GS1 gene capable of synergistically improving rice yield and rice taste quality and application thereof

Abstract

The invention relates to an application of a GS1 gene in changing rice grain shape, increasing rice yield and / or improving rice taste quality in rice breeding, and a dominant GS1 gene capable of synergistically increasing rice yield and rice taste quality, a CDS sequence is shown as SEQ ID NO: 1, or a coded amino acid sequence is shown as SEQ ID NO: 2. A new gene GS1 for controlling the rice grain shape is cloned through a forward genetics method, the GS1 gene is disclosed for the first time to increase the rice yield and improve the rice quality character at the same time, and a new method and path are provided for rice breeding.

Description

Technical Field

[0001] This invention belongs to the field of rice molecular breeding, specifically involving the GS1 gene and its application, which can synergistically improve rice yield and rice eating quality. Background Technology

[0002] Rice is an important staple crop. Rice yield traits are complex quantitative traits controlled by multiple factors and genes. Grain weight is a crucial factor affecting rice yield, controlled by grain shape, which includes grain length, width, thickness, and length-to-width ratio. Grain shape not only affects rice yield but also determines rice quality. Social development and improved living standards continuously drive people to demand higher rice quality. Rice quality determines consumer acceptance and influences its economic value in the market. According to national standards, rice quality mainly includes appearance, processing, cooking taste, and nutritional quality. The appearance quality of rice is closely related to its processing, cooking taste, and nutritional quality. Moreover, the appearance quality of rice directly affects consumer purchasing desire and commercial value. Evaluation indicators for appearance quality mainly include grain shape, chalkiness, and transparency.

[0003] The conflict between rice yield and rice quality is a significant challenge that needs to be addressed in rice breeding. Most grain shape genes (such as...) GW2 , GS2 and GW5 While increasing rice yield, these methods often lead to a decline in the appearance or taste quality of the rice.

[0004] Therefore, it is necessary to find a gene that can synergistically improve rice yield and rice taste quality. Summary of the Invention

[0005] We examined the Guangzhan 63-4S / W240 BC1F2 and BC1F strains, which use Guangzhan 63-4S as the maternal parent and W240 as the paternal parent. 2:3 Genetic linkage maps were constructed using the grain length and width phenotypes of the population, combined with polymorphic markers from the BC1F2 population. A total of 11 quantitative trait loci (QTLs) affecting grain length and 5 QTLs affecting grain width were detected. Among these, the QTLs located on chromosome 1... qGL1 The loci were detected in both years and explained the highest rate of phenotypic variation. Effect validation results showed that... qGL1 It is an incompletely dominant locus and can simultaneously affect rice grain length and thousand-grain weight. The frequency distribution histogram shows... qGL1 The grain length and thousand-grain weight phenotypes of the two near-isogenous lines can be well distinguished.

[0006] use qGL1 Recombinant plants were screened using molecular markers flanking the loci, and the phenotypes of grain length in the contemporary and progeny generations of the recombinant plants were examined. Ultimately, [the following was determined]. qGL1The region was precisely mapped to a 22.1 kb segment. Referring to the annotation information of the Nipponbare genome (http: / / rice.uga.edu / ), we found that this region contains two open reading frames: ORF1 and ORF2. Comparative sequencing results showed that both open reading frames had variations in their respective promoters, 5'UTRs, exons, and introns. CRISPR knockout experiments confirmed that ORF1 was... qGL1 The target gene was named GS1 .

[0007] right GS1 Functional verification of the gene showed that it is a pleiotropic gene, which not only affects heading date, grain length, thousand-grain weight, plant height, number of effective panicles, number of filled grains per panicle and yield, but also affects the total protein content, gluten content and eating value of polished rice.

[0008] Based on the above research, the present invention provides GS1 Application of genes in rice breeding.

[0009] In one specific implementation scheme, the GS1 Genes are used to alter rice grain shape, increase rice yield, and / or improve the eating quality of rice. The present invention also provides an advantage GS1 The gene, CDS sequence as shown in SEQ ID NO:1, or the encoded amino acid sequence as shown in SEQ ID NO:2.

[0010] In one specific implementation scheme, the GS1 The dominant allele of the gene is derived from the widely prevalent 63-4S. GS1 Gene, or its equivalent gene (e.g., in other rice lines, the sequence is similar to the widely prevalent 63-4S). GS1 Same genes GS1 Gene).

