KASP molecular marker of wheat scab resistance qtl qfhb.sdau-6bl and application thereof

Abstract

The present application relates to KASP molecular marker of wheat scab resistance QTL Qfhb.sdau-6BL and application thereof, and belongs to the technical field of wheat scab resistance molecular marker.The present application locates a new QTL site of wheat scab resistance on 6BL (706-709Mb) chromosome by BSR-Seq analysis, and names it as Qfhb.sdau-6BL.A KASP molecular marker is developed from the above QTL interval, and is named as KASP-QFhb.sdau-6B.14 with a physical position of 708440306.The above molecular marker has high correlation with scab resistance, and the site can be applied to molecular marker assisted selection breeding.Therefore, the present application mines a new scab resistance gene, and can provide a new gene resource for cultivation of new wheat varieties with scab resistance.

Description

TECHNICAL FIELD

[0001] The application relates to a KASP molecular marker of a wheat scab resistance QTL and application thereof, and belongs to the technical field of wheat scab resistance molecular markers. Qfhb.sdau-6BL BACKGROUND BACKGROUND

[0002] Wheat scab is a worldwide disease mainly caused by Fusarium graminearum (Schwein.) and the like, which invades floret at the flowering stage of wheat, continuously expands during the grain filling and maturation process, produces and accumulates various toxins such as deoxynivalenol (DON), nivalenol (NIV) and zearalenol (ZEN), and even expands to the ear axis to affect the transportation of nutrients and water, and even causes withered ear, grain shriveling, and thus reduces the yield of wheat, damages the quality, and even the toxin pollution causes great harm to human and animal health, and becomes a major threat to food safety. Fusarium gramin earum Molecular marker assisted selection breeding can select target traits at the DNA level, and is stable in results, easy to operate, and beneficial to early selection of breeding.

[0003] Single nucleotide polymorphism (SNP) markers have the characteristics of genetic stability, large quantity, wide distribution and easy detection, are suitable for large-scale detection and analysis, and a variety of SNP chips suitable for different animals and plants have existed in the market, and play a very important role in genetic breeding.

[0004] KASP (Kompetitive Allele Specific PCR) is a competitive allele specific PCR, which can be applied to a wide range of genomic DNA samples (even some complex genomic DNA samples), and can accurately determine the double alleles of SNPs and InDels at specific sites. KASP has high throughput, is fast and stable, and is a relatively ideal practical molecular marker for breeding. In recent years, with the continuous improvement of wheat whole genome sequencing, the genetic research on various traits of wheat has been deepened to the SNP level, so the development and utilization of KASP markers have become one of the main ways of wheat molecular marker assisted breeding, and the technology has been widely used in the breeding of wheat height, grain weight and vernalization genes / sites.

[0005] Chinese patent document CN107988411A (application number 201711397824.7) discloses a KASP molecular marker for wheat scab resistance major QTL and its application, the major QTL is located on the long arm of the second chromosome of wheat, named Qfhb-2DL; the Qfhb-2DL includes two linked KASP molecular markers GBS12056 and GBS10238, the Qfhb-2DL is located in the 2.0cM interval between GBS12056-GBS10238, can explain 30.3% of the phenotypic variation, the additive effect is -14.1. The KASP molecular marker for wheat scab resistance major QTL and its application of the invention is developed by exploring the closely linked marker of the wheat scab major resistance QTL, the QTL located by the KASP molecular marker of the invention has large and stable genetic effect, the KASP molecular marker is closely linked to the target QTL, and can meet the needs of molecular breeding.

[0006] Chinese patent document CN112941232A (application number 202110473947.4) discloses a wheat scab resistance related molecular marker and its application. Using Wheat55K wheat high-throughput gene chip to obtain genotype data, a major QTL site QFhb-6B-YM4 related to scab resistance is detected from Yangmai No.4, the closely linked marker is AX111634185, and a KASP marker primer group is developed accordingly to screen the high and low resistance to scab. Through PCR amplification of wheat genomic DNA by the primer group of the invention, it can be directly judged whether the wheat carries the high scab resistance gene of Yangmai No.4 by KASP typing, the detection method is simple to operate, the detection result is very intuitive, and the detection effect is obvious and effective, and the use of the molecular marker for screening can greatly improve the efficiency of molecular marker assisted selection of wheat breeding with high and low resistance to scab.

