A modified ToPif1 helicase and its application

Abstract

The present invention provides a modified ToPif1 helicase and its application, belonging to the field of gene sequencing technology. The modified ToPif1 helicase has SEQ ID NO:14 as the parent sequence, with at least one covalent bond between 221-229 and 401-405, and the amino acid numbering is based on SEQ ID NO:15. The modified ToPif1 helicase of the present invention can control the smooth movement of polynucleotides through the nanopore, reducing slippage or irregular movement.

Description

Technical Field

[0001] The present invention relates to the field of gene sequencing technology, and in particular to a modified ToPif1 helicase and applications thereof. Background Art

[0002] DNA helicase is a special application, a molecular actuator that binds to single-stranded DNA (ssDNA) independently of its sequence and uses ATP to promote its movement along the DNA. Selecting the right enzyme and fully utilizing its potential in nanopore-based sequencing is key to controlling the movement of polynucleotides through the channel.

[0003] The article "Structural and functional studies of SF1B Pif1 from Thermus oshimaireveal dimerization-induced helicase inhibition" reports the crystal structures of the Thermus oshimai Pif1 (ToPif1) helicase monomer and in complex with partially double-stranded or single-stranded DNA. The ToPif1 helicase core consists of five domains: 1A (RecA-like motor), 2A (RecA-like motor), 1B (wedgedomain), 2B (SH3-like), and a Pif-specific signature sequence (PFSS). Domains 1A and 2A are primarily involved in ATP binding and hydrolysis; domain 1B folds into an unstructured loop; and domain 2B adopts an SH3-like fold consisting of five β-strands arranged into two perpendicular β-sheets. The PFSS is a characteristic motif unique to Pif1 proteins. Among them, a long antiparallel β-hairpin (named loop 3) in domain 2B extends toward domain 1B and interacts with several residues in domain 1A, stabilizing the protein in a closed conformation. Through smFRET experiments, it was demonstrated that domain 2B / loop 3 of ToPif 1 exhibits repeated rotation / movement between closed and open conformations during DNA unwinding.

[0004] The paper also found that when ToPif1 is in a monomeric state, domain 2B / loop3 interacts with domains 1A and 2A to block the ssDNA binding site and form a closed conformation; in a complex formed with partially double-stranded DNA, its domain 2B / loop3 is in an open conformation. When complexed with single-stranded DNA, ToPif1 forms a stable dimer, and domain 2B / loop3 transforms into a more open conformation. Single-molecule and biochemical analyses show that when the ToPif1 monomer unwinds DNA, domain 2B / loop3 repeatedly switches between closed and open conformations. Summary of the Invention

[0005] The present invention further modifies the ToPif1 helicase to improve its performance, specifically in the following aspects:

[0006] The present invention first provides a modified ToPif1 helicase, the parent sequence of the modified ToPif1 helicase is SEQ ID NO:14 or a sequence with 90% homology to SEQ ID NO:14; the modified ToPif1 helicase has at least one covalent connection between 221-229 and 401-405, and the amino acid numbering is based on SEQ ID NO:15 (position +64 of SEQ ID NO:14).

[0007] Preferably, the parent sequence of the modified ToPif1 has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or at least 99.9% homology with SEQ ID NO:14.

[0008] Preferably, there is at least one covalent bond between at least one of residues E221, E222, Y225, I226 and T229 and at least one of residues Y401, T402, Y403, S405; further preferably, there is a covalent bond between E221 and Y401.

[0009] Preferably, in a specific embodiment of the present invention, the covalent linkage is achieved by replacing or inserting cysteine ​​or an unnatural amino acid.

[0010] In a specific embodiment of the present invention, the covalent linkage between the two cysteines is achieved through a disulfide bond or linker molecules; preferably, the linker molecules include: BMOE (bismaleimide ethane), BMB (1,4-bismaleimide butane), BMH (bismaleimide hexane), DTME (dithiomaleimide ethane), TMEA (tris(2-bismaleimidoethyl)amine), Bis(PEG)2 (1,8-bismaleimide-diethylene glycol) and Bis(PEG)3 (1,11-bismaleimide-triethylene glycol).

