Fat lipid markers in different parts of pigs and their application in regulating pig fat deposition

Abstract

The present invention relates to the field of animal breeding technology, and in particular to fat lipid markers of different parts of pigs and their application in regulating pig fat deposition. The application includes: regulating the fat deposition level of pigs by adjusting the expression level of genes for the synthesis of monosialoganglioside and acetal phosphatidylethanolamine. The fat lipid markers of different parts of pigs provided by the present invention and their application can be used to improve pork quality and cultivate pig breeds with higher production efficiency and pork quality, which is of great significance in the field of pig production and breeding.

Description

Technical Field

[0001] The invention relates to the technical field of animal breeding, and in particular to fat lipid markers in different parts of pigs and applications thereof in regulating pig fat deposition. Background Art

[0002] Pigs are one of the animals that are most likely to deposit fat, especially Chinese local pig breeds, which have a very strong ability to deposit fat. Fat deposition is one of the most important economic traits of pigs and is a typical complex quantitative trait. Fat deposition in different parts has different effects on pork quality and growth efficiency. For example, subcutaneous fat and visceral fat deposition significantly reduce production efficiency, but intermuscular fat and intramuscular fat deposition can improve meat quality. However, subcutaneous fat, visceral fat and intramuscular fat deposition are coordinated depositions, that is, reducing back fat thickness and visceral fat deposition will also reduce intramuscular fat deposition.

[0003] How to selectively reduce subcutaneous and visceral fat deposition without affecting intramuscular fat deposition has always been one of the main goals of pig breeding. Therefore, exploring the key genes involved in regulating fat deposition in different parts of the body is the primary goal of precise fat reduction. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the present invention provides lipid markers of fat in different parts of pigs and applications thereof in regulating pig fat deposition.

[0005] In a first aspect, the present invention provides the use of monosialoganglioside or acetal phosphatidylethanolamine as a marker of pig fat type.

[0006] The present invention further provides the use of monosialoganglioside, or acetal phosphatidylethanolamine, or monosialoganglioside synthase in any of the following:

[0007] i) Identification of pig fat types;

[0008] ii) regulating the fat deposition efficiency of pigs;

[0009] iii) Regulate pork quality and growth efficiency of pigs.

[0010] Furthermore, the regulation of the fat deposition efficiency of the pig includes: reducing the thickness of the pig back fat, reducing the subcutaneous fat rate, reducing the visceral fat rate, increasing the intramuscular fat rate or increasing the intermuscular fat rate or one or more of the following.

[0011] In a second aspect, the present invention provides the use of ST3GAL5 gene or FAR1 gene in regulating fat deposition efficiency in pigs.

[0012] The present invention further provides the use of ST3GAL5 gene or FAR1 gene in whole genome selection of pigs or breeding of transgenic pigs.

[0013] Furthermore, the Ensembl number of the ST3GAL5 gene is ENSSSCG00000008227; the Ensembl number of the FAR1 gene is ENSSSCG00000021170.

[0014] In a third aspect, the present invention provides a method for regulating the fat deposition rate of pigs, comprising: regulating the expression level of the ST3GAL5 gene or the FAR1 gene to further regulate the fat deposition rate of pigs.

[0015] Furthermore, the Ensembl number of the ST3GAL5 gene is ENSSSCG00000008227; the Ensembl number of the FAR1 gene is ENSSSCG00000021170.

[0016] Furthermore, the fat deposition efficiency of pigs is reduced by increasing the expression level of the ST3GAL5 gene and / or reducing the expression level of the FAR1 gene.

[0017] Furthermore, the pigs include: one or more of Landrace pigs, Large White pigs, Duroc pigs, Bama pigs, Rongchang pigs, Northeast Min pigs, Guangdong and Guangxi Xiaohua pigs, Neijiang pigs, Ningxiang pigs, Jinhua Liangtouwu pigs, Taihu pigs, Chenghua pigs, Tibetan pigs, Laiwu pigs or Duroc-Changda three-way hybrid commercial pigs.

