A marker LincRNA ROFA related to yak follicle atresia and granulosa cell apoptosis and application thereof

Abstract

The application discloses a marker LincRNAROFA related to yak follicle atresia and granulosa cell apoptosis and an application thereof, and belongs to the technical field of livestock molecular marker preparation. The marker LincRNAROFA related to yak follicle atresia and granulosa cell apoptosis disclosed by the application is highly expressed in healthy yak follicles and is lowly expressed in atretic follicles. The LincRNAROMT can be used as a molecular marker related to yak reproductive traits and has important practical application value in genetic assisted breeding.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of livestock molecular marker preparation, and more particularly to a marker LincRNAROFA related to yak follicle atresia and granulosa cell apoptosis and an application thereof. BACKGROUND

[0002] Livestock and poultry reproductive trait improvement is an important research direction of animal genetic breeding work. Yak (Bos grunniens) has a gestation period of 250-260 days and has a reproductive capacity of one calf per year; however, the actual reproductive level of yak is generally one calf per two years or two calves per three years. In recent years, with the increasing demand of consumers for yak meat, it is urgent to improve the reproductive rate of yak and increase the production of yak meat. Follicle is an important reproductive cell for female reproduction. During follicle development, only a small part of follicles can mature, and most follicles become atretic follicles. The formation of atretic follicles is mainly related to the apoptosis of follicular granulosa cells. Therefore, in the process of yak reproduction, at the level of follicle development, it is of great significance to analyze the relationship between healthy follicles and atretic follicles, find genes related to the normal development of yak follicles into mature follicles, and control the mechanism to improve the reproductive rate of yak.

[0003] In recent years, analyzing the overall characteristics of the expression pattern of yak reproduction-related traits at the whole genome level is one of the important research directions of yak breeding work. Long non-coding RNA (lncRNA) is a transcript with a length of more than 200 bp and cannot encode proteins, and was previously called "transcription noise" and ignored. In recent years, researchers have found that some lncRNAs play an important role in cell proliferation, differentiation, apoptosis, inflammation, immune response, and tumor occurrence, and some lncRNAs affecting yak follicular granulosa cell proliferation have been screened and determined in the process of yak follicle development.

[0004] Therefore, providing a marker LincRNAROFA related to yak follicle atresia and granulosa cell apoptosis and an application thereof is a problem to be solved by those skilled in the art. SUMMARY

[0005] Therefore, the present application provides a marker LincRNAROFA related to yak follicle atresia and granulosa cell apoptosis and an application thereof.

[0006] The application screens the molecular markers related to yak follicle atresia by high-throughput lncRNA sequencing of healthy yak follicles and atretic follicles, and preliminarily selects the lncRNA with extremely significant low expression in atretic follicles through bioinformatics differential expression analysis, and the lncRNA is named Long Intergenic Non-Protein Coding RNA, Regulator of Follicular Atresia (LincRNAROFA). The application also discloses a detection method for detecting the molecular marker, and has important practical application value.

[0007] In order to achieve the above-mentioned purpose, the application adopts the following technical scheme:

[0008] A marker LincRNAROFA related to yak follicle atresia and granulosa cell apoptosis, the sequence of which is shown as SEQ ID NO. 1.

[0009] Further, the LincRNAROFA is highly expressed in healthy yak follicles and lowly expressed in atretic follicles.

[0010] The LincRNAROFA is closely related to yak follicle atresia, and is applied to the assisted genetic selection process of yak breeding.

[0011] Further, the application of overexpressing LincRNAROFA in reducing granulosa cell apoptosis, the sequence of the LincRNAROFA being shown as SEQ ID NO. 1.

[0012] Further, the application of overexpressing LincRNAROFA in improving in vitro maturation of oocytes, the sequence of the LincRNAROFA being shown as SEQ ID NO. 1.

