Methods for in vitro induction of memory b cells and uses thereof

By using in vitro induction methods with IL-9 and IL-4 and the ZFP318-iso1 molecular marker, the problem of insufficient formation of memory B cells in existing technologies has been solved, enabling the in vitro induction of memory B cells and the screening of related drugs for application in vaccine development and the treatment of immune diseases.

CN118272300BActive Publication Date: 2026-04-07BEIJING CHANGPING LAB
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-02
Publication Date
2026-04-07

AI Technical Summary

Technical Problem

There is a lack of effective methods in the current technology to induce the formation of memory B cells in vitro, which affects the regulation of immune memory.

Method used

By inducing naive B cells to differentiate into memory B cells in vitro using IL-9 and IL-4, and using ZFP318-iso1 as a molecular marker, a method for in vitro screening that promotes or inhibits memory B cell formation was provided, including the use of feeder cells expressing CD40L and BAFF and specific concentrations of cell culture conditions.

Benefits of technology

This study achieved the effective induction of memory B cell formation in vitro and provided a method for screening drugs to promote or inhibit memory B cell formation, offering new approaches for vaccine development and the treatment of immune diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004644634530000091
    Figure BDA0004644634530000091
  • Figure HDA0004644634540000011
    Figure HDA0004644634540000011
  • Figure HDA0004644634540000012
    Figure HDA0004644634540000012
Patent Text Reader

Abstract

This invention relates to the field of immunology, specifically to a method for inducing the formation of memory B cells in vitro and its uses, and particularly to the in vitro screening of drugs that promote or inhibit the formation of memory B cells based on the method.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of immunology, in particular, the present application relates to a method for inducing the formation of memory B cells in vitro and the use thereof, in particular, the present application also relates to an in vitro screening method for drugs capable of promoting or inhibiting the formation of memory B cells based on the method. BACKGROUND

[0002] Humoral immunity is an important part of acquired immunity, after receiving antigen stimulation, through a series of cell activation and differentiation pathways, finally making naive B cells develop into antigen-specific plasma cells and memory B cells. Plasma cells are the source of high-affinity antibodies, while memory B cells can rapidly activate response when the antigen invades again, and remodel the germinal center and differentiate into plasma cells.

[0003] Regulating the formation of memory B cells by small molecule drugs is of great significance to immune memory, although there are some methods for inducing the generation of germinal center B cells in vitro at present, there is no good method for inducing the formation of functional memory B cells. SUMMARY

[0004] The present application inventors have identified a series of transcription factors, nuclear factors and related upstream signals affecting the formation and function of memory B cells through a large number of studies, among which the inventors found that IL-9 can effectively induce the differentiation of germinal center B cells into memory B cells in vitro, and based on this, the present application provides an integrated technical route for inducing the differentiation of naive B cells into germinal center B cells, and then into memory B cells in vitro.

[0005] In addition, the present application inventors have also identified a key factor ZFP318 that controls the secondary immune response of memory B cells. The inventors found that the expression of ZFP318-iso1 is the highest in naive B cells, significantly decreases when differentiating into germinal center B cells, and is re-induced to express when forming memory B cells, so that ZFP318-iso1 can be used as a molecular marker for the formation of memory B cells.

[0006] Based on the above research, the inventors provide a method for inducing the differentiation of naive B cells or germinal center B cells into memory B cells in vitro, and further provide a method for screening drugs capable of promoting or inhibiting the formation of memory B cells in vitro based on the method and the molecular marker function of ZFP318-iso1.

[0007] Therefore, in one aspect, the present application provides a method for inducing the generation of memory B cells in vitro, which comprises:

[0008] (1) providing naive B cells;

[0009] (2) contacting the naive B cells with IL-4;

[0010] (3) Contact the cell products from step (2) with IL-9 to obtain memory B cells.

[0011] In some embodiments, the naive B cells are primary B cells. In some embodiments, the primary B cells refer to CD19+ cells isolated from the spleen.

[0012] In some embodiments, the memory B cell possesses one or more of the following features:

[0013] (i) Compared to the cell product of step (2), the expression of ZFP318-iso1 in the memory B cells is upregulated (e.g., upregulated at least 2-fold); for example, at least half the expression level in naive B cells.

[0014] (ii) The expression level of ZFP318-iso2 in the memory B cells is comparable to the expression level of ZFP318-iso2 in the cell product of step (2);

[0015] (iii) The memory B cells mentioned are IgD - CD38 + cell.

[0016] In some embodiments, the expression level of ZFP318-iso1 in the memory B cells is at least half that in the naive B cells.

[0017] In some implementations, the cell product of step (2) is germinal center B cells.

[0018] In some embodiments, the germinal center B cells possess one or more of the following characteristics:

[0019] (i) Compared to the naive B cells, the expression of ZFP318-iso1 and ZFP318-iso2 in the germinal center B cells was suppressed (e.g., reduced to at least 1 / 2 of that in the naive B cells);

[0020] (ii) The germinal center B cells mentioned are Fas + GL7 + cell.

[0021] In some implementations, the Fas + GL7 + The cell represents a cell that expresses Fas and contains the GL7 recognition epitope. For example, the Fas... + GL7 + The cells represent those that express Fas and are able to specifically bind to GL7.

[0022] As is generally understood by those skilled in the art, GL7 is a monoclonal antibody (e.g., a rat-derived monoclonal antibody) that recognizes sialylated glycans, specifically α2,6-linked N-acetylneuraminic acid (Neu5Ac) chains of lactoaminoglycans, in a Sia (sialic acid) modification and Sia (sialic acid) linkage-dependent manner (see Naito Y, et al. Germinalcenter marker GL7 probes activation-dependent repression of N-glycolylneuraminic acid, a sialic acid species involved in the negative modulation of B-cell activation. Mol Cell Biol. 2007 Apr; 27(8):3008-22. doi:10.1128 / MCB.02047-06.; the full text of which is incorporated herein by reference). GL7 is commonly used to probe germinal centers of T-cell-dependent immunity.

[0023] In some implementations, in step (2), the naive B cells are brought into contact with IL-4 in the presence of feeder cells.