[0018] The present invention has the following beneficial effects:

[0019] The present invention obtains two pig lipid markers, monosialoganglioside and acetal phosphatidylethanolamine, by differential lipid screening of different fat tissue samples of pigs. These two markers show obvious level differences in different types of lipids. The present invention further provides the use of synthetic genes of these two markers in regulating the fat deposition efficiency of pigs. The fat deposition efficiency of pigs is regulated by ST3GAL5 gene and FAR1 gene, and breeds with excellent pork quality traits are cultivated, which is of great significance in the pig breeding industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 11 is a schematic diagram of the differential lipid screening results of different adipose tissue samples provided in Example 1 of the present invention; wherein A is a heat map of 9 adipose tissues at the levels of 4 major lipid classes; B is a heat map of 9 adipose tissues at the levels of 30 subclasses of lipids; C is a heat map of P values ​​obtained by comparing the 9 adipose tissues pairwise, wherein the significance is P-value<0.05, and only significant p values ​​are displayed; D is the content of lipids in the GM3 synthesis pathway in the three adipose tissues of ULB, ILB and IWAT.

[0022] Figure 2 It is a schematic diagram of the screening results of differential lipids in subcutaneous fat and visceral fat tissue provided in Example 1 of the present invention; wherein A is the differential lipids in subcutaneous fat and visceral fat tissue at the level of 30 subcategories, with P-value<0.05 as the screening criterion; B is a heat map of the content of differential lipids obtained by A screening in 9 types of fat tissues; C is a lipid volcano map of subcutaneous fat and visceral fat tissue at the level of 422 lipids, with P-value<0.05 and fold change (FC)>2 as the screening criteria; D and E are heat maps of the content of differential up-regulated lipids (D) and differential down-regulated lipids (E) in subcutaneous fat and visceral fat tissue obtained by screening from C.

[0023] Figure 3 : This is a diagram of the effect of interfering with the ST3GAL5 gene on pre-adipocyte proliferation and lipid deposition provided in Example 2 of the present invention; wherein A is the GM3 synthesis pathway and its regulatory genes; B is the expression changes of each gene in the GM3 synthesis pathway in ULB, ILB and IWAT tissues; C is a schematic diagram of cell differentiation and interference experiments; D is the expression changes of each gene in the GM3 synthesis pathway during the differentiation of SVF in vitro to mature adipocytes; E is the Oil Red O staining of differentiated mature adipocytes of the siST3GAL5 and siNC groups; F is the quantitative result of E; G is the ST3GAL5, fat regulatory transcription factor PPARγ, lipid deposition regulatory genes ACACA and FASN of the siST3GAL5 and siNC groups mRNA expression; H is a schematic diagram of cell proliferation EdU and interference experiments; I is a display of cell proliferation EdU and DAPI staining in the siST3GAL5 and siNC groups; J is a statistical graph of the percentage of I-positive EdU cells; K is the expression of ST3GAL5, cell proliferation marker gene PCNA, and fat-regulating transcription factors C / EBPα and PPARγ mRNA in the siST3GAL5 and siNC groups differentiated for 2 days.

[0024] Figure 4: This is a diagram of the effect of interfering with the FAR1 gene on pre-adipocyte proliferation and lipid deposition provided in Example 2 of the present invention; wherein A is the expression changes of each gene in the pPE synthesis pathway in subcutaneous adipose tissue (SAT) and visceral adipose tissue (VAT); B is the expression changes of each gene in the pPE synthesis pathway during the differentiation of SVF into mature adipocytes in vitro; C is the detection result of siFAR1 interference efficiency; D is the Oil Red O staining diagram of siFAR1 and siNC groups differentiated into mature adipocytes; E is the quantitative result of D; F is the mRNA expression of FAR1, fat regulatory transcription factor PPARγ, lipid deposition gene ACACA and SCD in siFAR1 and siNC groups; G is the EdU and DAPI staining display diagram of cell proliferation in siFAR1 and siNC groups; H is a statistical diagram of the proportion of positive EdU cells in J; I is the mRNA expression of FAR1, cell proliferation marker gene PCNA, fat regulatory transcription factor C / EBPα and PPARγ in siFAR1 and siNC groups differentiated for 2 days. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0026] Unless otherwise specified, the experimental methods involved in the following embodiments can be implemented using conventional methods in the art.

[0027] Unless otherwise specified, the experimental materials involved in the following examples can be purchased commercially.

[0028] In the following examples, the Ensembl number of the ST3GAL5 gene is ENSSSCG00000008227; the Ensembl number of the FAR1 gene is ENSSSCG00000021170.