[0011] In a specific embodiment of the present invention, the modified ToPif1 includes the amino acid sequence shown in SEQ ID NO:1, or has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or at least 99.9% homology with the amino acid sequence shown in SEQ ID NO:1, and there is a covalent connection between E221C and Y401C.

[0012] Preferably, the covalent linkage is a disulfide bond;

[0013] Preferably, the covalent linker is BMOE (bismaleimidoethane).

[0014] In another embodiment of the present invention, at least one unnatural amino acid is introduced to achieve covalent linkage.

[0015] Preferably, the covalent linkage is achieved through a bioorthogonal reaction involving unnatural amino acids; more preferably, the covalent linkage is achieved through a bioorthogonal reaction involving linker molecules.

[0016] Preferably, the bioorthogonal reaction comprises a condensation reaction between a ketocarbonyl compound and hydroxylamine / hydrazide, a 1,3-dipolar cycloaddition reaction, a Staudinger ligation reaction, an inverse electron demand Diels-Alder reaction (IEDDA) reaction, or a photoinduced cross-linking reaction.

[0017] Preferably, the unnatural amino acid comprises a ketone / aldehyde group, an oxime / hydroxylamine group, an azide group, an alkyne group, a ring-strained olefin group, a tetrazine group, or a diazine group.

[0018] The present invention also provides a sequencing element and a sequencing device comprising the modified ToPif1.

[0019] The present invention also provides sequencing use of the truncated modified ToPif1.

[0020] The present invention also provides a mutated ToPif1 helicase, the parent sequence of the mutated ToPif1 helicase is SEQ ID NO: 14 or a sequence with 90% homology to SEQ ID NO: 14; the mutated ToPif1 has at least one cysteine ​​or non-natural amino acid between 221-229 and 401-405, and the amino acid numbering is based on SEQ ID NO: 15.

[0021] Preferably, there is at least one mutation in E221, E222, Y225, I226 and T229 and at least one mutation in Y401, T402, Y403, S405; further preferably, there is a combination of mutations in E221 and Y401.

[0022] Preferably, the mutated ToPif1 helicase comprises the amino acid sequence shown in SEQ ID NO:1, or has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or at least 99.9% homology with the amino acid sequence shown in SE Q ID NO:1.

[0023] The present invention also provides a polynucleotide encoding the above-mentioned mutated ToPif1 helicase.

[0024] The present invention also provides biological materials such as vectors or recombinant microorganisms comprising the above polynucleotide or expressing the above mutated ToPif1 helicase.

[0025] The present invention also provides a method for preparing the modified ToPif1 helicase, comprising the following steps:

[0026] 1) Providing the above-mentioned mutant ToPif1 helicase;

[0027] 2) reacting under covalent linkage conditions to obtain the modified ToPif1 helicase.

[0028] Preferably, the reaction in step 2) is a reaction involving thiol groups.

[0029] Preferably, the reaction in step 2) is a bioorthogonal reaction.

[0030] Beneficial technical effects

[0031] The modified ToPif1 helicase of the present invention can control the smooth movement of polynucleotides from the pore, reduce slippage or irregular movement, and promote more accurate reading of polynucleotides and longer read lengths; while maintaining the continuous binding of the enzyme to the polynucleotide, it effectively enhances the enzyme molecules to control the movement of nucleic acid molecules through the nanopore, thereby improving the accuracy and throughput of nucleic acid detection or sequencing. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is the SDS-PAGE gel electrophoresis image of the purified ToPif1 helicase;

[0033] Figure 2 Schematic diagram of fluorescence analysis for detecting helicase activity;

[0034] Figure 3 This is the change in fluorescence value generated by ToPif1 helicase unwinding the fluorescent substrate over time;

[0035] Figure 4 4-10% SDS-PAGE gel electrophoresis of ToPif1-E221C / Y401C (SEQ ID NO: 1 with mutations E221C / Y401C forms a disulfide bond through TMAD catalysis or is linked to bismaleimidoethane);

[0036] Figure 5 The effect of ToPif1 helicase on DNA binding ability before and after modification;

[0037] Figure 6 is a schematic diagram of the DNA construct;

[0038] Figure 7 Electrical signal diagram showing that the modified ToPif1 helicase is able to control the movement of the intact DNA construct X through the nanopore.