[0024] In some embodiments, the feeder cells express CD40L and BAFF (B cell activating factor).

[0025] In some embodiments, the feeder cells are selected from fibroblasts expressing CD40L and BAFF.

[0026] In some embodiments, the feeder cells are obtained by culturing NIH-3T3 cells that exogenously express CD40L and BAFF.

[0027] In some implementations, step (2) includes culturing the naive B cells in a culture medium containing IL-4, thereby causing the naive B cells to differentiate into germinal center B cells.

[0028] In some embodiments, the concentration of IL-4 is at least 0.5 ng / ml, for example at least 1 ng / ml; preferably, the concentration of IL-4 is 0.5-50 ng / ml (e.g., 0.5-2 ng / ml, 0.5-5 ng / ml, 0.5-10 ng / ml, 1-5 ng / ml, 1-10 ng / ml, 1-50 ng / ml), for example 1.0 ng / ml.

[0029] In some embodiments, the culture medium is a basal medium containing serum (e.g., RPMI-1640 medium). Hereinafter, the term "basal medium" refers to any culture medium capable of supporting cell growth, typically containing inorganic salts, vitamins, glucose, buffer systems, and essential amino acids. In some embodiments, the basal medium is preferably a medium for mammalian cells (particularly suspension cells).

[0030] In some embodiments, the culture time is 3-4 days. In some embodiments, the culture time is 4 days.

[0031] In some implementations, in step (3), the cell product of step (2) is contacted with IL-9 in the presence of feeder cells.

[0032] In some embodiments, the feeder cells express CD40L and BAFF (B cell activating factor).

[0033] In some embodiments, the feeder cells are selected from fibroblasts expressing CD40L and BAFF.

[0034] In some embodiments, the feeder cells are obtained by culturing NIH-3T3 cells that exogenously express CD40L and BAFF.

[0035] In some implementations, step (3) includes culturing the cell product of step (2) in a culture medium containing IL-9, thereby differentiating the cell product of step (2) into memory B cells.

[0036] In some embodiments, the concentration of IL-9 is at least 0.5 ng / ml, for example, at least 1 ng / ml. In some embodiments, the concentration of IL-9 is 0.5-50 ng / ml (e.g., 0.5-5 ng / ml, 0.5-10 ng / ml, 1-5 ng / ml, 1-10 ng / ml, 1-50 ng / ml), for example, 1 ng / ml, 5 ng / ml, 10 ng / ml, or 50 ng / ml.

[0037] In some embodiments, the culture medium is a basal culture medium containing serum (e.g., RPMI-1640 medium).

[0038] In some embodiments, the culture time is at least 24 hours, at least 36 hours, at least 40 hours, at least 44 hours, or at least 48 hours. In some embodiments, the culture time is 24-48 hours. In some embodiments, the culture time is 48 hours.

[0039] In some implementations, the cell product of step (2) is contacted with IL-9 when at least 80% (e.g., at least 85% or at least 90%) of the cells in step (2) differentiate into germinal center B cells.

[0040] On the other hand, this application also provides a method for in vitro identification of the effect of a test reagent on the formation of memory B cells, the method comprising:

[0041] (a) Provides immature B cells;

[0042] (b) Expose the immature B cells to IL-4;

[0043] (c) Contact the cell product from step (b) with the test reagent;

[0044] (d) Detect the expression level of ZFP318 in the cell products of step (c).

[0045] In some embodiments, the naive B cells are primary B cells. In some embodiments, the primary B cells refer to CD19+ cells isolated from the spleen.

[0046] In some implementations, the cell product of step (b) is germinal center B cells.

[0047] In some embodiments, the germinal center B cells possess one or more of the following characteristics:

[0048] (i) Compared to the naive B cells, the expression of ZFP318-iso1 and ZFP318-iso2 in the germinal center B cells was suppressed (e.g., reduced to at least 1 / 2 of that in the naive B cells);

[0049] (ii) The germinal center B cells mentioned are Fas + GL7 + cell.

[0050] In some implementations, the Fas + GL7 + The cell represents a cell that expresses Fas and contains the GL7 recognition epitope. For example, the Fas... + GL7 + The cells represent those that express Fas and are able to specifically bind to GL7.

[0051] In some embodiments, in step (b), the naive B cells are brought into contact with IL-4 in the presence of feeder cells.

[0052] In some embodiments, the feeder cells express CD40L and BAFF (B cell activating factor).

[0053] In some embodiments, the feeder cells are selected from fibroblasts expressing CD40L and BAFF.

[0054] In some embodiments, the feeder cells are obtained by culturing NIH-3T3 cells that exogenously express CD40L and BAFF.

[0055] In some embodiments, step (b) includes culturing the naive B cells in a culture medium containing IL-4.

[0056] In some embodiments, the concentration of IL-4 is at least 0.5 ng / ml, for example, at least 1 ng / ml. In some embodiments, the concentration of IL-4 is 0.5-50 ng / ml (e.g., 0.5-2 ng / ml, 0.5-5 ng / ml, 0.5-10 ng / ml, 1-5 ng / ml, 1-10 ng / ml, 1-50 ng / ml), for example, 1.0 ng / ml.

[0057] In some embodiments, the culture medium is a basal culture medium containing serum (e.g., RPMI-1640 medium).

[0058] In some implementations, the culture time is 3-4 days; preferably 4 days.

[0059] In some embodiments, in step (c), the cell product from step (b) is contacted with the test reagent in the presence of feeder cells.

[0060] In some embodiments, the feeder cells express CD40L and BAFF (B cell activating factor).

[0061] In some embodiments, the feeder cells are selected from fibroblasts expressing CD40L and BAFF.

[0062] In some embodiments, the feeder cells are obtained by culturing NIH-3T3 cells that exogenously express CD40L and BAFF.

[0063] In some implementations, step (c) includes culturing the cell product of step (b) in a culture medium.

[0064] In some embodiments, the culture medium is a basal culture medium containing serum (e.g., RPMI-1640 medium).