[0011] The present invention also provides a method for altering rice grain shape, comprising overexpressing in rice GS1 The steps of gene generation.

[0012] This invention also provides a breeding method for synergistically improving rice yield and eating quality, including... GS1 The steps for introducing the dominant allele of a gene into rice.

[0013] In one specific implementation, the method includes the following steps: S1: containing GS1 Rice with the dominant allele of the gene as a donor and without the aforementioned GS1 Rice with the dominant allele of the gene was used as the recipient for hybridization and multiple generations of backcrossing; S2: In the aforementioned hybridization and backcrossing process, utilizing... GS1 Selective use of tightly linked molecular markers containing the aforementioned GS1 Plants with dominant alleles of genes; S3: Screening for rice varieties with the genetic background of the recipient rice and containing the genetic characteristics of the recipient rice in a multi-generation backcross population. GS1 Plants with the dominant allele of the gene.

[0014] In one specific implementation, the recipient may be a rice sterile line, restorer line, or conventional variety.

[0015] In one specific implementation scheme, the GS1 The CDS sequence of the dominant allele of the gene is shown in SEQ ID NO:1, or the encoded amino acid sequence is shown in SEQ ID NO:2.

[0016] In one specific implementation scheme, the GS1 The dominant allele of the gene is derived from the widely prevalent 63-4S. GS1 Gene, or its equivalent gene (e.g., in other rice lines, the sequence is similar to the widely prevalent 63-4S). GS1 Same genes GS1 Gene).

[0017] This invention cloned a novel gene controlling rice grain shape using forward genetics. GS1 For the first time, it was made public. GS1 Genes can simultaneously increase rice yield and improve rice quality traits, providing new methods and pathways for rice breeding. Attached Figure Description

[0018] Figure 1 For BC1F2 and BC1F 2:3 Initial QTL localization results for population particle shape.

[0019] Figure 2 In the BC1F5 group GS1 Statistical graphs of grain length (A) and thousand-grain weight (B) for materials with different genotypes; Figure 3 In the BC1F5 group GS1 Histograms showing the frequency distribution of grain length (A) and thousand-grain weight (B) for materials of different genotypes; Figure 4 for GS1 Map-based cloning of genes; Figure 5 for GS1 Comparative sequencing analysis of candidate gene regions: A is the sequence variation of the first open reading frame region, and B is the sequence variation of the second open reading frame region. Figure 6To verify the function of the CRISPR knockout transgene of the ORF1 gene, A is a plant of the mutant under the NIL-W background, B is a seed of the mutant under the NIL-W background, C is the heading date of the mutant under the NIL-W background, D is the grain length of the mutant under the NIL-W background, E is a plant of the mutant under the NIL-G background, F is a seed of the mutant under the NIL-G background, G is the heading date of the mutant under the NIL-G background, and H is the grain length of the mutant under the NIL-G background. Figure 7 To verify the function of the CRISPR knockout transgene of the ORF2 gene, A is the heading date of the knockout material, B is the seed of the mutant and wild-type materials, and C is the grain length of the knockout material. Figure 8 for GS1 To verify the function of complementary transgenic materials, A is a plant of complementary material under the NIL-G background, B is a seed of complementary positive material, C is the heading stage of complementary positive material, and D is the grain length of complementary positive material. Figure 9 for GS1 Overexpression transgene function verification: A is the plant of the overexpression material under the NIL-W background, B is the heading date of the overexpression material under the NIL-W background, C is the grain length of the overexpression material under the NIL-W background, D is the plant of the overexpression material under the NIL-G background, E is the heading date of the overexpression material under the NIL-G background, and F is the grain length of the overexpression material under the NIL-G background. Figure 10 for GS1 Photographs of plant type (AB), grain length (C), and grain width (D) among near-isogenic lines; Figure 11 for GS1 Statistical graphs of grain length (A), grain width (B), length-to-width ratio (C), thousand-grain weight (D), plant height (E), number of effective panicles (F), number of filled grains per panicle (G), yield per plant (H), and heading date (I) among near-isogenic lines; Figure 12 for GS1 Statistical graph of total protein (A), albumin (B), globulin (C), prolysin (D), glutenin (E), total starch (F), amylose (G), gel consistency (H) and taste value (I) among near-isogenic lines. Detailed Implementation