[0039] Figure 8 A magnified image showing the area where the modified ToPif1 helicase controls the movement of DNA using electrical signals.

[0040] Figure 9 This is the electrical signal diagram of a simple nucleic acid sample passing through the pore without helicase control. DETAILED DESCRIPTION

[0041] The technical solutions of the present invention will be described in further detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are encompassed within the scope of protection that the present invention is intended to protect.

[0042] Technical terms

[0043] Covalent attachment

[0044] As used in the present invention, "covalent linkage" refers to a connection between two or more amino acid residues at specific positions of the ToPif1 helicase through any chemical group, including direct connection through the functional groups of the amino acid residues, or connection through a bifunctional linker molecule or a multifunctional linker molecule.

[0045] For direct connection, for example, two cysteines can form a disulfide bond, or two amino acid residues carrying bioorthogonal functional groups such as azide or alkyne can form a triazole connection under Cu ion catalysis.

[0046] When a bifunctional linker molecule is used to form a covalent linkage, the "covalent linkage" has a typical structure of AL-A1, wherein A and A1 are structures formed by coupling the functional group of the linker with the functional group of the amino acid residue, such as thioether (for example, formed by the reaction of the sulfhydryl group of cysteine ​​with maleimide) or triazole (formed by the reaction of azide and alkyne), wherein L is the spacer of the bifunctional linker, which can be any divalent chemical group, preferably a C1-10 (including C1, C2, C3, C4, C5, C6, C7, C8, C9 or C10) straight or branched alkylene or 1, 2 or 3 repeating units of polyethylene glycol subunits.

[0047] Bifunctional linkers are well known to those skilled in the art and can be obtained commercially or customized. In certain embodiments of the present invention, homofunctional bifunctional linkers such as BMOE (bismaleimidoethane) or BMB (1,4-bismaleimidobutane) are used; in other embodiments of the present invention, heterofunctional bifunctional linkers such as alkyne-hydrazide bifunctional linkers are used. The type and length of the spacer arm of the bifunctional linker can be selected based on, for example, the distance between the amino acid residues to be connected.

[0048] The linking molecule in the present invention has its broadest meaning, and also includes what are called disulfide bridging or disulfide re-bridging reagents or disulfides tapling reagents in the art, such as the thioester bireactive reagents reported in the prior art (Chem. Sci., 2022, 13, 11533–1153); another example is 3Br–5MP reagent (Zhang, Y., Zang, C., An, G. et al. Cysteine-specific protein multi-functionalization and disulfide bridging using 3-bromo-5-methylenepyrrolones. Nat Commun 11, 1015 (2020). https: / / doi.org / 10.1038 / s41467-020-14757-4) and the like.

[0049] Unless otherwise specified, the raw materials and reagents used in the following examples are commercially available or can be prepared by known methods.

[0050] Example 1 Preparation of Pif1 helicase protein

[0051] Based on the amino acid sequence of the wild-type ToPif1 protein (64-507) (PDB ID: 6S3P, website: RCSBPDB–6S3P: Structural and functional studies of SF1B Pif1 from Thermus oshimaireveal dimerization-induced helicase inhibition. SEQ ID NO: 14), the nucleic acid sequence was obtained by in vitro gene synthesis. The codons were then optimized using Escherichia coli, replacing them with codons commonly used in E. coli. The optimized nucleic acid sequence of the ToPif1 protein was obtained, as shown in SEQ ID NO: 2. The protein was then inserted into the pET28 expression vector via the Nde I and Xho I restriction enzyme sites. Sequencing confirmed the correct sequence to obtain a recombinant expression plasmid for the ToPif1 helicase.

[0052] The recombinant plasmid was transformed into the BL21 (DE3) Escherichia coli expression host by heat shock method. During the induction expression process, the host bacteria containing the expression plasmid were first cultured at 37°C overnight with LB medium containing kanamycin resistance, and then amplified at 37°C at a ratio of 1:100. When the OD (600) value reached 0.4-0.6, the culture was stopped and placed at 4°C for 1 hour for cooling treatment. Subsequently, isopropyl β-D-Thiogalactoside (IPTG) with a final concentration of 0.5mM was added to induce expression at 16°C for 12-16h. Then, the bacteria were collected by centrifugation at 4°C and 15000rpm, and the bacteria were crushed by high pressure at 4°C using a high pressure crusher. The supernatant was then collected by centrifugation at 4°C, and then the target protein was separated and purified step by step through nickel column, heparin column, Q column and molecular sieve, and finally a large amount of high-purity wild-type helicase protein was obtained. The product was identified by SDS-PAGE gel electrophoresis, and the results are as follows. Figure 1 As shown, there is only one single band in the figure, indicating that the protein is very pure.