[0013] Further, a detection primer of the marker LincRNAROFA, the primer sequence being as follows:

[0014] An upstream primer: 5'-CACCAACACAGGAGCGTCTGCGT-3'; SEQ ID NO. 2;

[0015] A downstream primer: 5'-GAGCGGTGGTGTCGTTTCCCTTAAC-3'; SEQ ID NO. 3.

[0016] Further, the application of the marker LincRNAROFA or the detection primer in genetic marker assisted breeding and improving yak reproductive traits.

[0017] Further, the marker LincRNA ROFA or the detection primer is applied to the preparation of a kit for genetic marker assisted breeding and improvement of reproductive traits of yaks.

[0018] Further, a kit for detecting the marker LincRNA ROFA contains the primer.

[0019] When detecting the marker LincRNA ROFA by using the fluorescent quantitative PCR method, the SYBR Green fluorescent dye method can be used.

[0020] The kit contains reverse transcription reagents, specific primers, internal reference primers and SYBR Green fluorescent quantitative PCR reaction solution for the marker LincRNA ROFA.

[0021] The kit is applied to the quantitative detection of LincRNA ROFA in yak ovaries.

[0022] The kit is suitable for all types of fluorescent quantitative gene amplification instruments currently existing in the market, has high sensitivity, and is fast, accurate and stable in quantification, and has good application prospect.

[0023] Further, a method for detecting the marker LincRNA ROFA comprises the following steps:

[0024] (1) extracting total RNA of yak follicle tissue;

[0025] (2) reverse transcribing the total RNA into cDNA;

[0026] (3) amplifying and detecting the cDNA obtained in step (2) on a fluorescent real-time quantitative PCR instrument;

[0027] (4) performing relative quantification by melting curve analysis, 2 -ΔΔCt method.

[0028] According to the above technical solution, compared with the prior art, the present application provides a marker LincRNA ROFA related to yak follicle atresia and granulosa cell apoptosis and its application, and the significantly differentially expressed lncRNA screened by the present application is LincRNA ROFA. LincRNA ROFA is highly expressed in healthy yak follicles and lowly expressed in atretic follicles; LincRNA ROFA can be used as a molecular marker related to yak reproductive traits, and has important practical application value in genetic assisted breeding. BRIEF DESCRIPTION OF DRAWINGS

[0029] In order to make the technical solutions in the embodiments of the present application or the prior art clearer, the accompanying drawings needed in the embodiments or prior art description will be briefly introduced below. Obviously, the accompanying drawings in the following description only represent some of the embodiments of the present application, and all other embodiments obtained by a person of ordinary skill in the art without any creative effort on the basis of the provided accompanying drawings also belong to the protection scope of the present application.

[0030] Figure 1 The figure is a healthy follicle and a closed follicle;

[0031] Among them, A: healthy follicle; B: closed follicle;

[0032] Figure 2 The figure is the relative expression amount of LincRNA ROFA in the yak ovary detected by the fluorescent quantitative PCR of the present application;

[0033] Figure 3 The figure is the overexpression efficiency of the overexpression of LincRNA ROFA;

[0034] Figure 4 The figure is the knockdown efficiency of the knockdown of LincRNA ROFA;

[0035] Figure 5 The figure is that the overexpression of LincRNA ROFA inhibits the apoptosis of yak follicular granulosa cells;

[0036] Figure 6 The figure is that the knockdown of LincRNA ROFA promotes the apoptosis of yak follicular granulosa cells;

[0037] Figure 7 The figure is the influence of the knockdown and overexpression of LincRNA ROFA on follicle maturation. DETAILED DESCRIPTION

[0038] The technical solutions in the embodiments of the present application will be described clearly and completely below in combination with the accompanying drawings in the embodiments of the present application. Obviously, the described embodiments only represent some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by a person of ordinary skill in the art without any creative effort also belong to the protection scope of the present application.