[0007] Chinese patent document CN114959100A (application number 202210680831.2) discloses a KASP primer set for screening dwarf dense spike fusarium wilt resistant wheat and its application. The application uses Wheat55K wheat high-throughput gene chip to obtain genotype data, and detects two QTL regions Q.2D and Q.5A related to plant height, spikelet density and fusarium wilt resistance from Yangmai 11 on 2D and 5A chromosomes, and the closely linked markers are AX110519154 (2D) and AX111618105 (5A), and two KASP marker primer sets are developed accordingly. Experiments prove that the KASP molecular marker of the application can be used for molecular marker assisted selection breeding of wheat plant height, spikelet density and fusarium wilt resistance. The application provides a good tool for effective use of two QTL regions Q.2D and Q.5A related to plant height, spikelet density and fusarium wilt resistance in breeding.

[0008] It is very important to mine more QTL sites of wheat fusarium wilt resistance and develop linkage molecular markers for use in breeding for molecular marker assisted selection of wheat fusarium wilt resistance. SUMMARY

[0009] In view of the deficiencies of the prior art, the application provides a KASP molecular marker of a wheat fusarium wilt resistance QTL Qfhb.sdau-6BL and its application.

[0010] The technical scheme of the application is as follows:

[0011] A KASP molecular marker of a wheat fusarium wilt resistance QTL Qfhb.sdau-6BL , which is located on the 6BL chromosome and specifically at 706-709 Mb; the KASP molecular marker is Qfhb.sdau-6BL , specifically at 708440306, and the SNP site base variation of the KASP molecular marker KASP-QFhb.sdau-6B.14 is C / T variation, and the fusarium wilt resistance of wheat material containing TT base is better than that of wheat material containing CC base. KASP-QFhb.sdau-6B.14

[0012] A primer of a KASP molecular marker of a wheat fusarium wilt resistance QTL Qfhb.sdau-6BL , which comprises two forward primers, and the nucleotide sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2, and one reverse universal primer, and the nucleotide sequence is shown in SEQ ID NO. 3.

[0013] According to the application, different fluorescence detection sequences are added in front of the sequences of the two forward primers respectively.

[0014] ​Further preferably, the fluorescence detection sequences are FAM sequence and HEX sequence respectively.

[0015] A wheat scab resistance QTL Qfhb.sdau-6BL A genotyping method of the wheat scab resistance QTL, extracting wheat genomic DNA, performing PCR amplification with primers shown in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3, and determining genotyping after fluorescence detection.

[0016] A wheat scab resistance QTL Qfhb.sdau-6BL A genotyping product of the wheat scab resistance QTL, comprising a detection material of the KASP molecular marker.

[0017] According to the present application, preferably, the detection material comprises primers of the KASP molecular marker.

[0018] The KASP molecular marker of the above-mentioned wheat scab resistance QTL Qfhb.sdau-6BL The KASP molecular marker of the above-mentioned wheat scab resistance QTL

[0019] (1) identifying or assisting in identifying wheat resistance to scab resistance;

[0020] (2) preparing a product for identifying or assisting in identifying wheat resistance to scab resistance;

[0021] (3) comparing the scab resistance of the wheat grains to be tested;

[0022] (4) breeding or screening wheat lines or strains with relatively strong scab resistance;

[0023] (5) breeding or screening wheat lines or strains with relatively weak scab resistance;

[0024] (6) preparing a product for screening or comparing the scab resistance of the wheat to be tested.

[0025] According to the present application, preferably, the detection material of the KASP molecular marker comprises primers of the KASP molecular marker.

[0026] Advantages:

[0027] Bulked segregant RNA-Seq (BSR-Seq) is a high-efficiency sequencing method combining bulked segregant analysis (BSA) and RNA sequencing technology (RNA-Seq), which can effectively find significantly different sites and predict candidate genes. Qfhb.sdau- 6BL, A KASP molecular marker is developed from the above-mentioned QTL interval and is named KASP-QFhb.sdau-6B.14, the physical position is 708440306, the molecular marker has high correlation with scab resistance, and the site can be applied to molecular marker assisted selection breeding. Therefore, the new scab resistance gene is mined, and new gene resources are provided for cultivation of new scab resistance wheat varieties. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 It is a column chart of chromosome distribution of SNP / Indel site number.

[0029] Figure 2 It is a Manhattan chart of chromosome distribution of Delta (SNP-index), wherein the scatter plot is an original value, the black curve is a fitting value, the blue curve is a 95% confidence interval boundary, and the red curve is a 99% confidence interval boundary.