[0065] In some embodiments, the culture time is at least 24 hours, at least 36 hours, at least 40 hours, at least 44 hours, or at least 48 hours. In some embodiments, the culture time is 24-48 hours. In some embodiments, the culture time is 48 hours.

[0066] In some embodiments, the method further includes determining the effect of the test agent on memory B cell formation (e.g., inhibition or promotion) based on the expression level of ZFP318.

[0067] In some embodiments, the effect of the test agent on memory B cell formation is determined by comparing the expression levels of ZFP318 in the cell product of step (c) and the control group cells. In some embodiments, the control group cells are cells that have not been exposed to the test agent. In some embodiments, the control group cells are cells from the cell product of step (b), or cells from the cell product of step (b) treated with a negative control reagent or a blank control reagent (e.g., a treatment parallel to step (c)).

[0068] In some implementations, if the expression level of ZFP318 in the cell product of step (c) is higher than the expression level of ZFP318 in the control group cells, the test agent is considered to have a promoting effect on the formation of memory B cells.

[0069] In some implementations, if the expression level of ZFP318 in the cell product of step (c) is lower than the expression level of ZFP318 in the control group cells, the test agent is considered to have an inhibitory effect on the formation of memory B cells.

[0070] In some embodiments, the expression level of ZFP318 is the expression level of ZFP318 protein or the expression level of ZFP318 mRNA.

[0071] In some embodiments, the expression level of ZFP318 is obtained by directly detecting the content of ZFP318 protein or ZFP318 mRNA.

[0072] In some embodiments, the naive B cells provided in step (a) are modified to contain a reporter gene capable of indicating ZFP318 expression (e.g., the expression level of the reporter gene is consistent with or positively or negatively correlated with the expression level of ZFP318).

[0073] In some embodiments, the modified naive B cells contain a modified endogenous ZFP318 locus in their genome, which contains a reporter gene.

[0074] In some implementations, the reporter gene and the ZFP318 are located in the same expression cassette (e.g., transcription is initiated via the same promoter).

[0075] In some implementations, the expression level of ZFP318 is obtained indirectly by detecting the expression level of a reporter gene.

[0076] In some embodiments, the expression level of the reporter gene is obtained by detecting the protein product content or mRNA product content of the reporter gene, or the activity of its product (e.g., fluorescence signal, enzyme activity), thereby indirectly obtaining the expression level of ZFP318.

[0077] In some implementations, the expression level of ZFP318 is the expression level of ZFP318-iso1, or the expression level of ZFP318 is the total expression level of ZFP318-iso1 and ZFP318-iso2.

[0078] It is known in the art that ZFP318 comprises two transcriptional variants: ZFP318-iso1 (e.g., NM_207671.4) and ZFP318-iso2 (e.g., NM_021346.2). For example, the mRNA structures of ZFP318-iso1 (NM_207671.4) and ZFP318-iso2 (NM_021346.2) are as follows: Figure 8As shown. In some embodiments, when it is necessary to detect the total protein / mRNA expression levels of ZFP318-iso1 and ZFP318-iso2, the detection reagent can target a common portion of the two variants. In some embodiments, when it is necessary to detect the total mRNA expression levels of ZFP318-iso1 and ZFP318-iso2, the detection qRT-PCR primers can be designed to target a partial sequence in Exon4 (e.g., primers designed with sequences such as SEQ ID NO: 1 and 2), thereby detecting the full mRNA expression of ZFP318-iso1 and ZFP318-iso2. In some embodiments, when it is necessary to detect the mRNA expression level of ZFP318-iso1, the detection primers can be designed to target partial sequences in Exon9 and Exon10 respectively (e.g., primers designed with sequences such as SEQ ID NO: 3 and 4), thereby specifically detecting the expression level of ZFP318-iso1 while not detecting ZFP318-iso2. In some implementations, when it is necessary to detect the mRNA expression level of ZFP318-iso2, the detection primers can be designed to target partial sequences in Exon7 and Exon8, which are unique to ZFP318-iso2, respectively (e.g., primers with sequences such as SEQ ID NO:5 and 6), thereby enabling specific detection of the expression level of ZFP318-iso2 while ZFP318-iso1 cannot be detected.

[0079] On the other hand, this application also provides a kit containing IL-9 and IL-4, as well as reagents capable of detecting the expression level of ZFP318 in cells.

[0080] In some implementations, the expression level of ZFP318 is the expression level of ZFP318-iso1, or the expression level of ZFP318 is the total expression level of ZFP318-iso1 and ZFP318-iso2.

[0081] In some embodiments, the reagent capable of detecting the expression level of ZFP318 in cells is a reagent capable of detecting the content of ZFP318 protein (e.g., ZFP318-iso1 protein and / or ZFP318-iso2 protein), such as an antibody that specifically binds to ZFP318 (e.g., an antibody that specifically binds to ZFP318-iso1 protein and / or ZFP318-iso2 protein).

[0082] In some embodiments, the reagent capable of detecting the expression level of ZFP318 in cells is a reagent capable of detecting the content of ZFP318 mRNA (e.g., ZFP318-iso1 mRNA and / or ZFP318-iso2 mRNA), such as primers and / or probes capable of specifically binding to ZFP318 mRNA or its cDNA (e.g., primers and / or probes capable of specifically binding to ZFP318-iso1 mRNA and / or ZFP318-iso2 mRNA).

[0083] In some embodiments, the kit further comprises a basal culture medium containing serum (e.g., RPMI-1640 medium).

[0084] On the other hand, this application also provides the use of the kit described above for in vitro induction of memory B cells or screening for reagents that affect the formation of memory B cells.

[0085] In some embodiments, the reagent that affects the formation of memory B cells is a reagent that promotes or inhibits the formation of memory B cells.

[0086] On the other hand, this application provides the use of reagents capable of detecting the expression level of ZFP318 in cells for screening drugs that affect the formation of memory B cells.

[0087] In some embodiments, the drug affecting the formation of memory B cells is a drug that promotes or inhibits the formation of memory B cells.