[0020] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0021] 1. Source of materials The BC1F2 and BC1F used in this invention 2:3The genetic mapping population was derived from two parental materials, Guangzhan 63-4S and W240. Guangzhan 63-4S (GZ63-4S, the recurrent parent) was jointly bred by the Northern Hybrid Japonica Rice Research Center and the Hefei Fengle Seed Industry Rice Research Institute, and is an indica-type photoperiod-temperature-sensitive genic male-sterile line. W240 (the donor parent) is an indica-type variety from 533 core germplasm resources collected by Huazhong Agricultural University; compared to Guangzhan 63-4S, its grains are larger. Early preliminary mapping identified BC1F2 and BC1F... 2:3 The rice population grew normally in summer at the Huazhong Agricultural University Rice Experimental Base in Wuhan, Hubei Province.

[0022] Using BC1F4 and BC1F5 random population pairs qGL1 Effect verification was performed using contemporary BC1F6 recombinant single plants and progeny of BC1F7 recombinant single plants for fine mapping. In BC1F... 2:3 In the genetic mapping population, selection qGL1 Materials flanking heterozygous markers and with all other markers homozygous were used to construct near-isogenic lines through continuous self-crossing. These lines included NIL-G from the GZ63-4S allele and NIL-W from the W240 allele. The mutant family KO-G was obtained using NIL-G as the material, and KO-W was obtained using NIL-W as the material, through gene editing using CRISPR / Cas9 technology. The complementary family CO was obtained through transgenic complementation experiments using NIL-G as the recipient. The overexpression families OE-G and OE-W were obtained through transgenic overexpression experiments using NIL-G and NIL-W materials, respectively. Transgenic phenotypes were collected from the T1 generation. All materials were grown normally in the transgenic experimental field of Huazhong Agricultural University in Wuhan during the summer.

[0023] Harvest mature seeds, dry them for 2-3 days, and then store them at room temperature for at least 3 months before using them in experiments.

[0024] 2. Linkage analysis of grain shape and GS1 fine positioning Genotyping of 327 BC1F2 strains was performed using 177 pairs of polymorphic molecular markers covering the entire genome (including SSR, Indel, and KASP markers). The genotypes of BC1F2 and BC1F2 strains were combined. 2:3 The grain length and grain width phenotypes of the population were analyzed. Genetic linkage maps were constructed using Mapmaker / Exp 3.0 software. Linkage analysis was performed using the composite interval plotting method in WinQTLCart 2.5. Linkage plotting of the WinQTLCart output results was performed using PowerPoint software. Figure 1 A total of 11 QTLs affecting granule length and 5 QTLs affecting granule width were detected, among which the QTLs located on chromosome 1 were... qGL1 The site effect is the largest and most stable.

[0025] To verify qGL1 Due to the genetic effects, we selected BC1F 2:3 A randomized population of BC1F5 was constructed in 2018, consisting of individuals with heterozygous target region and homozygous regions for all other molecular markers. Genotypes of the BC1F5 materials were identified using molecular markers flanking the target region, and grain length, grain width, and thousand-grain weight phenotypes were examined. Grain length and thousand-grain weight were significantly higher in the NIL-W material than in the NIL-G material. Figure 2 Furthermore, the frequency distribution histograms of grain length and thousand-grain weight show that the grain length and thousand-grain weight phenotypes from NIL-W and NIL-G materials can be well distinguished. Figure 3 We also found that hybridization qGL1 The grain length and thousand-grain weight of the allelic material (NIL-H) were between those of the homozygous genotypes, indicating that... qGL1 It is an incompletely dominant site and can affect both grain length and thousand-grain weight simultaneously.

[0026] exist qGL1 In the process of fine-tuning, we developed a randomized population of BC1F6 containing 6,027 individual plants in the field in Wuhan in 2019, utilizing... qGL1 Recombinant single plants were screened using molecular markers at both ends. A total of 258 recombinant single plants were ultimately screened. Progeny testing was then performed on the genotypes and grain lengths of the progeny from each family. We ultimately selected... qGL1 The precise location was determined between markers Z14 and Z20, with a range size of 22.1 kb. Figure 4 ).