[0030] Figure 3 It is an ED 2 Manhattan chart of chromosome distribution, wherein the scatter plot is an original value, the black curve is a fitting value, the blue curve is a 95% confidence interval boundary, and the red curve is a 99% confidence interval boundary.

[0031] Figure 4 It is a Manhattan chart of Delta (SNP-index) distribution of 6B chromosome, wherein the scatter plot is an original value, the black curve is a fitting value, the blue curve is a 95% confidence interval boundary, and the red curve is a 99% confidence interval boundary.

[0032] Figure 5 It is an ED 2 Manhattan chart of chromosome distribution, wherein the scatter plot is an original value, the black curve is a fitting value, the blue curve is a 95% confidence interval boundary, and the red curve is a 99% confidence interval boundary.

[0033] Figure 6 It is a genotyping result chart of KASP molecular marker KASP-QFhb.sdau-6B.14 , wherein R represents an individual genotype consistent with the parent Nankang No. 1 (resistant to disease), S represents an individual genotype consistent with the parent Shan Nong No. 102 (susceptible to disease), and NTC is a negative control.

[0034] Figure 7 It is a genotyping result chart of KASP molecular marker KASP-QFhb.sdau-6B.14 , wherein R represents a scab-resistant strain, S represents a scab-susceptible strain, and NTC represents a negative control. DETAILED DESCRIPTION

[0035] The technical solutions of the present application are further described below in combination with examples, but the protection scope of the present application is not limited to this. The reagents and drugs involved in the examples are all ordinary commercially available products if not otherwise specified; the experimental operations and steps involved in the examples are all conventional operations in the field if not otherwise specified.

[0036] The biological materials involved in the examples are as follows:

[0037] The disease-resistant parent Nankang No. 1 and the disease-susceptible parent Shannong No. 102 can be obtained from Shandong Agricultural University, and the F4 population material constructed by hybridization of Nankang No. 1 and Shannong No. 102 has 426 strains.

[0038] The Fusarium graminearum can be purchased through ordinary commercial channels.

[0039] Example 1: Sample screening

[0040] The F4 population material constructed by hybridization of Nankang No. 1 and Shannong No. 102 was used as samples and planted in a greenhouse from September 2020 to January 2021 and from March to June 2021. The wheat grains were placed in a seedling tray filled with mixed substrate soil (nutrient soil: vermiculite: ordinary soil = 1:1:1, mass ratio), and after germination at room temperature for 2 days, they were placed in a 4℃ light incubator for about 35 days. During the vernalization period, the light incubator was set as shown in Table 1. After vernalization, the plants were transplanted into flowerpots in the greenhouse of Shandong Agricultural University and managed routinely until maturity.

[0041] Table 1: Vernalization conditions of the light incubator

[0042]

[0043] The F5:6 population material of Nankang No. 1 and Shannong No. 102 planted in flowerpots in the greenhouse in March 2021 was taken, and normal plants at the initial flowering stage of wheat were selected. Five wheat spikes of the same strain were randomly selected, and 2 florets in the middle of each spike were inoculated. 20μL of Fusarium graminearum spore suspension (1μL containing 50 spores) was injected using a micro-syringe, water was sprayed, and the bag was sealed for 3 days. The self-sealing bag was removed after 3 days.

[0044] The incidence of disease was investigated 7d, 14d, and 21d after inoculation, and the number of diseased spikes was recorded.

[0045] Diseased spikelet rate (DSR) = (number of diseased spikes / total number of spikes) × 100%

[0046] Diseased spike rachis length (DRL) was measured 21d after inoculation.

[0047] Resistance gene effect = (average diseased spikelet rate of material carrying resistance gene - average diseased spikelet rate of material not carrying resistance gene) / average diseased spikelet rate of material not carrying resistance gene

[0048] The disease severity of the inoculated wheat materials was investigated, and the grade division was referred to the People's Republic of China Agricultural Industry Standard (Technical Specification for Evaluation of Wheat Disease Resistance NY / T 1443.4-2007): Wheat Scab Severity Grading and Resistance Evaluation Standard, as shown in Tables 2 and 3.