[0088] In some implementations, the expression level of ZFP318 is the expression level of ZFP318-iso1, or the expression level of ZFP318 is the total expression level of ZFP318-iso1 and ZFP318-iso2.

[0089] In some embodiments, the reagent capable of detecting the expression level of ZFP318 in cells is a reagent capable of detecting the content of ZFP318 protein (e.g., ZFP318-iso1 protein and / or ZFP318-iso2 protein), such as an antibody that specifically binds to ZFP318 (e.g., an antibody that specifically binds to ZFP318-iso1 protein and / or ZFP318-iso2 protein).

[0090] In some embodiments, the reagent capable of detecting the expression level of ZFP318 in cells is a reagent capable of detecting the content of ZFP318 mRNA (e.g., ZFP318-iso1 mRNA and / or ZFP318-iso2 mRNA), such as primers and / or probes capable of specifically binding to ZFP318 mRNA or its cDNA (e.g., primers and / or probes capable of specifically binding to ZFP318-iso1 mRNA and / or ZFP318-iso2 mRNA).

[0091] In some embodiments, the B cells described in any embodiment of any aspect of the foregoing are mouse-derived. In some embodiments, the ZFP318 described in any embodiment of any aspect of the foregoing is mouse-derived.

[0092] In some embodiments, relevant information about the exemplary marker molecules involved in this application is shown in Table 1:

[0093] Table 1. Information on exemplary labeled molecules

[0094]

[0095] Beneficial effects of the invention

[0096] The method provided in this application can realize the transformation of germinal center B cells or naive B cells into memory B cells in vitro. Furthermore, this application also provides a method for screening drugs that can promote or inhibit the formation of memory B cells in vitro based on the method and the molecular marker effect of ZFP318-iso1. This is not only of great significance for the development and application of vaccines, but can also provide better methods for the treatment of some immune diseases.

[0097] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings and examples. However, those skilled in the art will understand that the following drawings and examples are for illustrative purposes only and are not intended to limit the scope of the invention. Various objects and advantages of the present invention will become apparent to those skilled in the art from the following detailed description of the drawings and preferred embodiments. Attached Figure Description

[0098] Figure 1 Real-time quantitative PCR detection of the isolate obtained from B6 mice The expression level of ZFP318 mRNA in B (immature B cells), GC B (germinal center B cells), CD38+GC B (memory B cell precursor cells), MBC (memory B cells), SPPC (splenic plasma cells), and BMPC (bone marrow plasma cells).

[0099] Figure 2 (A) Immature B cells B) In vitro induction of germinal center B cells (IGC B) manipulation route; (B) Real-time quantitative PCR detection Expression levels of mRNAs of CCL22, BCL6, ZFP318, ZFP318-iso1, and ZFP318-iso2 in B and IGC B.

[0100] Figure 3 (A) Collection (B) B cells were collected and the signals of B220, Fas, and GL7 were detected by flow cytometry.

[0101] Figure 4 (A) (B) The operational pathway for the formation of memory B cells after in vitro induction of IGC B, and further treatment under different conditions (IL-9, CpG or IL-21); (B) Real-time quantitative PCR detection The expression levels of B and IGC B, and the expression levels of CCL22, BCL6, ZFP318, ZFP318-iso1 and ZFP318-iso2 mRNAs of IGC B after treatment under different conditions.

[0102] Figure 5 The diagram shows the result of knocking the TdTomato fluorescent gene into the ZFP318 promoter using CRISPR technology. It includes the loxP-STOP-loxP element, which represses transcription. In the presence of Cre expression, STOP is excised, allowing normal transcription. This mouse was named the ZSDAT mouse.

[0103] Figure 6 (A) Ordinary B6 mice and mice with the tdTomoto gene knocked in. (B) The operational route for the formation of memory B cells after in vitro induction of IGC B under different conditions; (B) Flow cytometry was used to detect the proportion of tdTomoto-expressing cells in B cells of ordinary B6 mice and mice with knock-in tdTomoto gene.

[0104] Figure 7 (A) IGC B cells were treated with different concentrations of IL-9 and IL-21, and the proportion of cells expressing tdTomoto was detected by flow cytometry. (B) Statistical analysis was performed.

[0105] Figure 8 Schematic diagram of ZFP318-iso1 and ZFP318-iso2 mRNA structures.

[0106] Figure 9 (A) Mice with the tdTomoto gene knocked in The operational pathway for in vitro induction of IGC B followed by IL9 treatment to form memory B cells; (BC) B220, Fas, GL7 and tdTomoto signals were detected by flow cytometry; (D) The expression levels of CCL22, ZFP318, ZFP318-iso1 and ZFP318-iso2 mRNA were detected by real-time quantitative PCR.

[0107] Figure 10 The operational route for the first in vitro drug screening: knock-in tdTomoto gene mice. After in vitro induction to form IGCs, compounds were screened using a drug library from Selleck (catalog number: L2000-Z657393), which contains 3113 drugs. Flow cytometry was used to screen 98 drugs with tdTomoto fluorescence greater than 5000.

[0108] Figure 11 (A) To eliminate fluorescence interference from the drugs themselves, a second drug screening was conducted, in which wild-type mouse (WT) cells without tdTomoto fluorescence were added as a control, and 17 compounds with a tdTomoto Ratio (i.e., the ratio of MFI of ZSDTA×MB1 mouse cells to MFI of WT mouse cells) greater than 1.5 were screened; (B) The expression level of ZFP318 under the treatment of the 17 selected compounds was detected by real-time quantitative PCR. Detailed Implementation

[0109] The invention will now be described with reference to the following embodiments, which are intended to illustrate the invention (and not limit it).

[0110] Unless otherwise specified, the molecular biology experimental methods and immunoassays used in this invention are substantially based on those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, 1989, and F.M. Ausubel et al., A Concise Guide to Molecular Biology, 3rd Edition, John Wiley & Sons, Inc., 1995. Those skilled in the art will appreciate that the examples illustrate the invention by way of illustration and are not intended to limit the scope of the invention as claimed.