[0027] 3. GS1 Comparative sequencing analysis of candidate regions Sequencing primer pairs were designed based on the Nipponbare reference genome sequence. qGL1 The 22.1kb region of NIL-W and NIL-G materials was sequenced comparatively. Sequence alignment of the genomic DNA and CDS sequences of the two open reading frames (ORFs) was performed using Seqman and MegAlign software in LaserGene. We found variations in the promoters, 5' UTRs, exons, and introns of both ORFs. Based on this analysis, we believe that ORF1 (… LOC_Os01g11940 (Encoding a floridin-like protein) is more likely to be qGL1 Candidate genes ( Figure 5 ).

[0028] 4. GS1 Genetic transformation and functional verification In order to determine GS1For the target genes, we constructed knockout (KO) vectors for ORF1 and ORF2, respectively. We designed the sequence in exon 4 of ORF1 (GCGGCACACGGTGTACGCAC in NIL-W and GCGGCAGACGGTGTACGCAC in NIL-G) as the target site for sgRNA, and used the CRISPR-Cas9 system to edit the ORF1 gene in both NIL-W and NIL-G backgrounds. Field observation of heading phenotypes revealed that the heading date of the mutant materials was delayed by approximately 45 days compared to their respective wild types, and the seeds also exhibited malformed phenotypes, ultimately leading to reduced grain length. Figure 6 ).

[0029] We designed the sequence (ACTGCACAAGTTCCACAACA) in exon 10 of ORF2 as the target site for sgRNA and performed gene editing on ORF2 in a NIL-W background. Phenotypic examination revealed that the heading date and grain length of the mutant material were similar to those of the wild type. Figure 7 ).

[0030] We transferred NIL-W-derived cells into a NIL-G genetic background. GS1 , constructed GS1 The complementary materials were named CO-1 to CO-6. Phenotypic results showed that the complementary positive materials with an earlier heading date of about 20 days exhibited excessively rapid vegetative growth, which affected normal flower development and resulted in reduced grain length; while the materials with an earlier heading date of about one week showed normal flower development and increased grain length. Figure 8 ).

[0031] We overexpressed NIL-W and NIL-G genetic backgrounds, respectively. GS1 Overexpressing plants from OE-W1 to OE-W6 and OE-G1 to OE-G6 were obtained. Phenotypic results showed that materials with an earlier heading date of about 20 days had reduced grain length due to excessively rapid vegetative growth affecting normal flower development; while materials with an earlier heading date of about one week had normal flower development and increased grain length. Figure 9 ).

[0032] In summary, the knockout, complementation, and overexpression transgenic experiments validated... GS1 These are functional genes that can simultaneously regulate heading time and grain shape because they are crucial to flower development and thus affect rice grain size. They are located in ORF1 (…). LOC_Os01g11940 ).

[0033] By analyzing the 533 core germplasm resources GS1 There are five main alleles, Hap1 to Hap5. The breeding-disadvantaged allele is NIL-W. GS1(The CDS sequence is shown in SEQ ID NO:3, and the encoded protein sequence is shown in SEQ ID NO:4.) It belongs to Hap1, and the breeding advantage allele is NIL-G. GS1 (The CDS sequence is shown in SEQ ID NO:1, and the encoded protein sequence is shown in SEQ ID NO:2) belongs to Hap2. The breeding advantage allele NIL-G... GS1 Introduced into the male-sterile or restorer lines of hybrid rice to be improved, it provides new genetic tools and breeding strategies for the genetic improvement of high-yield and high-quality rice varieties.

[0034] GS1 Includes two alleles, NIL-G GS1 and NIL-W GS1 .

[0035] 5. Phenotypic Examination The determination method is as follows: 1) Determination of particle shape and particle weight: Grain length, grain width, and thousand-grain weight were measured using a digital seed testing machine jointly developed by the National Key Laboratory of Crop Improvement of Huazhong Agricultural University and the Optoelectronic Laboratory of Huazhong University of Science and Technology. Approximately 500 plump seeds from each package were placed in the seed testing machine to directly obtain phenotypic data on grain length, grain width, and thousand-grain weight.

[0036] 2) Determination of yield-related traits: Heading period observation: Starting from the sowing time, when the main ear in the material heads out, the date of heading is recorded. The data is investigated and recorded once every 3 days. The heading period is the difference between the heading date and the sowing date for each individual plant. 20 plants are measured for each family.