[0049] Table 2 Scab severity grading and symptom description under single flower drop inoculation condition

[0050]

[0051] Table 3 Scab resistance evaluation standard under single flower drop inoculation condition

[0052]

[0053] Through phenotypic identification, 20 high-resistant and 20 high-susceptible lines were screened from the F5:6 generation population of Nankang 1 x Shannong 102, and the spike tissues of the high-resistant and high-susceptible lines were mixed in equal amounts to construct two pools of resistant and susceptible for RNA extraction and analysis.

[0054] Example 2 Sequencing analysis

[0055] The RNA extraction and quality detection of the BSR sequencing sample, the construction and quality detection of the cDNA library, the transcriptome sequencing, the sequencing results and data analysis, and other operation processes were performed by Guangzhou Kidebio Technology Co., Ltd.

[0056] 1. RNA extraction and quality detection

[0057] (1) Sample preparation: 20 high-resistant lines and 20 high-susceptible lines were taken respectively, and the spike tissues of each line were mixed in equal amounts to construct two pools of resistant and susceptible for RNA extraction. In addition, the spike tissues of the resistant parent Nankang 1 and the susceptible parent Shannong 102 were taken to extract RNA.

[0058] (2) An appropriate amount of wheat spike tissue was taken, ground thoroughly in a liquid nitrogen environment, and then transferred to a 1.5 mL centrifuge tube. 1 mL of Trizol reagent was added, mixed thoroughly, and placed at room temperature for 10 min to allow complete lysis;

[0059] (3) 200 µL of chloroform was added, mixed thoroughly, and centrifuged at 4°C, 12000 r / min for 10 min;

[0060] (4) Take the supernatant, add an equal volume of phenol: chloroform mixture (25:24, v / v), shake well, centrifuge at 4°C, 12000 r / min for 10 min;

[0061] (5) Take the supernatant, add an equal volume of chloroform, shake well, centrifuge at 4°C, 12000 r / min for 10 min;

[0062] (6) Take the supernatant, add an equal volume of isopropanol, stand at -20°C for 1 h, centrifuge at 4°C, 12000 r / min for 10 min;

[0063] (7) Discard the supernatant, add 1 mL of 75% ethanol, wash the precipitate, centrifuge at 4°C, 8000 r / min for 5 min, discard the supernatant, repeat twice;

[0064] (8) Dry in the fume hood for 2-4 min;

[0065] (9) Add 20-50 μL of RNase-Free Water, dissolve at room temperature for 10 min, mix well and centrifuge briefly;

[0066] (10) The RNA is detected by agarose gel electrophoresis, Nanodrop 2000, and Agilent 2100. Store at -80°C.

[0067] 2. Construction and quality control of cDNA library

[0068] (1) Prepare the first strand reaction buffer and random primer mixture (2×) (Table 4):

[0069] Table 4 First strand reaction buffer (Buffer) and random primer mixture (2×)

[0070]

[0071] (2) Isolate mRNA, fragmentize, and add primers: Use magnetic beads with Oligo (dT) to enrich eukaryotic mRNA; add 17 μL of the previously prepared first strand reaction buffer and random primer mixture (2×) in the tube, and incubate the sample at 95°C for 15 min to elute the mRNA from the magnetic beads.

[0072] (3) cDNA first strand synthesis:

[0073] a. Add cDNA first strand synthesis reagents to the mRNA mixture after fragmentization and primer addition, and the synthesis system is as follows:

[0074] Table 5 cDNA first strand synthesis system

[0075]

[0076] b. Place the cDNA first strand synthesis system in a preheated PCR machine for reaction (cap heat temperature: 105°C), synthesis conditions: 25°C for 10 min, 42°C for 15 min, 70°C for 15 min, 4°C.

[0077] c. Immediately start the second strand synthesis reaction.

[0078] (4) cDNA second strand synthesis:

[0079] Add the reagents in the following table to the cDNA first strand synthesis reaction solution (20 μL) above to synthesize the cDNA second strand.

[0080] Table 6 Reagents required for cDNA second strand synthesis

[0081]

[0082] (5) cDNA library fragment end preparation:

[0083] a. Mix the following reagents in a sterile tube:

[0084] Table 7 Reagents required for cDNA library fragment end preparation

[0085]

[0086] b. Place the mixed reagents in a PCR machine for reaction (cap heat temperature 75°C), reaction conditions: 20°C for 30 min, 65°C for 30 min, 4°C.

[0087] c. Immediately perform the linker ligation step.