[0039] Example 1 High-throughput lncRNA-seq sequencing analysis of different yak healthy and closed follicles

[0040] 1) Select yak healthy follicles and closed follicles as research objects, and send to a sequencing company for lncRNA sequencing with dry ice.

[0041] 2) The quality of sequencing data was evaluated by FastQC (http: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / ) software, including the distribution of base quality value, the distribution of quality value position, GC content, PCR duplication content, etc.

[0042] 3) After high-throughput sequencing, the total reads of three samples of healthy follicles were 124,722,298, 124,846,624 and 124,795,930, respectively, and the total reads of three samples of atretic follicles were 124,431,340, 124,432,710 and 122,165,182, respectively. The number of reads met the needs of the experiment.

[0043] 4) The lncRNA-seq sequencing data was analyzed by lncRNA identification, and the internationally recognized algorithms CPC (http: / / cpc.cbi.pku.edu.cn / ), CNCI (https: / / github.com / www-bioinfo-org / CNCI) and PfamScan (http: / / pfam.xfam.org / ) were used.

[0044] 5) The internationally recognized algorithm Cuffdiff (http: / / cole-trapnell-lab.github.io / cufflinks / cuffdiff / ) was used for differential screening, and through analysis, the differentially expressed LincRNA ROFA was finally selected, the sequence was SEQ ID NO. 1, and LincRNA ROFA was extremely significantly highly expressed in healthy follicles of yak.

[0045] GACACTCAGCTAAGAGCATCGAGGGGGCGCCGAGAGGCAAGGGGCGGGGACGGGCGGCGGCGGCGAAACGGGCAACGGATCGGGACCGCGGCGGGCCCGGAAGCGAGACACACCAGGGCGCGGCCCCGGGAGGCAGCAGACGGCGAGCGGACTGAGGCGGACGGACAGACGGAGAGGAGCACCGACGGGGTGCGGCCACGCGAGGCCAACGCCACGGAACAGGGGCGGTGTTGGTGGGGCGGCCGCGCGCCACCGCGAGGGGCATGGCTCAAAGCGACCCGTGCTGGGGCAGGGGGAAGCGCGAGTCGGCCGCCAGGGCCCACCGCGG