[0111] Example 1: In vitro induction of memory B cells

[0112] Experimental Methods :

[0113] 1. Feeder cell culture

[0114] 1.1 Resuscitate 3T3-40LB cells (this cell line is NIH-3T3, obtained from ATCC, and exogenously expresses CD40L and BAFF (B cell activating factor)).

[0115] 1.2 The cells were passaged into T75 culture flasks. After the cell density reached 90%, 5 ml of DMEM complete medium (containing Mitomycin at a final concentration of 10 μg / ml) was added, and the cells were incubated at 37°C for 4 h.

[0116] 2. Isolation and purification of primary B cells from mice

[0117] 2.1 Remove the spleen of the mouse (C57BL / 6J, purchased from Vital River), add 3 ml of MACS buffer and grind, filter through a 70 μm sieve, and centrifuge the resulting single-cell suspension at 1700 rpm for 5 minutes in a pre-cooled 4°C centrifuge.

[0118] 2.2 Discard the supernatant, add 1 ml of red blood cell lysis buffer to the spleen of each mouse, resuspend the cells and let stand at room temperature for 1-2 minutes, then add 9 ml of MACS buffer to dilute tenfold, filter through a 70 μm sieve, and centrifuge at 1700 rpm for 5 minutes.

[0119] 2.3 Discard the supernatant, add 470 μl of MACS buffer to the spleen of each mouse to resuspend the cells, then add 30 μl of anti-CD19 magnetic beads, mix well and incubate on ice for 30 minutes, then add 9 ml of MACS buffer to dilute, filter through a 70 μm sieve, and centrifuge at 1700 rpm for 5 minutes.

[0120] 2.4 Resuspend the cells in each spleen in 1 ml of MACS buffer. Add the cell suspension to the LS sorting column that has been rinsed and fixed in a magnetic rack. After the cells flow through the sorting column, wash three times with 3 ml of MACS buffer each time.

[0121] 2.5 After all the liquid has flowed through the sorting column, remove the sorting column, wash the cells attached to the column with 5 ml of MACS buffer, centrifuge at 1700 rpm for 5 minutes, discard the supernatant, resuspend the cells in 10 ml of RPMI-1640 medium containing 10% fetal bovine serum, and count the cells.

[0122] 3. In vitro induction of germinal center B cells

[0123] 3.1 After 4 hours of treatment with Mitomycin, 3T3-40LB cells were washed five times with 10ml of PBS buffer preheated to 37°C each time.

[0124] 3.2 Take 5 × 105 The primary B cells obtained in step 2.5 above were diluted with 40 ml of RPMI-1640 complete medium and IL-4 was added to a final concentration of 1 ng / ml. This solution was then slowly added to the cell culture flask containing 3T3-40LB cells that had been washed in step 3.1 above, and cultured in a 37℃ CO2 incubator for 4 days.

[0125] 4. In vitro induction of memory B cells

[0126] 4.1 After culturing for 4 days in step 3.2 above, carefully remove the upper culture medium, being careful not to shake the B cells at the bottom.

[0127] 4.2 Add 20 ml of RPMI-1640 complete medium containing 1 ng / ml IL-9, 1 ng / ml IL-21 or 500 ng / ml CpG respectively, and continue to incubate at 37℃ in a CO2 incubator for 2 days.

[0128] 4. Enrichment and detection of B cells in vitro

[0129] 4.1 After completing the culture in step 3.2 or step 4.2 above, carefully remove the upper culture medium, being careful not to shake the 3T3-40LB cells at the bottom.

[0130] 4.2 Add 10 ml of preheated PBS buffer and let stand at room temperature for 5 minutes. Collect the supernatant and repeat twice. After collecting all the supernatant, centrifuge at 1700 rpm for 5 minutes.

[0131] 4.3 Discard the supernatant, resuspend the cells in 470 μl of MACS buffer, add 30 μl of anti-CD19 magnetic beads, mix well, incubate on ice for 30 minutes, then dilute with 9 ml of MACS buffer, filter through a 70 μm sieve, and centrifuge at 1700 rpm for 5 minutes.

[0132] 4.4 Repeat steps 2.4-2.5 above, collect the final cells, resuspend them in MACS, and detect them by flow cytometry and real-time quantitative PCR, respectively. The primer sequences used for detection are as follows:

[0133] ZFP318-F:CAGCTCGGATACCTCCAAATTA(SEQ ID NO:1)

[0134] ZFP318-R:GGTTGAGAGGCAGGATACATAG(SEQ ID NO:2)

[0135] ZFP318-iso1-F:TTTCTGGAGAGCAGCATGTC(SEQ ID NO:3)

[0136] ZFP318-iso1-R:CGGTCCAGATTTCTTCGTTCT(SEQ ID NO:4)

[0137] ZFP318-iso2-F:GTGGGACCATGTTTGACTTCT(SEQ ID NO:5)

[0138] ZFP318-iso2-R:TGCTTCAGTCCTTCCGTTTG(SEQ ID NO:6)

[0139] Experimental Results :

[0140] B cells at different differentiation stages ( The expression levels of ZFP318 mRNA in B cells (immature B cells), GC B cells (germinal center B cells), CD38+GC B cells (memory B cell precursor cells), MBC cells (memory B cells), SPPC cells (spleen plasma cells), and BMPC cells (bone marrow plasma cells) are as follows: Figure 1 As shown, the results indicate that ZFP318 expression was significantly upregulated in memory B cells compared to germinal center B cells, at least twice as high, and reached [a certain level]. ZFP318 is expressed in more than half of B cells, and its upregulation is significantly higher than that of other types of B cells (e.g., CD38+GC B (memory B cell precursor cells), SPPC (splenic plasma cells), and BMPC (bone marrow plasma cells)), indicating that ZFP318 can serve as a molecular marker for the formation of memory B cells.