[0088] (6) Perform linker ligation:

[0089] a. Add the reagents in the following table directly to the end preparation reaction solution (65 μL) of the previous step (note: dilute NEBNext Adaptor with Tris-HCl).

[0090] Table 8 Reagents required for linker ligation

[0091]

[0092] b. Place in a PCR machine at 20°C for 15 min. Turn off the heat cap.

[0093] (7) Purify the ligation reaction solution

[0094] The reaction solution was supplemented with water to 100 μL, purified using AMPure XP Beads, washed with 80% ethanol, eluted with ddH2O, and the eluate was subjected to the next step reaction.

[0095] (8) PCR library amplification

[0096] a. The amplification system of PCR library amplification is as follows:

[0097] Table 9 PCR library amplification system

[0098]

[0099] b. PCR cycle conditions: 98℃ 30s; 98℃ 10s, 65℃ 75s, 12 cycles; 65℃ 5s.

[0100] (9) The PCR product was purified using AMPure XP Beads (1.0x).

[0101] (10) Library quality control

[0102] The DNA 1000 assay Kit (Agilent Technologies, 5067-1504) was selected for the kit. The DNA 1000 assay kit can detect sample fragment sizes ranging from 25-1000 bp, and concentrations ranging from 0.1-50 ng / µL;

[0103] The sequencing library was detected using an Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA), and library quantification was performed using real-time PCR.

[0104] 3. Illumina sequencing

[0105] Sequencing was performed on a Novaseq 6000 sequencer using a PE150 sequencing strategy.

[0106] 4. Data quality control

[0107] In order to ensure data quality and reduce the analysis interference of invalid data, data filtering was performed on the raw data. The raw sequence (raw reads) was subjected to quality control by FASTP (version 0.18.0) (Chen et al. , 2018), and low-quality data was filtered to obtain high-quality sequences (clean reads).

[0108] The conditions for filtering reads are as follows:

[0109] (1) Reads containing adapters;

[0110] (2) Reads containing unknown nucleotides (N) ≥ 10%;

[0111] (3) Reads containing all A bases;

[0112] (4) Low-quality reads (the number of bases with quality value Q ≤ 20 accounts for more than 50% of the entire read).

[0113] After filtering the data, the composition and quality distribution of the bases were analyzed to intuitively show the data quality.

[0114] The results showed that the anti-parent, sensitive parent and anti-sensate pools produced 76,162,892, 62,759,864 and 74,168,292, 63,300,060 raw sequences, respectively. After filtering the raw sequences, 75,748,704, 62,419,952 and 73,748,806, 62,946,928 high-quality sequences were obtained, accounting for 99.43-99.46% of the high-quality sequences, and the other invalid sequences accounted for a small percentage (Table 10).

[0115] Table 10 Data filtering statistics table

[0116]

[0117] Note: Each percentage is based on the percentage of raw sequences.

[0118] The anti-parent, sensitive parent and anti-sensate pools produced 11,424,433,800, 9,413,979,600 and 11,125,243,800, 9,495,009,000 bp raw bases, respectively. After filtering, 11,322,396,712, 9,331,792,559 and 11,025,171,867, 9,414,154,647 bp high-quality bases were obtained. After filtering, the GC content was 51.56-52.02%, the sequencing quality ≥ Q20 was 97.85-98.02%, and the sequencing quality ≥ Q30 was 94.09-94.55%, indicating that the sequencing quality was good and met the subsequent analysis (Table 11).

[0119] Table 11 Base information statistics table

[0120]

[0121] 5. Sequence alignment analysis

[0122] To exclude the influence of partial rRNA residues, the high-quality sequences (clean reads) were aligned to the ribosome database of wheat using the short-read alignment tool bowtie2 (Langmead et al., 2012), and the reads aligned to the ribosome were removed without allowing mismatches, and the remaining unmapped reads were referred to as valid sequences. The valid sequences were aligned to the Chinese Spring reference genome (IWGSC_RefSeq_v2.1) using the alignment software HISAT2 (Daehwan et al. , 2015), the alignment rate and the chromosomal distribution of the sequences were counted, and the uniquely aligned sequences were analyzed.

[0123] The comparative analysis results showed that the anti-parent, the susceptible parent and the anti-susceptible pool produced 62,840,849, 51,567,191 and 63,774,745, 52,458,768 sequences, respectively, which were uniquely aligned to the reference genome, and the proportion of the four samples was between 82.83-86.71% (Table 12).

