotopic variants, or stereoisomers of Formula I.

11. The use of sulfonamide compounds or combinations thereof in the preparation of anti-aging products, characterized in that, The anti-aging measures refer to extending lifespan and / or delaying aging. The sulfonamide compounds have formula I A structure: I A Among them, R 1 It is an adamantyl alkyl group or a substituted adamantyl alkyl group; the substituent of the substituted adamantyl alkyl group is a hydroxyl group or a methyl group; R 2 R 3 R 4 R 5 R 6 Each is independently selected from hydrogen, halogen, hydroxyl group, -COOR7, C 1~6 Alkyl or substituted C 1~6 Alkoxy; the substituted C 1~6 The alkoxy group has a C substituent. 3~6 cycloalkyl; R7 is C 1~6 alkyl; n is an integer from 1 to 5.

12. The application according to claim 11, characterized in that, The R 1 It is an adamantyl alkyl group or a substituted adamantyl alkyl group; the substituent of the substituted adamantyl alkyl group is a hydroxyl group; R 2 R 3 R 5 R 6 Each is independently selected from hydrogen, halogen, hydroxyl, C 1~3 Alkoxy; R 4 Selected from hydrogen, halogens, -COOR7, C 1~6 Alkyl or substituted C 1~6 Alkoxy; the substituted C 1~6 The alkoxy group has a C substituent. 3~6 cycloalkyl; R7 is C 1~3 alkyl; n is 1, 2, or 3.

13. The application according to claim 12, characterized in that, The R 1 It is an adamantyl alkyl group or a substituted adamantyl alkyl group; the substituent of the substituted adamantyl alkyl group is a hydroxyl group; R 2 R 3 R 5 R 6 Each is independently selected from hydrogen, chlorine, hydroxyl, and methoxy groups; R 4 Selected from hydrogen, fluorine, chlorine, iodine, -COOCH3, C 2~6 Alkyl or substituted C 1~3 Alkoxy; the substituted C 1~3 The alkoxy group has a C substituent. 3~6 cycloalkyl; n is 1, 2, or 3.

14. The application according to claim 13, characterized in that, The R 1 It is an adamantyl alkyl group or a substituted adamantyl alkyl group; the substituent of the substituted adamantyl alkyl group is a hydroxyl group; R 2 R 3 R 5 R 6 Each is independently selected from hydrogen, chlorine, hydroxyl, and methoxy groups; R 4 Selected from hydrogen, fluorine, chlorine, iodine, -COOCH3, C 2~6 Alkyl or substituted C 1~3 Alkoxy; the substituted C 1~3 The alkoxy group has a C substituent. 3~6 cycloalkyl; and R 4 When it is -COOCH3, R 2 Not methoxylated; n is 1, 2, or 3.

15. The application according to any one of claims 11 to 14, characterized in that, The sulfonamide compounds also include Formula I A A pharmaceutically acceptable salt, isotopic variant, or stereoisomer.

16. The application according to claim 11, characterized in that, The anti-aging products mentioned are pharmaceuticals or cosmetics.

Citation Information

Patent Citations

  • FLT3 receptor antagonists

    CN107001283A

  • Novel application of sulfonylurea drugs to aging resistance

    CN112022862A