[0029] Example 1

[0030] 1. Based on three 6-month-old Laiwu pigs, the present invention used targeted lipidomics to detect 9 types of adipose tissue (superficial backfat ULB, deep backfat ILB, inguinal subcutaneous fat IWAT, intermuscular fat IAD, pericardial fat PAD, greater omental fat GOM, mesenteric fat MAD, perirenal fat RAD, and suet PF). Figure 1 A), 30 subclasses ( Figure 1 B) lipid levels using P-value<0.05 ( Figure 1 C) for differential lipid screening. The detection method is as follows:

[0031] The adipose tissue samples were extracted, and then analyzed by liquid chromatography-mass spectrometry. Finally, the peak graph was extracted and corrected with standard substances to identify the absolute abundance of lipids. The screened monosialogangliosides (GM3) were further detected by multiple reaction monitoring (MRM) targeted determination.

[0032] Get as Figure 1 The results shown in D in the figure: In the subcutaneous adipose tissue, the content of sialoganglioside in the deep backfat adipose tissue (ILB) was significantly higher than that in the superficial backfat (ULB) and inguinal subcutaneous adipose tissue (IWAT). Therefore, GM3 can be used as a lipid marker to identify ULB, ILB and IWAT.

[0033] 2. The present invention further analyzes subcutaneous adipose tissue (including superficial back fat ULB, deep back fat ILB, inguinal subcutaneous fat IWAT, intermuscular fat IAD) and visceral adipose tissue (including greater omental fat GOM, mesenteric fat MAD, perirenal fat RAD, suet PF) in 4 categories and 30 subcategories ( Figure 2 A and B) and 422 lipid species levels ( Figure 2 In step C), differential lipids were screened using P-value < 0.05 and fold change (FC) > 2. The lipid detection method was the same as the detection process in step 1.

[0034] Get as Figure 2 The results shown in D and E in the figure show that compared with subcutaneous adipose tissue (SAT), the significantly upregulated lipids in visceral adipose tissue (VAT) are all plasmalogen PE (pPE). Therefore, pPE can be used as a lipid marker to distinguish subcutaneous fat from visceral fat.

[0035] Example 2

[0036] This example further studies the effects of ST3GAL5 and FAR1, the key genes responsible for the synthesis of GM3 and pPE, on pig fat deposition, as follows:

[0037] 1. The present invention first analyzed the molecular mechanism of high GM3 in ILB, and then used RNA interference technology to reduce the expression of ST3GAL5, a key gene responsible for the synthesis of GM3, during the differentiation of vascular stromal cells (SVF) isolated from pig subcutaneous fat into white fat, in order to detect its effect on pig fat deposition.

[0038] RNA interference uses the traditional small RNA interference method, and siRNA is delivered into cells using liposome transfection. The specific siRNA sequences used are as follows:

[0039] Table 1 siRNA sequences of ST3GAL5 gene

[0040]

[0041] The conventional phenol-chloroform extraction method was used for RNA extraction from adipose tissue and cells, and the concentration was determined and reverse transcribed using conventional methods. The conventional QPCR method was used for quantification of the ST3GAL5 gene, and the primers used were as follows:

[0042] ST3GAL5-Pig-QCR-F:AGCCCAGAGCAAGATGAGAA,

[0043] ST3GAL5-Pig-QCR-R:GGGCGTATTTCTGTGCTCTC.

[0044] The results showed that the GM3 synthesis pathway ( Figure 3 The expression levels of B4GALT5 / 6 and ST3GAL5 genes in ILB were significantly higher than those in ULB and IWAT, indicating that the high content of GM3 in ILB is caused by its high GM3 synthesis pathway activity ( Figure 3 B).

[0045] In order to further verify the role of ST3GAL5 gene in pig fat deposition, the present invention further detected the expression changes of GM3 synthesis pathway related genes during SVF cell adipogenesis in vitro, and found that GM3 synthesis pathway related genes were highly expressed in the early stage of adipogenesis in vitro ( Figure 3 C and D in the figure), while the expression level decreased in the later stage, suggesting that the GM3 synthesis pathway may play a role in promoting the proliferation or differentiation of preadipocytes.

[0046] To further verify the effect of GM3 on pig fat deposition, the present invention designed ST3GAL5 interfering RNA ( Figure 3 C), the results showed that siST3GAL5-treated cells significantly reduced ST3GAL5 gene expression, indicating successful interference ( Figure 3 At the same time, the results of Oil Red O and QPCR showed that the adipogenesis efficiency was significantly increased after interfering with the ST3GAL5 gene ( Figure 3 E and F in Figure 3) and the expression levels of key genes for lipid deposition (including PPARγ, ACACA and FASN) ( Figure 3 G in.