[0124] Table 12 Alignment reference statistics

[0125]

[0126] Note: The number of reads after filtering ribosomes is referred to as valid sequences.

[0127] 6. Genome variation detection

[0128] For the sequences uniquely aligned to the reference genome (Unique mapped reads), the alignment results were sorted by chromosomes, and the repeated sequences were removed, the SNP detection was performed using the variation detection software GATK (version 3.4-46) (DePristo et al , 2011), and the ANNOVAR (version 2) (Wang et al. , 2010) was used to functionally annotate the detected variants.

[0129] In order to control the background noise as much as possible, the SNP / Indel sites were filtered according to the following standards, and the sites meeting the following conditions were used for subsequent BSA analysis:

[0130] (1) When both parents exist, there is a difference between the parents and the segregation form meets the population type (the segregation form of the markers retained in the F1 population is nn x np, lm x ll, hk x hk, and the segregation form of the markers retained in other populations is aa x bb);

[0131] (2) When parents exist, the sequencing depth of the (two) parents is greater than or equal to a given threshold, and the threshold used in this analysis is 5x;

[0132] (3) Neither of the two offspring pools is missing;

[0133] (4) The sequencing depth of each offspring pool is greater than 10x and less than 500x;

[0134] (5) The SNP-index of at least one offspring pool is greater than 0.3;

[0135] (6) The SNP-index of at least one offspring pool is less than 0.7.

[0136] SNP and Indel variation detection was performed using software GATK4, and finally data statistics, a total of 725,683 sites, including 692,717 SNP sites and 32,966 Indel sites (Table 13). In order to control the background noise as much as possible, according to the standard, the SNP / Indel site filtering was performed, and after filtering, 30,289 SNP / Indel sites were obtained, of which 30,109 were located on 21 chromosomes, accounting for 99.40% (Table 14, Figure 1 ). The number of SNP sites detected by the D genome is less than that of the A and B genomes, and the number of SNP sites of the B genome is the most, 15,172, the most in 5B and 1B, 3,256 and 3,214, respectively, the least in 3D and 4D, 188 and 131.

[0137] Table 13 SNP / Indel site number results statistics

[0138]

[0139] Table 14 Marker number statistics table before and after filtering

[0140]

[0141] 7. SNP-index-based BSA analysis method

[0142] The SNP separated from the parents in the population is screened as a molecular marker for subsequent BSA QTL mapping (QTL-seq). The frequency distribution of SNPs in the offspring sample is calculated using sliding window analysis, i.e. the offspring SNP-index. In the sliding window analysis, to reduce the interference of windows with less than 10 SNPs on the analysis, first count the number of SNPs in each window in the whole genome, calculate the proportion of the number of windows with SNPs ≥ 10 to the total number of windows, and select the window size of 400 kb with a proportion > 95% as the analysis parameter. According to the distribution of SNP density, the frequency distribution of SNPs in the pool sample is calculated with a window size of 400 kb and a sliding step of 20 kb, i.e. the offspring SNP-index. To intuitively reflect the distribution of pool SNP-index on the chromosome, Manhattan plot is used for mapping. The mean value of SNP index of each window SNP marker site is calculated, and the fitting curve is drawn. The difference between the two pool SNP-index is calculated, and the Δ (SNP-index) is calculated. The calculation process is subjected to 1000 times of permutation test, and the 95% confidence interval and the 99% confidence interval of Δ (SNP index) of each site and window are obtained. In the whole genome, the peak region greater than the threshold value is selected as the candidate region according to the 95% confidence interval, and the SNPs / InDels in the candidate region are annotated to screen potential candidate functional mutations.

[0143] The calculation method of SNP-index is as follows:

[0144] SNP-index of a specific site = ρ (recessive) / (ρ (dominant) + ρ (recessive))

[0145] ρ is the depth of the site in the pool. When the dominance and recessiveness can be clearly determined, Δ (SNP-index) has obvious directionality, i.e. a positive value indicates that the proportion of recessive alleles (or mutant alleles) in the recessive pool is higher than that in the dominant pool, which is usually the direction we concern; a negative value indicates that the proportion of recessive alleles (or mutant alleles) in the dominant pool is higher than that in the recessive pool.

[0146] 8. BSA analysis method based on ED method

[0147] Euclidean Distance (ED) algorithm is used to find significant difference markers between pools by using sequencing data. The calculation formula is as follows, and the larger the ED value, the greater the difference of the marker between the two pools.