[0141] An exemplary procedure for inducing germinal center B cells from primary B cells in vitro is as follows: Figure 2 As shown in (A), CD40L and BAFF were first exogenously expressed in feeder cells. Immature B cells were then grown on the feeder cells and stimulated with IL-4 (see, for example, Nojima T, et al. In-vitro derived germinal center B cells differentially generate memory B or plasma cells in vivo. Nature Communications. 2011; 2(1):465.). The pre-induction... The expression levels of mRNAs of CCL22, BCL6, ZFP318, ZFP318-iso1, and ZFP318-iso2 in B cells and IL-4-induced IGC B cells were detected (e.g., Figure 2 As shown in (B), the results show that compared to In B cells, the mRNA level of ZFP318 was significantly suppressed in IGC B cells, whether it was ZFP318-iso1 or ZFP318-iso2.

[0142] In addition, through flow cytometry detection The inventors of this application discovered that B cells and in vitro induced IGCs contain signals such as B220, Fas, and GL7 in B cells. Less than 1% of germinal center B cells (Fas) make up B cells. + GL7 + )(like Figure 3 As shown in (A), after 4 days of in vitro culture, 90% of the obtained B cells were germinal center B cells (e.g., Figure 3 As shown in (B), this demonstrates that the system can simulate the maturation and differentiation of B cells in the germinal centers of the body.

[0143] An exemplary operational route for inducing memory B cells from germinal center B cells in vitro is as follows: Figure 4 As shown in (A), after culturing IGC B cells for 4 days to form, the inventors unexpectedly discovered that only IL-9 could induce ZFP318 mRNA expression by adding IL-9, IL-21, and CpG as stimuli. In particular, it only upregulated ZFP318-iso1 without affecting ZFP318-iso2 expression (e.g., Figure 4 As shown in (B), this is also consistent with Figure 1 The similar changes in ZFP318 mRNA expression in B cells at different differentiation stages, as shown in the study, indicate that this method can simulate the differentiation of memory B cells in vitro and in vivo. Furthermore, B cells obtained by IL-9 stimulation expressed known memory B cell markers (including IgD). - CD38 + This further confirms that memory B cells can be obtained from this process.

[0144] Example 2: Small molecule drug screening

[0145] To facilitate the screening of drugs that can promote or inhibit memory B cell formation based on the in vitro induced memory B cell formation method of Example 1, the inventors used CRISPR technology to knock in the TdTomato fluorescent gene after the ZFP318 promoter (operation diagram shown in Figure 1). Figure 5 When the ZFP318 promoter is activated, it simultaneously expresses TdTomato fluorescence. The expression of ZFP318 can be determined by detecting the fluorescence by flow cytometry, making drug screening more efficient.

[0146] Specifically, the inventors used modified mouse cells to re-induce germinal center B cells in vitro. After the germinal center B cells were formed, they were cultured for another 2 days (without IL-9 induction). The fluorescence ratio was then detected by flow cytometry. The results showed that, compared to ordinary B6 mouse cells, cells with the TdTomato gene knocked in significantly expressed fluorescence. Figure 6 B) indicates that the above-mentioned reporter system based on the TdTomato gene is feasible and can report the expression of ZFP318.

[0147] Furthermore, the inventors further investigated different concentrations of IL-9 (see schematic diagram for in vitro induction). Figure 6 As shown in A), all of these can increase the proportion of TdTomato positive cells. Figure 7 A and Figure 7 B). Based on this, drug screening can be carried out more efficiently.

[0148] To further confirm the reliability of the screening model, the inventors further combined flow cytometry and real-time quantitative PCR technology to detect the knock-in tdTomoto gene mice. The expression of relevant genes in B cells at different differentiation stages during the in vitro induction of memory B cells. The specific operational route is as follows: Figure 9 As shown in Figure A, mice with the tdTomoto gene knocked in... After in vitro induction to form IGC B cells, memory B cells were further induced under IL-9 treatment. B220, Fas, GL7, and tdTomoto signaling were detected by flow cytometry. Figure 9 B and Figure 9 C), and the expression levels of CCL22, ZFP318, ZFP318-iso1, and ZFP318-iso2 mRNA were detected by real-time quantitative PCR. Figure 9 D). The results showed that cells with the TdTomato gene knocked in significantly expressed fluorescence, with fluorescence intensity decreasing after IGC formation and increasing after IL-9 treatment. Furthermore, quantitative real-time PCR also revealed that ZFP318 mRNA levels decreased after IGC formation and increased after IL-9 treatment. These results indicate that tdTomato gene knock-in mice... B cells can form IGC B cells under the induction of IL-4, and can further differentiate into memory B cells under the induction of IL-9, and can be reported by the knock-in tdTomoto gene, further confirming the feasibility of the screening model.

[0149] Based on the above screening model, under the same time conditions of IL-9 treatment, the test drug was added in parallel, and the proportion of TdTomato-positive cells was detected to assess the drug's promoting or inhibiting effect on memory B cell formation (specific operation route as follows). Figure 10 As shown), the ZSDAT×MB1cre mouse is a hybrid of ZSDAT and MB1cre mice. The ZSDAT mouse has a loxP-STOP-loxP element knocked into the ZFP318 promoter region, which inhibits transcription. In the presence of Cre (Cre recombinase) expression, STOP is cleaved, allowing normal transcription. Specifically, the inventors used a drug compound library from Selleck (catalog number: L2000-Z657393), containing 3113 drugs. The first screening was performed using flow cytometry, identifying 98 drug compounds with significantly upregulated TdTomato fluorescence intensity (MFI>5000). Figure 10 Because some drugs are fluorescent, the inventors conducted a second screening to eliminate this influence, ultimately selecting 17 drugs. Figure 11 A). Further quantitative real-time PCR analysis revealed that 5 out of the 17 drugs (No. 1-16 and Doxcy) (No. 7, No. 9, No. 12, No. 13, and No. 14) significantly upregulated ZFP318 mRNA levels. Figure 11 B).

[0150] Although specific embodiments of the invention have been described in detail, those skilled in the art will understand that various modifications and variations can be made to the details based on all the published teachings, and all such changes are within the scope of protection of the invention. The entire scope of the invention is given by the appended claims and any equivalents thereof.

Claims

1. A method for inducing the generation of memory B cells in vitro, comprising: (1) Provides immature B cells; (2) Contact the immature B cells with IL-4; (3) Contact the cell products from step (2) with IL-9 to obtain memory B cells; (4) Detect the expression level of ZFP318 in the cell products of step (3).