[0047] In order to verify its effect on the proliferation or differentiation of preadipocytes, the present invention used EdU staining to detect the proliferation efficiency and differentiation efficiency of cells in the siST3GAL5 group and the siNC group (transfection control group interference RNA, sequence shown in Table 1) Figure 3 The results showed that siST3GAL5 treatment significantly increased the proliferation efficiency of preadipocytes ( Figure 3 I and J in Figure 3) and the expression of key transcription factors for adipogenic differentiation (including PPARγ, CEBP / α, and PCNA) ( Figure 3 The above results indicate that the ST3GAL5 gene plays an important regulatory role in pig adipocyte adipogenesis by negatively regulating the clonal proliferation and adipogenic differentiation of preadipocytes, and can be used as a molecular target for specifically regulating pig backfat thickness for breeding lean pig breeds.

[0048] 2. The present invention further analyzes the molecular mechanism of high pPE specifically in visceral adipose tissue, and then uses RNA interference technology to interfere with FAR1, the rate-limiting enzyme encoding pPE synthesis, during the differentiation process of vascular stromal cells (SVF) isolated from pig subcutaneous fat into white fat, in order to detect its effect on pig fat deposition.

[0049] RNA interference uses the traditional small RNA interference method, and siRNA is delivered into cells using liposome transfection. The specific siRNA sequences used are as follows:

[0050] Table 2 siRNA sequences of FAR1 gene

[0051]

[0052] The conventional phenol-chloroform extraction method was used for adipose tissue and cell RNA extraction, and the concentration was determined and reverse transcription was performed using conventional methods. The conventional QPCR method was used for FAR1 gene quantification, and the primers used were as follows:

[0053] Pig-QPCR-FAR1-F:AACCCACAACCTCATGGTTC,

[0054] Pig-QPCR-FAR1-R:CTTTCTGTCGCACCAAAACA.

[0055] The results showed that the expression of genes in the pPE synthesis pathway of visceral adipose tissue was inconsistent with its pPE content ( Figure 4 A in the figure suggests that pPE synthesis may be in the early stage of adipocyte differentiation in visceral adipose tissue. This is consistent with the fact that during the in vitro differentiation of SVF cells into mature adipocytes, the FAR1 gene is highly expressed in the early stage of adipogenesis, while the expression level decreases in the later stage ( Figure 4B) The high expression of FAR1 gene in the pre-adipogenic stage suggests that it may play an important role in promoting the proliferation or differentiation of preadipocytes.

[0056] To further verify the effect of pPE on pig fat deposition, the present invention designed FAR1 interfering RNA. The results showed that siFAR1-treated cells significantly reduced the expression of FAR1 gene, indicating that the interference was successful ( Figure 4 C and F in ).

[0057] At the same time, the results of Oil Red O and QPCR showed that interference with the FAR1 gene significantly reduced the adipogenesis efficiency ( Figure 4 D and E in Figure 3) and the expression of key genes for lipid deposition (including PPARγ, ACACA, and SCD) ( Figure 4 F).

[0058] In order to verify its effect on the proliferation or differentiation of preadipocytes, the present invention uses EdU staining to detect the proliferation efficiency and differentiation efficiency of cells in the siFAR1 group and the siNC group.

[0059] The results showed that siFAR1 treatment significantly reduced the proliferation efficiency of preadipocytes ( Figure 4 G and H in the mitochondria) and the expression of key transcription factors regulating adipogenesis (including PPARγ, CEBP / α and PCNA) ( Figure 4 The above results indicate that the FAR1 gene plays an important role in regulating the adipogenesis of pig adipocytes by regulating the clonal proliferation and adipogenic differentiation of preadipocytes, and can be used as a molecular target for the specific regulation of pig visceral fat deposition for pig breed breeding.

[0060] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of monosialoganglioside or acetal phosphatidylethanolamine as a marker of pig fat type, characterized in that: Monosialoganglioside was used as a marker to distinguish deep backfat adipose tissue from superficial backfat, and acetal phosphatidylethanolamine was used as a marker to distinguish visceral adipose tissue from subcutaneous adipose tissue.

2. The use of monosialoganglioside or acetal phosphatidylethanolamine in identifying the type of pig fat, characterized in that: Monosialoganglioside was used to differentiate deep backfat adipose tissue from superficial backfat, and acetalphosphatidylethanolamine was used to differentiate visceral adipose tissue from subcutaneous adipose tissue.

Images