[0148] The calculation formula of Euclidean distance method is as follows:

[0149]

[0150] wherein mut and wt represent recessive / mutant pool, dominant / wild type pool, respectively, A, C, G, T represent the coverage depth of each locus, and the ED value is the difference between the large value and the small value, so as to eliminate background noise. Usually, the original ED value is multiplied by a power to eliminate background noise. The ED value described herein refers to the result after multiplication.

[0151] BSA analysis results based on SNP-index and ED method:

[0152] In order to reduce background noise, the Δ (SNP-index) and ED method results obtained by calculation were fitted according to the sliding window method. The window size used in the sliding window was 2000 kb, and the step size used was 20 kb. When the number of SNPs in the window was greater than or equal to 10, the window was an effective window. When the number of SNPs was insufficient, the results of the window were integrated into the next window. The number of effective windows of SNP-index, ED results related indicators sliding window is shown in Table 15.

[0153] Table 15 Number of effective windows of SNP-index and ED method related indicators sliding window

[0154]

[0155] In order to intuitively reflect the distribution of Δ (SNP-index) and the square of the original ED on the chromosome, Manhattan plots were used to display them as Figure 2 and Figure 3 . Δ (SNP-index) was screened with the condition that the fitting peak value in the sliding window was greater than or equal to 0.55 or less than or equal to -0.55, and 32 effective windows were obtained. ED 2 was screened with the condition that the fitting peak value in the sliding window was greater than or equal to 0.6, and 42 effective windows were obtained. A new candidate QTL interval was determined by combining the two analysis methods, located on the 6BL chromosome, specifically 6BL (706-709 Mb) ( Figure 4~Figure 5 ), named Qfhb.sdau-6BL . There is one SNP site in the QTL interval, with a physical position of 708440306, showing a C / T base mutation, named KASP-QFhb.sdau-6B.14 . In addition, there are 395 SNP / Indel sites in the 95% confidence interval in the candidate QTL interval on the 3B chromosome. After analysis, the QTL interval has a major gene for resistance to fusarium wilt Fhb1 , which also verifies the results of molecular markers.

[0156] Example 3 KASP primer design and genotyping detection

[0157] To further verify the relationship between the sites detected by BSR-Seq and the resistance of wheat scab, SNP sites on 6BL were selected, KASP primers were designed using the sequences at both ends, and the primers were verified in the parents and the population. Through the physical position of the SNP site, 100 bp sequences before and after the SNP site were obtained from the Wheat Research Consortium Multiscale Data Website (http: / / 202.194.139.32 / #). The position of the SNP site and the sequence are shown in Table 16. When the base of the SNP site is T, the nucleotide sequence of the SNP sequence is shown in SEQ ID NO. 4. When the base of the SNP site is C, the nucleotide sequence of the SNP sequence is shown in SEQ ID NO. 5.

[0158] Table 16 SNP molecular marker sequence and base variation

[0159]

[0160] KASP primers were designed for the SNP molecular marker sequence through the Polymarker website (http: / / polymarker.tgac.ac.uk / ). (Table 17). After the primer design, the two forward primer sequences were added with fluorescence detection sequences respectively:

[0161] FAM sequence: GAAGGTGACCAAGTTCATGCT,

[0162] HEX sequence: GAAGGTCGGAGTCAACGGATT.

[0163] The primers were sent to Qingdao Biosyntech Biotech Co., Ltd. for synthesis.

[0164] Table 17 KASP primer sequence

[0165]

[0166] The specific experimental operation of genotyping detection is as follows:

[0167] (1) Primer dissolution and mixing: dilute each primer to 100 μM with ultrapure water, and mix the primers according to the volume ratio of upstream primer 1: upstream primer 2: downstream primer: ultrapure water / buffer solution = 6:6:15:13;

[0168] (2) PCR system preparation: the total volume of the amplification system is 10.0825 μL, and the specific sample addition is shown in Table 18, and the PCR amplification program is shown in Table 19;

[0169] Table 18 PCR amplification system

[0170]

[0171] Table 19 PCR amplification procedure

[0172]

[0173] (3) Fluorescence detection: Use real-time fluorescence quantitative PCR system to detect fluorescence signal to determine the genotype of each strain, and export the genotyping results through Launch Kluster Caller software;

[0174] (4) Phenotype test: Perform correlation analysis on the genotyping data and the greenhouse phenotype identification results in the spring of 2021 by SPSS software (version 26) to determine the relevance of SNP sites and wheat scab resistance and test the reliability of the positioning interval.