2. The method as described in claim 1, wherein, The naive B cells mentioned are primary B cells.

3. The method as described in claim 1, wherein, The memory B cell possesses one or more of the following characteristics: (i) Compared to the cell products of step (2), the expression of ZFP318-iso1 in the memory B cells is upregulated; (ii) The expression level of ZFP318-iso2 in the memory B cells is comparable to the expression level of ZFP318-iso2 in the cell product of step (2); (iii) The memory B cells mentioned are IgD. - CD38 + cell.

4. The method of claim 3, wherein, The expression of ZFP318-iso1 in memory B cells described in (i) is upregulated by at least 2-fold.

5. The method of claim 1, wherein, The cell product of step (2) is germinal center B cells.

6. The method of claim 5, wherein, The germinal center B cells possess one or more of the following characteristics: (i) Compared to the naive B cells, the expression of both ZFP318-iso1 and ZFP318-iso2 in the germinal center B cells was inhibited; (ii) The germinal center B cells mentioned are Fas + GL7 + cell.

7. The method of claim 6, wherein, The expression of ZFP318-iso1 and ZFP318-iso2 in the germinal center B cells described in (i) is reduced to at least half of that in the naive B cells.

8. The method of claim 1, wherein, In step (2), the naive B cells are brought into contact with IL-4 in the presence of feeder cells.

9. The method of claim 8, wherein, The feeder cells express CD40L and BAFF (B cell activating factor).

10. The method of claim 8, wherein, The feeder cells were selected from fibroblasts expressing CD40L and BAFF.

11. The method of claim 8, wherein, The feeder cells were obtained by culturing NIH-3T3 cells that exogenously expressed CD40L and BAFF.

12. The method of claim 1, wherein, Step (2) includes culturing the naive B cells in a culture medium containing IL-4, thereby causing the naive B cells to differentiate into germinal center B cells.

13. The method of claim 12, wherein, The concentration of IL-4 is at least 0.5 ng / ml.

14. The method of claim 12, wherein, The concentration of IL-4 is at least 1 ng / ml.

15. The method of claim 12, wherein, The concentration of IL-4 is 0.5-50 ng / ml.

16. The method of claim 12, wherein, The concentration of IL-4 is 0.5-2 ng / ml.

17. The method of claim 12, wherein, The concentration of IL-4 is 0.5-5 ng / ml.

18. The method of claim 12, wherein, The concentration of IL-4 is 0.5-10 ng / ml.

19. The method of claim 12, wherein, The concentration of IL-4 is 1-5 ng / ml.

20. The method of claim 12, wherein, The concentration of IL-4 is 1-10 ng / ml.

21. The method of claim 12, wherein, The concentration of IL-4 is 1-50 ng / ml.

22. The method of claim 12, wherein, The concentration of IL-4 was 1.0 ng / ml.

23. The method of claim 12, wherein, The culture medium is a basic culture medium containing serum.

24. The method of claim 12, wherein, The culture medium is RPMI-1640 medium containing serum.

25. The method of claim 12, wherein, The culture time is 3-4 days.

26. The method of claim 12, wherein, The culture time is 4 days.

27. The method of claim 1, wherein, In step (3), the cell product from step (2) is brought into contact with IL-9 in the presence of feeder cells.

28. The method of claim 27, wherein, The feeder cells express CD40L and BAFF (B cell activating factor).

29. The method of claim 27, wherein, The feeder cells were selected from fibroblasts expressing CD40L and BAFF.

30. The method of claim 27, wherein, The feeder cells were obtained by culturing NIH-3T3 cells that exogenously expressed CD40L and BAFF.

31. The method of claim 1, wherein, Step (3) includes culturing the cell product of step (2) in a culture medium containing IL-9, thereby differentiating the cell product of step (2) into memory B cells.

32. The method of claim 31, wherein, The concentration of IL-9 is at least 0.5 ng / ml.

33. The method of claim 31, wherein, The concentration of IL-9 is at least 1 ng / ml.

34. The method of claim 31, wherein, The concentration of IL-9 is 0.5-50 ng / ml.

35. The method of claim 31, wherein, The concentration of IL-9 is 0.5-5 ng / ml.

36. The method of claim 31, wherein, The concentration of IL-9 is 0.5-10 ng / ml.

37. The method of claim 31, wherein, The concentration of IL-9 is 1-5 ng / ml.

38. The method of claim 31, wherein, The concentration of IL-9 is 1-10 ng / ml.

39. The method of claim 31, wherein, The concentration of IL-9 is 1-50 ng / ml.

40. The method of claim 31, wherein, The concentration of IL-9 is 1 ng / ml, 5 ng / ml, 10 ng / ml or 50 ng / ml.

41. The method of claim 31, wherein, The culture medium is a basic culture medium containing serum.

42. The method of claim 31, wherein, The culture medium is RPMI-1640 medium containing serum.

43. The method of claim 31, wherein, The culture time is at least 24 hours.

44. The method of claim 31, wherein, The culture time is at least 36 hours.

45. The method of claim 31, wherein, The culture time is at least 40 hours.

46. ​​The method of claim 31, wherein, The culture time is at least 44 hours.

47. The method of claim 31, wherein, The culture time is at least 48 hours.

48. The method of claim 31, wherein, The culture time is 24-48 hours.

49. The method of claim 31, wherein, The culture time was 48 hours.

50. The method of claim 1, wherein, When at least 80% of the cells in step (2) differentiate into germinal center B cells, the cell product from step (2) is contacted with IL-9.

51. The method of claim 1, wherein, When at least 85% of the cells in step (2) differentiate into germinal center B cells, the cell product from step (2) is contacted with IL-9.

52. The method of claim 1, wherein, When at least 90% of the cells in step (2) differentiate into germinal center B cells, the cell product from step (2) is contacted with IL-9.