[0053] Example 2 Fluorescence assay analysis of the unwinding activity of ToPif1 helicase

[0054] Fluorescence analysis of helicase activity Figure 2 shown.

[0055] Specifically, Figure 2 As shown in (1), the fluorescent substrate chain (final concentration 100 nM, d, SEQ ID NO: 4) has a 20-base single-stranded DNA portion at the 5' end and an 18-base hybridized double-stranded DNA portion, and its 3' end has a fluorescent group (Cy3, f). The upper short chain (c, SEQ ID NO: 5) that is complementary to it has a fluorescence quenching group (BHQ-1, e) at the 5' end. When the two chains are complementary, the fluorescence of Cy3 (f) is quenched by BHQ-1 (e), and the substrate is essentially non-fluorescent.

[0056] During the experiment, Figure 2 As shown in (2), ToPif1 helicase binds to the 5' end single-stranded DNA portion of the fluorescent substrate, and after adding ATP (2 mM) and MgCl2 (2 mM), it shifts along the 5'-3' direction and unwinds the double-stranded portion.

[0057] Then, if Figure 2 As shown in (3), the excess capture chain (b, SEQ ID NO: 6) preferentially pairs with the short chain (c) to prevent re-annealing between the initial substrates, and the released substrate backbone (d) emits fluorescence.

[0058] The fluorescence values ​​of ToPif1 helicase unwinding the fluorescent substrate over time in 50mM, 100mM, 200mM, and 300mM NaCl buffers (25mM Tris-HCl pH 7.5, 2mM ATP, 2mM MgCl2, 300mM NaCl) are shown in Figure 2. Figure 3 The results showed that the substrate changed from being essentially non-fluorescent to emitting fluorescence.

[0059] Example 3 Preparation of ToPif1-E221C / Y401C

[0060] Based on the amino acid sequence of the wild-type ToPif1 protein (64-507) (PDB ID: 6S3P, website: RCSBPDB–6S3P: Structural and functional studies of SF1B Pif1 from Thermus oshimaireveal dimerization-induced helicase inhibition.), the nucleotide sequence was obtained by in vitro gene synthesis. Codons were then optimized using Escherichia coli, replacing the codons with those commonly used in E. coli. The optimized nucleotide sequence of ToPif1 protein is shown in SEQ ID NO:2. This protein was then inserted into the pET28 expression vector via the NdeI and XhoI restriction enzyme sites. Sequencing confirmed the correct sequence, resulting in a recombinant expression plasmid for the ToPif1 helicase. Site-directed mutagenesis was then performed by overlapping PCR to obtain the nucleotide sequence encoding the mutation combination E221C and Y401C (SEQ ID NO:3).

[0061] The mutated recombinant plasmid was transformed into the BL21 (DE3) Escherichia coli expression host by heat shock method. During the induction expression process, the host bacteria containing the expression plasmid were first cultured at 37°C overnight with LB medium containing kanamycin resistance, and then amplified at 37°C at a ratio of 1:100. When the OD (600) value reached 0.4-0.6, the culture was stopped and the cells were placed at 4°C for 1 hour for cooling. Subsequently, isopropyl β-D-Thiogalactoside (IPTG) was added at a final concentration of 0.5mM to induce expression at 16°C for 12-16 hours. Then, the bacteria were collected by centrifugation at 4°C, 15000rpm, and the cells were crushed by high pressure at 4°C using a high pressure crusher. The supernatant was then collected by centrifugation at 4°C, and then the target protein was separated and purified step by step through nickel column, heparin column, Q column and molecular sieve, and finally a large amount of high-purity helicase mutant protein was obtained, the sequence of which is shown in SEQ ID NO: 1.