[0037] Plant height assessment: After the rice matures, the distance from the ground to the top of the main panicle is measured using a measuring rod to determine the plant height. 20 plants are measured for each family.

[0038] Examination of effective ear number: After the seeds mature, all plants with straw are cut down and put into mesh bags. The number of ears that produce fruit on each plant is recorded, which is the effective tiller number per plant, or effective ear number.

[0039] The number of grains per ear was determined by scanning the individual plant after threshing using a digital seed testing machine. The number of grains per ear was the ratio of the total number of grains per plant to the number of effective ears.

[0040] Assessment of yield per plant: The weight of the grains obtained by weighing the individual plant after threshing is the yield per plant.

[0041] 3) Determination of quality-related traits: Starch content determination: The starch content measured in this experiment includes total starch content and amylose content. Refined rice flour was boiled in dilute hydrochloric acid to decompose it. After boiling for 15 minutes, the sample was cooled to room temperature, and potassium ferrocyanide and zinc acetate solutions were added. The optical rotation was directly obtained using a polarimeter, and the total starch content could be calculated. Amylose content was determined by utilizing the difference in iodine-binding capacity of amylose. The absorbance was measured using a TECAN Infinite M200 multi-functional microplate reader at OD 620 nm. The amylose content of each sample was calculated based on a linear equation between the absorbance of the standard sample and the amylose content. Three biological replicates were set up for each sample.

[0042] Determination of storage protein content: The content of albumin, globulin, prolamins, glutenin, and total storage proteins was determined based on their differences in solution under the corresponding reagents. Four storage proteins were extracted using different reagents, stained with Coomassie Brilliant Blue G-250, and the absorbance was measured at OD595 nm using a TECAN Infinite M200 multi-mode microplate reader. The content of the four storage proteins in each sample was calculated based on a linear equation between the absorbance of the standard sample and the content of the four storage proteins. Three biological replicates were set up for each sample.

[0043] Determination of gel consistency: Gelatin consistency refers to the length of rice paste that has spread after gelatinization and cooling. In this experiment, thymol blue solution was used to disperse the rice flour, KOH solution was added and mixed, and then gelatinized in a boiling water bath. After standing at room temperature (25 ± 2℃) for 1 hour, the length of the rice paste flowing in the test tube was measured with a ruler, which is the gel consistency. Three biological replicates were set up for each sample.

[0044] Determination of taste value: Approximately 20 g of polished rice was weighed into a rice flour container, and the taste value of the polished rice was determined using a rice grain taste meter (model RLTA10B-KC) manufactured by Satake Corporation, Japan. Ten biological replicates were set up for each sample.

[0045] 6. GS1 Affects rice yield and rice quality In order to study GS1 To investigate the effects on grain shape, heading date, yield, and quality, we planted high-generation near-isogenic lines NIL-W and NIL-G in the summer of 2023. Compared to NIL-G, NIL-W showed a significant difference in grain length, increasing by 0.67 mm. Figure 10 C, 11A); no difference in grain width ( Figure 10 D, 11B); the aspect ratio also differed significantly, increasing by 0.22 ( Figure 11 C); similarly, the thousand-grain weight showed a significant difference, increasing by 0.90 g ( Figure 11D); In addition, the plant height of NIL-W was significantly different from that of NIL-G, increasing by 7.54 cm (D); Figure 10 AB, 11E); the number of effective spikelets was significantly reduced ( ). Figure 11 F); the number of filled grains per ear also differed significantly, with an average decrease of 15 seeds per ear (F). Figure 11 G); the yield per plant decreased slightly by 2.80 g ( Figure 11 H); the heading period was advanced by about 6 days, which was significantly different. Figure 10 A, 11I).

[0046] We also investigated GS1 Compared with NIL-G, the total protein content of the NIL-W material in near-isogenic rice quality traits increased by 2.41%, showing a significant difference. Figure 12 A); albumin content ( Figure 12 B), globulin content ( Figure 12 C) and prolamin content ( Figure 12 D) No difference; gluten content increased by 2.60%, which is a significant difference ( Figure 12 E); Total starch ( Figure 12 There was no difference in F) and amylose content (F) Figure 12 G); there was no difference in gel consistency ( Figure 12 H); the taste score decreased by 6.75 points, which is statistically significant (H). Figure 12 I).