[0175] The results show that the KASP molecular marker from the scab resistance QTL Qfhb.sdau-6BL in the interval has good genotyping effect (Table 20, KASP- QFhb.sdau-6B.14 According to the correlation analysis of KASP detection results and phenotypic traits, it is found that the phenotypic traits are extremely significantly different between different genotypes in the population Figure 6 (0.01). The SNP site of the KASP molecular marker P< KASP- QFhb.sdau-6B.14 The base variation of the SNP site is C / T variation, and the scab resistance of wheat materials containing TT base is better than that of wheat materials containing CC base (Table 21). The genotyping results fully demonstrate the reliability of the KASP molecular marker, which has high correlation with scab resistance, and the KASP molecular marker can be applied to molecular marker-assisted selection breeding.

[0176] Table 20 Correlation test of KASP primers

[0177]

[0178] Note: ** at the 0.01 level (two-tailed), the correlation is significant.

[0179] Table 21 SNP base variation in disease-resistant and disease-susceptible materials

[0180]

[0181] Example 4 Marker verification

[0182] Test materials: 12 wheat lines from the research group of the present application. In 2022-2023, they were planted in the agronomy test field of Shandong Agricultural University, 4 rows per line, row length 1.2 meters, row width 25 cm, 40 grains per row; 3 times of repetition. After heading, the flowering period was closely investigated; single flower dripping identification was performed on the small ears that just started to bloom. The identification method and resistance investigation and evaluation method are the same as in Example 1.​

[0183] Table 22 Disease resistance survey of wheat lines

[0184]

[0185] In combination with the scab resistance survey following single flowered infestation (Table 22), it was found that KASP-QFhb.sdau-6B.14 The molecular marker genotyping was in agreement with the scab phenotype ( Figure 7 ), and therefore, this KASP molecular marker can be used for molecular assisted selection of wheat scab resistant varieties.

Claims

1. A KASP molecular marker for a wheat scab resistance QTL characterized in that, Qfhb.sdau-6BL The nucleotide sequence of the KASP molecular marker is shown as SEQ ID NO. 4 or SEQ ID NO.

5. ​ 2. A wheat scab resistance QTL Qfhb.sdau-6BL of primer of KASP molecular marker of the QTL, characterized in that, The primer comprises two forward primers, the nucleotide sequences of which are shown as SEQ ID NO. 1 and SEQ ID NO. 2, and one reverse universal primer, the nucleotide sequence of which is shown as SEQ ID NO.

3.

3. The primer of the KASP molecular marker of claim 2, wherein, The two forward primer sequences are respectively added with different fluorescent detection sequences in front.

4. The primer of the KASP molecular marker of claim 3, wherein, The fluorescent detection sequences are FAM sequence and HEX sequence respectively.

5. A method of genotyping a wheat scab resistance QTL Qfhb.sdau-6BL characterized in that, Genomic DNA of wheat is extracted, and PCR amplification is carried out using the primers shown as SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3, and genotyping is determined after fluorescence detection.

6. A genotyping product for a wheat scab resistance QTL Qfhb.sdau-6BL characterized in that, The detection reagent comprises the primer of the KASP molecular marker according to any one of claims 2-4.

7. The genotyping product of claim 6, wherein, The detection reagent comprises the primer of the KASP molecular marker according to any one of claims 2-4.

8. The wheat scab resistance QTL of claim 1 Qfhb.sdau-6BL use of the detection reagent of the KASP molecular marker of the wheat scab resistance QTL of claim 1 in any one of: (1) identifying or assisting in identifying the resistance of wheat to scab; (2) preparing a product for identifying or assisting in identifying the resistance of wheat to scab; (3) comparing the scab resistance of the wheat grains to be tested; (4) breeding or screening wheat lines or strains with relatively strong scab resistance; (5) breeding or screening wheat lines or strains with relatively weak scab resistance; (6) preparing a product for screening or comparing the scab resistance of wheat to be tested.

9. Use according to claim 8, wherein the compound is ###0002### The detection reagent of the KASP molecular marker comprises the primer of the KASP molecular marker according to any one of claims 2-4. The detection reagent of the KASP molecular marker comprises the primer of the KASP molecular marker according to any one of claims 2-4.

Images