[0046] GATCTCACCGCCGGAGGCCTCCCAGCACAGGGACGGTCCCACCGCACGCCCGGGAC

[0047] GACGGACTGGCGCCCCCCCGGCACCCTCACGGGGGCTCACGCCCACCGCCACCAAC

[0048] ACACACCCGAGAGCCGCAAGCCGGCCAGGGAGAACGCTCTCCCGCCGCGCACCGGC

[0049] GGCCCCCACGTCCCCCACACGCGCAAAGCTCCCCGCGCGCCGCCCCGCCTCGGGGA

[0050] CGCCACCGGCCGACGGAGGCCGGGGGACGACACCCACATGAGGCGAGGCCGGCTC

[0051] GGCCCCAGACAGGGGAAGGGAGCGCGGGGCGGTCGCACGCGCGGGACGAGGAGGA

[0052] GAGGCCGGCAGCGGCGGGGAGGGGCCGGCAAGCACGCACGGCGGGGGCCGCGGGA

[0053] CAGGGCCGCGGGCGCCATCCGGGGACCACAAAGACACCGGGAACACGGCCGGGCC

[0054] ACCAGGAAAACCAGCGCGGGGTCCCACCGCCACCCACACACGAGGGCGGTCCCGCG

[0055] ACACGCCTGGGACGCCGACCGGTCCCGGCCAGCCCCAGAGCGGGCCCCCACGACCC

[0056] GGCCCCGCCGCCAGGGCCGGCGAGCCGCCCAAACCCATCTTCCGCCATCCGTCCTCG

[0057] ACAGATCCGTCTTCCGATCTAAGTCTGCCACCCCGAGGCTCGACATCCTGGGGATCA

[0058] CGCTCTCGAGCGAGGCGGCCCCGACCGCGACCGCACGCCGCCACCGGCTGCGGCTC

[0059] GTGGGGAGAGGGCGGGCGCGATAGGCTCTCCCGCACCACGGCTGCGGGGCTGGGGA

[0060] AGCCGGGGCCGACCGGACGTCGCGCCCCCAACACCTTCCCCCCTTTGCCCCAAGGCT

[0061] CACCACACCGCGGGGGCCGACCGCGCGCACACGCGGCGCACGCACGCTCCGGTCCC

[0062] CCCCACCTGCCGGACGCCCGGCGGGGCCCAGCGGGACCCTCCCCCAACTCGAAGCG

[0063] GGGAGGCGCGGGCCGCGGTAGGCAACGAGCGGCACACGGCCCCACCGCGGGGCCG

[0064] GCGCACCCGCCCCCCACCGCCCCCAGAGGGGAGGTGGGGGGCGGGGTGTTCTGCCC

[0065] ACGCGCTCTTGGCAGCCGCCACGGCGGCCACTGCGCACGCAGGAGGGGCAGCAGCT

[0066] GGGGGGTCCGATACCCCAAGGCTCCCTCTCGGATCGCTAGAGAAGGCTTTCTCACCG

[0067] AGGGCTCGCCGCCCCTCACCCGGATCGTCTCTCTCCTTCGGGCCCACGGAGGCGCTC

[0068] CACGAGCCACCAGTCCTCAGCTGGGGTGGGAGGGGTCTGCGGTACAGGTAGGCGGA

[0069] G CACCAACACAGGAGCGTCTGCGT GGCCGGGGCCAGCGCAGAGCCCGCGTCCCGTC

[0070] CCCTGCAAGGCCTCACCCGTCAGCCTCGACGACGAGGGGAACAGGCACGCCTCTCC

[0071] TACCGCCTCGACCCCCCCCAAAAGAGAGCCCACTCACGGGACACACACACACCACC

[0072] GCGGTGGGGACCCGAGGAGGACACCGGG GTTAAGGGAAACGACACCACCGCTC GG

[0073] CCTCAGGCACCTGAGCGACGACCTGGAGCGCTCCAGGGGCACCACCGAGGGTCCAA

[0074] CGAGGCACGCTCGCGCACCCGCGCGGGGGGGGGCGCAGCGCAGCAGCGGTACAGC

[0075] CCTCCCCACCGCGGGGAGGGCCGCTCGCGGAGCACACGCCGGGAAGGCGAAGCGA

[0076] GAGCATCTGCTGTGTCAGAAGACCCACGGCCCCCACCGACGCCCCCCGAGGCGGGG

[0077] GACAGGAGACCGAAGGTCAGGGCCAGAGGCCGCAACCCAGCCCCCGCCTTCCTCCC

[0078] CCTCCCCGACGGCCAGGGGGGAAAAGTCAGGCGAGGGGCCCCGCGGACAGACCGA

[0079] GAAGAGCAGACACGTTCACCGGGAACACCTGTCCCTCGTCTGGCACGGCTTAGGCC

[0080] CGGCCCGGGAGAGCACGACCACACCACATCGATCGGATGAGCCAAGGTGGAGCGG

[0081] GGGGAAGGCACGGCGAGGACAGTCACCAGAGGGGCCCGCTTTAAGCCTCACCGGCA

[0082] ACCTCCGCCCCCCACCTCGCCTCAGGCGAGAGCGGCCCACGACCCAGGAGGTTCG

[0083] AGAACGCCTGACACGTGGCACGGAGCCCACAGGGCGGGGGTCGCATCTCAGCCTTC

[0084] ACCGGGTGCCCGCAGCGGGGAGCGCACAGGGTAGAAGACCCACGGCGCCTCGCCCC

[0085] GCCGCCCTCGGGTCGCCCAGAGACCGGAGGTGGCACCACGAGTCGGGTCAGCCAGA

[0086] SEQ ID NO.1

[0087] Example 2: Detection of LincRNA ROFA expression in healthy and atretic follicle tissues of yak using quantitative real-time PCR.