[0062] 1 μL of 1 M DTT was added to 100 μL of ToPif1 mutant protein (SEQ ID NO: 1 with mutations E221C / Y401C, stored in 25 mM Tris-HCl pH 7.5, 500 mM NaCl, 10% glycerol) and incubated at room temperature for 30 minutes.

[0063] The buffer was exchanged with PBS buffer (pH 7.0) using a 0.5 ml Zeba desalting column (7k MWCO) to obtain 100 μl of sample. 1 μl of 8.1 mM TMAD or 10 mM bismaleimidoethane was added and incubated at room temperature for 1 hour with rotation at 20 rpm. The crosslinking results were then analyzed using a 4-10% polyacrylamide gel. The results are shown in Figure 2. Figure 4 It can be clearly seen from the gel that the yield of the two ligation reactions of the ToPif1 mutants reached almost 100%.

[0064] The ToPif1 mutant (or ToPif1-E221C / Y401C) is SEQ ID NO: 1 with the mutation combination E221C and Y401C, which is catalyzed by TMAD to form an intramolecular disulfide bond or to form a bismaleimidoethane linker. In this case, a covalent linkage is formed between cysteines 221 and 401 in the original ToPif1 sequence by TMAD-catalyzed disulfide cross-linking or by reaction with a bismaleimidoethane linker.

[0065] Example 4 DNA binding ability of ToPif1-E221C / Y401C

[0066] The DNA substrate required for the gel shift experiment was prepared by annealing (SEQ ID NO: 7 was annealed with SEQ ID NO: 8 and NO: 9 at a molar concentration ratio of 1:1.1:1.1, with a final concentration of 10uM), and then incubated with wild-type ToPif1 (PDB ID: 6S3P) and ToPif1-E221C / Y401C (SEQ ID NO: 1 with the mutation combination E221C / Y401C connected to bismaleimidoethane) at a molar ratio of 1:1, 1:5 and 1:10, respectively, in buffer (25mM Tris-HCl pH7.0, 100mM NaCl, 10% glycerol, 1Mm EDTA) at room temperature for one hour, resulting in a final DNA concentration of 500nM in the final reaction solution, and the total reaction volume was 20μL.

[0067] Add bismaleimidoethane to the corresponding helicase mutant sample to a final concentration of 5 μM and incubate at room temperature for 1 hour. Then, use 4%-10% TBE gel for detection, run the gel at 120V for 1.5 hours, and then observe the DNA bands under UV light by Gel Red staining. The results are as follows Figure 5 shown.

[0068] like Figure 5 As shown, lane 1 represents a simple DNA substrate without protein binding. When wild-type ToPif1 was mixed with DNA substrate at different molar ratios of 1:1, 5:1 and 10:1, protein-bound bands appeared on the gel image, i.e., new bands appeared above lanes 2, 3 and 4 relative to lane 1. After the ToPif1 helicase was modified, the simple DNA substrate bands at the bottom of lanes 5, 6 and 7 decreased compared to lanes 1, 2 and 3, while the protein-bound bands at the top increased, indicating that the modified ToPif1's ability to bind to polynucleotides was significantly enhanced.

[0069] Example 5 Ability of ToPif1-E221C / Y401C to Control the Movement of an Intact DNA Construct Through a Nanopore

[0070] Prepare as Figure 6 The DNA construct X shown. The specific method includes:

[0071] First, primers containing sequences A, C, D, E, and F were designed and used to amplify a 1000-base sequence (G) on λ DNA. The resulting PCR product was purified and then annealed and hybridized with sequence H at a molar ratio of 1:1.1 to obtain the final DNA construct X.

[0072] A represents 50 Ts, C represents an iSpC18 spacer, D represents SEQ ID NO: 10, E represents two iSpC18 spacers, F represents SEQ ID NO: 11, G represents SEQ ID NO: 12, and H represents SEQ ID NO: 13 with a cholesterol tag at the 3' end.

[0073] The prepared DNA construct X (final concentration 0.1 nM) was preincubated with ToPif1-E221C / Y401C (final concentration 10 nM) in a buffer solution (10 mM Hepes, pH 8.0, 100 mM KCl, 10% glycerol) at room temperature for 30 minutes. Bismaleimidoethane was added to the corresponding helicase mutant sample to a final concentration of 5 μM and incubated at room temperature for 1 hour.