[0047] In summary, GS1 This is a pleiotropic gene that affects not only heading date, grain length, thousand-grain weight, plant height, number of effective panicles, number of filled grains per panicle, and yield, but also the total protein content, gluten content, and eating value of polished rice. In this invention, we successfully cloned a novel gene regulating rice grain shape using forward genetics. GS1 . GS1 Compared to the NIL-W allele, the NIL-G allele not only increases rice yield ( Figure 11 Furthermore, the taste and quality of rice after steaming and cooking have also been improved. Figure 12 Therefore, we believe GS1 It can simultaneously increase rice yield and improve rice quality, and has good breeding application value to a certain extent.

[0048] 7. GS1 Examples of gene breeding applications To verify GS1 The application value of genes in practical breeding: We used the superior male-sterile line Hua 8S as the recipient parent, and the genes carrying... GS1 GZThe materials with superior alleles were used as donor parents and subjected to hybridization and multiple generations of backcrossing. During this process, [the following was observed / utilized / etc.]. GS1 Molecular markers with tight gene linkages are used for assisted selection to screen for homozygous genotypes in backcross populations. GS1 GZ A single plant.

[0049] The results showed that the breeding advantage allele NIL-G GS1 Compared to NIL-W GS1 Synergistic advantages in output and quality Figure 11 and 12 ).in, Figure 11 NIL-G was displayed GS1 The increase in yield per plant from the material Figure 12 This demonstrated its significant effects in reducing total protein and gluten content while improving palatability. The obtained stable improved strains (genotype same as NIL-G) showed… GS1 We conducted an investigation into the phenotypes related to field yield and rice quality.

[0050] The above breeding application examples prove that, GS1 The trend of synergistic improvement in yield and taste quality of genes Figure 11 , 12 The results shown are consistent, indicating that... GS1 GZ Introducing the breeding allele into the superior genetic background of Hua 8S can effectively cultivate new rice varieties with high yield and better eating quality.

[0051] Furthermore, the invention constructs GS1 Overexpression vectors and corresponding transgenic plant lines ( Figure 9 This confirms that regulation GS1 Expression levels can effectively regulate grain shape and heading date. These transgenic materials provide a material foundation and technical reserves for the rapid creation of new rice varieties with high yield potential and excellent eating quality using transgenic technology.

[0052] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. GS1 Application of genes in rice breeding.

2. The application according to claim 1, characterized in that, The GS1 Genes are used to alter rice grain shape, increase rice yield, and / or improve the eating quality of rice.

3. An advantage GS1 Genes, characterized by, The CDS sequence is shown in SEQ ID NO:1, or the encoded amino acid sequence is shown in SEQ ID NO:

2.

4. Advantages as described in claim 3 GS1 Genes, characterized by, For the Guangzhan 63-4S GS1 Gene, or its equivalent gene.

5. A method for changing the shape of rice grains, characterized in that, Including overexpression in rice GS1 The steps of gene generation.

6. A breeding method for synergistically improving rice yield and eating quality, characterized in that, Including GS1 The steps for introducing the dominant allele of a gene into rice.

7. The method according to claim 6, characterized in that, Includes the following steps: S1: containing GS1 Rice with the dominant allele of the gene as a donor and without the aforementioned GS1 Rice with the dominant allele of the gene was used as the recipient for hybridization and multiple generations of backcrossing; S2: In the aforementioned hybridization and backcrossing process, utilizing... GS1 Selective use of tightly linked molecular markers containing the aforementioned GS1 Plants with dominant alleles of genes; S3: Screening for rice varieties with the genetic background of the recipient rice and containing the genetic characteristics of the recipient rice in a multi-generation backcross population. GS1 Plants with the dominant allele of the gene.

8. The method according to any one of claims 5-7, characterized in that, The GS1 The CDS sequence of the dominant allele of the gene is shown in SEQ ID NO:1, or the encoded amino acid sequence is shown in SEQ ID NO:

2.

9. The method according to claim 8, characterized in that, The GS1 The dominant allele of the gene is derived from the widely prevalent 63-4S. GS1 Gene, or its equivalent gene.

Images