53. A method for in vitro identification of the effect of a test reagent on the formation of memory B cells, the method comprising: (a) Provides immature B cells; (b) Expose the immature B cells to IL-4; (c) Contact the cell product from step (b) with the test reagent; (d) Detect the expression level of ZFP318 in the cell products of step (c).

54. The method of claim 53, wherein, In step (b), the naive B cells are brought into contact with IL-4 in the presence of feeder cells.

55. The method of claim 54, wherein the feeder cells express CD40L and BAFF (B cell activating factor).

56. The method of claim 54, wherein, The feeder cells were selected from fibroblasts expressing CD40L and BAFF.

57. The method of claim 54, wherein, The feeder cells were obtained by culturing NIH-3T3 cells that exogenously expressed CD40L and BAFF.

58. The method of claim 53, wherein, Step (b) includes culturing the naive B cells in a culture medium containing IL-4.

59. The method of claim 58, wherein, The concentration of IL-4 is at least 0.5 ng / ml.

60. The method of claim 58, wherein, The concentration of IL-4 is at least 1 ng / ml.

61. The method of claim 58, wherein, The concentration of IL-4 is 0.5-50 ng / ml.

62. The method of claim 58, wherein, The concentration of IL-4 is 0.5-2 ng / ml.

63. The method of claim 58, wherein, The concentration of IL-4 is 0.5-5 ng / ml.

64. The method of claim 58, wherein, The concentration of IL-4 is 0.5-10 ng / ml.

65. The method of claim 58, wherein, The concentration of IL-4 is 1-5 ng / ml.

66. The method of claim 58, wherein, The concentration of IL-4 is 1-10 ng / ml.

67. The method of claim 58, wherein, The concentration of IL-4 is 1-50 ng / ml.

68. The method of claim 58, wherein, The concentration of IL-4 was 1.0 ng / ml.

69. The method of claim 58, wherein, The culture medium is a basic culture medium containing serum.

70. The method of claim 58, wherein, The culture medium is RPMI-1640 medium containing serum.

71. The method of claim 58, wherein, The culture time is 3-4 days.

72. The method of claim 58, wherein, The culture time is 4 days.

73. The method of claim 53, wherein, In step (c), the cell product from step (b) is brought into contact with the test reagent in the presence of feeder cells.

74. The method of claim 73, wherein, The feeder cells express CD40L and BAFF (B cell activating factor).

75. The method of claim 73, wherein, The feeder cells were selected from fibroblasts expressing CD40L and BAFF.

76. The method of claim 73, wherein, The feeder cells were obtained by culturing NIH-3T3 cells that exogenously expressed CD40L and BAFF.

77. The method of claim 53, wherein, Step (c) includes culturing the cell products of step (b) in a culture medium.

78. The method of claim 77, wherein, The culture medium is a basic culture medium containing serum.

79. The method of claim 77, wherein, The culture medium is RPMI-1640 medium containing serum.

80. The method of claim 77, wherein, The culture time is at least 24 hours.

81. The method of claim 77, wherein, The culture time is at least 36 hours.

82. The method of claim 77, wherein, The culture time is at least 40 hours.

83. The method of claim 77, wherein, The culture time is at least 44 hours.

84. The method of claim 77, wherein, The culture time is at least 48 hours.

85. The method of claim 53, wherein, The method also includes determining the effect of the test agent on the formation of memory B cells based on the expression level of ZFP318.

86. The method of claim 85, wherein, The effects include inhibiting or promoting the formation of memory B cells.

87. The method of claim 53, wherein, The expression level of ZFP318 refers to either the expression level of ZFP318 protein or the expression level of ZFP318 mRNA.

88. The method of claim 53, wherein, The expression level of ZFP318 was obtained by directly detecting the content of ZFP318 protein or ZFP318 mRNA.

89. The method of claim 53, wherein, The naive B cells provided in step (a) are modified to contain a reporter gene that can indicate ZFP318 expression.

90. The method of claim 89, wherein, The expression level of the reporter gene is consistent with, or positively or negatively correlated with, the expression level of ZFP318.

91. The method of claim 89, wherein, The modified naive B cells contain a modified endogenous ZFP318 locus in their genome, which contains a reporter gene.

92. The method of claim 89, wherein, The reporter gene is located in the same expression cassette as ZFP318.

93. The method of claim 89, wherein, The reporter gene and ZFP318 are transcribed through the same promoter.

94. The method of claim 89, wherein, The expression level of ZFP318 was indirectly obtained by detecting the expression level of the reporter gene.

95. The method of claim 89, wherein, The expression level of the reporter gene is obtained by detecting the content of its protein product or mRNA product, or the activity of its product, thereby indirectly obtaining the expression level of ZFP318.

96. The method of claim 95, wherein, The activity of the reporter gene product is determined by the product's fluorescence signal or enzyme activity.

97. The method of claim 53, wherein, The expression level of ZFP318 is the expression level of ZFP318-iso1, or the expression level of ZFP318 is the total expression level of ZFP318-iso1 and ZFP318-iso2.

98. A kit containing IL-9 and IL-4, and reagents for detecting ZFP318 expression levels in cells. The reagent capable of detecting the expression level of ZFP318 in cells is an antibody that specifically binds to the ZFP318 protein or a primer and / or probe that specifically binds to ZFP318 mRNA or its cDNA.

99. The kit of claim 98, wherein, The expression level of ZFP318 is the expression level of ZFP318-iso1, or the expression level of ZFP318 is the total expression level of ZFP318-iso1 and ZFP318-iso2.

100. The kit of claim 98, wherein, The ZFP318 protein is ZFP318-iso1 protein and / or ZFP318-iso2 protein.

101. The kit of claim 98, wherein, The ZFP318 mRNA is ZFP318-iso1 mRNA and / or ZFP318-iso2 mRNA.

102. The kit of claim 98, wherein, The kit further includes a basal culture medium containing serum.

103. The kit of claim 98, wherein, The kit further includes RPMI-1640 medium containing serum.

104. Use of the kit according to any one of claims 98-103 for in vitro induction of memory B cells or screening for agents that promote the formation of memory B cells.

Citation Information

Patent Citations

  • Method for culturing memory b cell

    JP2010263825A