[0074] Electrical signal measurements were obtained from a Csgg nanopore embedded in a DPhPC phospholipid bilayer in a buffer solution (600 mM KCl, 75 mM K3[Fe(CN)6, 25 mM K4[Fe(CN)6]·3H2O, 100 mM Hepes, pH 8.0). After achieving single-pore insertion into the phospholipid bilayer, 2 ml of buffer (600 mM KCl, 75 mM K3[Fe(CN)6, 25 mM K4[Fe(CN)6]·3H2O, 100 mM Hepes, pH 8.0) was flowed through the system to remove excess nanopore. The preincubated sample, ATP (final concentration 2 mM), and MgCl2 (final concentration 10 mM) were then co-flowed into the single nanopore experimental system (total volume 100 μL), and the signal was measured at a constant voltage of +180 mV for 6 h (including a potential 2 s voltage reversal at -180 mV).

[0075] Figure 7 showed that the mutants were able to control the movement of the complete DNA construct X through the nanopore, Figure 8 A magnified view of a portion of the region showing the DNA movement it controls. Figure 9 This is the case of a simple nucleic acid sample passing through the pore without helicase control. The burr-like signal marked by the arrow represents the passing of a simple nucleic acid sample. It can be seen that the speed of the simple nucleic acid passing through the pore is very fast (<<1s), and the base information of the nucleic acid cannot be identified. However, after adding the modified ToPif1 helicase, a clear nucleic acid passing through signal can be seen. When using the wild-type helicase for the experiment, due to its weak binding to the nucleic acid sequence to be tested, it slips from the spacer region, resulting in no signal measurement.

[0076] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

[0077] Sequence information:

[0078] SEQ ID NO:1ToPif1-E221C / Y401C

[0079] PEGLSSEQQRAFLAVTQTPHPAHLITGPAGTGKTTLLYALQEFYKGRAVTLAPTGTAALQARGQTVHSFFRFPARLLRYRHPEDIRPPGPHSPLRKAIEQMEVLILDEVGMVRVDLLEAMDWALRKTRKRLEEPFGGVKVLLLGDTRQLEPVVPGGCEALYIARTWGGPFFFQAHVWEEVALRVHRLWESQRQREDPLFAELLKRLRQGDPQALETLNRAAVRPDGGEEPGTLILTPRRKEADALNLKRLEALPGKPLEYQAQVKGEFAETDFPTEAALTLKKGAQVILLRNDPLGEYFNGDLGWVEDLEAEALAVRLKRNGRRVVIRPFVWEKIVCTYDSEREEIKPQVVGTFRQVPVRLAWALTVHKAQGLTLDKVHLELGRGLFAHGQLYVALTRVRRLQDLSLSRPIAPTELLWRPEVEVFETRIQEGIWQKSHGWPSL

[0080] SEQ ID NO:2 Nucleic acid sequence of wild-type ToPif1

[0081]

[0082] SEQ ID NO:3 Nucleic acid sequence of ToPif1-E221C / Y401C

[0083]

[0084] AAGTGGTGGGCACCTTTCGCCAAGTGCCGGTGCGCCTGGCGTGGCGCTGACCGTGCATAAAGCGCAAGGCCTGACCCTGGATAAAGTGCATCTGGAACTGGGCCGCGGCCTGTTTGCGCATGGTCAGCTGTATGTGGCGCTG ACCCGCGTGCGCCGCCTGCAAGATCTGAGCCTGAGCCGCCCGATTGCGCCGACCGAACTGCTGTGGCGCCCGGAAGTGGAAGTGTTTGAAACCCGCATTCAAGAAGGCATTTGGCAGAAAAGCCATGGCTGGCCGAGCCTGTAA

[0085] SEQ ID NO: 4: Substrate sequence

[0086] GAACAACAACAACAACCATGGAAAATCAAAACTAAAAC

[0087] SEQ ID NO: 5: Substrate sequence

[0088] GTTTTAGTTTTGATTTTC

[0089] SEQ ID NO: 6: Substrate sequence

[0090] GAAAATCAAAACTAAAAC

[0091] SEQ ID NO: 7: Substrate sequence

[0092] GGCGTCTGCTTGGGTGTTTAACCTTTTTTTTTTCCACAACTTCGTTCAGTTACGTATTGCT

[0093] SEQ ID NO: 8: Substrate sequence

[0094] GCAATACGTAACTGAACGAAGTTGTGG

[0095] SEQ ID NO: 9: Substrate sequence

[0096] GGTTAAACACCCAAGCAGACGCC

[0097] SEQ ID NO: 10: D sequence in construct X

[0098] GGCGTCTGCTTGGGTGTTTAACC

[0099] SEQ ID NO: 11: F sequence in construct X

[0100] TTGACCTTTCTCTCCCATATTGCA

[0101] SEQ ID NO: 12: G sequence in construct X

[0102]

[0103] SEQ ID NO:13: H sequence in construct X

[0104] GGTTAAACACCCAAGCAGACGCCTTTGAGGCGAGCGGTCAA-cholesterol

[0105] SEQ ID NO:14: 6S3P_1|Chain A|PIF1 helicase|Thermus oshimai(56957)

[0106] PEGLSSEQQRAFLAVTQTPHPAHLITGPAGTGKTTLLYALQEFYKGRAVTLAPTGTAALQARGQTVHSFFRFPARLLRYRHPEDIRPPGPHSPLRKAIEQMEVLILDEVGMVRVDLLEAMDWALRKTRKRLEEPFGGVKVLLLGDTRQLEPVVPGGEEALYIARTWGGPFFFQAHVWEEVALRVHRLWESQRQREDPLFAELLKRLRQGDPQALETLNRAAVRPDGGEEPGTLILTPRRKEADALNLKRLEALPGKPLEYQAQVKGEFAETDFPTEAALTLKKGAQVILLRNDPLGEYFNGDLGWVEDLEAEALAVRLKRNGRRVVIRPFVWEKIVYTYDSEREEIKPQVVGTFRQVPVRLAWALTVHKAQGLTLDKVHLELGRGLFAHGQLYVALTRVRRLQDLSLSRPIAPTELLWRPEVEVFETRIQEGIWQKSHGWPSL

[0107] SEQ ID NO:15: (WP_026234175.1,DEAD / DEAH box helicase)

[0108] MSHLLLFVTLLGAFGLGYLQGGPVLGLFLAGLGLLLGRGLRPARPSQVEEPPSPKADPEEVEETPEGLSSEQQRAFLAVTQTPHPAHLITGPAGTGKTTLLYALQEFYKGRAVTLAPTGTAALQARGQTVHSFFRFPARLLRYRHPEDIRPPGPHSPLRKAIEQMEVLILDEVGMVRVDLLEAMDWALRKTRKRLEEPFGGVKVLLLGDTRQLEPVVPGGEEALYIARTWGGPFFFQAHVWEEVALRVHRLWESQRQREDPLFAELLKRLRQGDPQALETLNRAAVRPDGGEEPGTLILTPRRKEADALNLKRLEALPGKPLEYQAQVKGEFAETDFPTEAALTLKKGAQVILLRNDPLGEYFNGDLGWVEDLEAEALAVRLKRNGRRVVIRPFVWEKIVYTYDSEREEIKPQVVGTFRQVPVRLAWALTVHKAQGLTLDKVHLELGRGLFAHGQLYVALTRVRRLQDLSLSRPIAPTELLWRPEVEVFETRIQEGIWQKSHGWPSL

Claims

1. A modified ToPif1 helicase, characterized in that: The sequence of the modified ToPif1 helicase is SEQ ID NO: 1; the modified ToPif1 helicase is covalently linked between positions 221 and 401 via bismaleimide ethane.

2. A sequencing element or sequencing device comprising the modified ToPif1 helicase according to claim 1.

3. Use of the modified ToPif1 helicase according to claim 1 in nucleic acid sequencing. 4 . A biological material comprising the modified ToPif1 helicase according to claim 1 .

5. A method for preparing the modified ToPif1 helicase according to claim 1, comprising the following steps: 1) Providing the ToPif1 helicase shown in SEQ ID NO: 1 as claimed in claim 1; 2) reacting in the presence of bismaleimide ethane to form a covalent link to obtain the modified ToPif1 helicase.

Images