[0088] 1) Reagents:

[0089] Reverse transcription kit: PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time), #RR047Q, Takara;

[0090] Quantitative PCR reagents: Fast qPCR Mix, #RR430A, Takara.

[0091] 2) Relevant experimental materials were treated with RNase:

[0092] (1) Before use, all glassware should be rinsed and soaked in DEPC, pressure-treated at 120℃ for 20 minutes, and then dried at 180℃ for more than 2 hours.

[0093] (2) Before using plastic containers (such as EP tubes / gun tips), soak them in 0.1% DEPC water overnight, then drain the liquid, pressurize at 120℃ for 20 minutes, and bake them in an oven until dry.

[0094] 3) Total RNA extraction:

[0095] Twenty-five healthy follicle tissues and twenty-five atretic follicle tissues were selected Figure 1 The TRIzol method was used according to the Invitrogen kit instructions, and the specific steps were as follows:

[0096] (1) The follicle tissue sample was placed in a mortar pre-cooled in liquid nitrogen, and liquid nitrogen was added to grind it into powder rapidly;

[0097] (2) When there were no obvious particles, the powdered tissue was transferred to a 1.5 mL centrifuge tube;

[0098] (3) 1 mL of Trizol was added, and it was shaken vigorously and incubated at room temperature for 10 min to completely lyse the cells;

[0099] (4) 200 μL of chloroform was added, and it was shaken up and down vigorously for 90 s and incubated on ice for 5 min;

[0100] (5) Centrifugation was performed at 12,000 r / min for 15 min at 4°C, and the supernatant was transferred to another new 1.5 mL centrifuge tube;

[0101] (6) An equal volume of isopropanol was added, mixed, and precipitated for 10 min;

[0102] (7) Centrifugation was performed at 12,000 r / min for 10 min at 4°C, and the supernatant was discarded;

[0103] (8) The precipitate was washed twice with 75% ethanol, and it was naturally dried at room temperature for 5 min;

[0104] (9) 50 μL of DNase I mixed solution was added, and it was dissolved at 75°C for 5 min and stored at -80°C for standby.

[0105] The integrity of total RNA was preliminarily detected by 1.2% agarose gel electrophoresis; the quality and solubility of total RNA were further detected by Agilent 2100 (Agilent Technologies, Santa Clara, CA, USA), and 1 μL of sample was denatured at 70°C for 2 min and then subjected to Agilent 2100 detection.

[0106] 4) cDNA synthesis and quality detection

[0107] (1) Total RNA detection qualified immediately after the synthesis of cDNA, reverse transcription using Dalian Bao biological company's reverse transcription kit (PrimeScript RT reagent Kit with gDNA Eraser), first in 0.2 mL PCR tube preparation of genomic reaction system, the total reaction system is 10 μL: 5 x gDNA Eraser Buffer 2 μL, gDNA Erase 1 μL, total RNA 1000 ng, RNase-free dH2O to 10 μL. Then 42℃ for 2 minutes.

[0108] (2) In the above reaction liquid in turn 5 x PrimeScript Buffer 4 μL, PrimeScript RT Enzyme Mix I 1 μL, primer 0.5 μL, and RNase-free dH2O 4.5 μL, a total of 10 μL. 37℃ reaction 30 minutes, 85℃ reaction 15 seconds stop. Then add 190 μL RNase free dH2O dilution to 200 μL stored at 20℃, for subsequent test.

[0109] 5) Quantitative analysis

[0110] (1) This test uses Dalian Bao biological company Fast qPCR Mix reagent for real-time quantitative PCR analysis.

[0111] Each sample set 3 times, each pair of primers set 3 negative controls. With GAPDH as the internal reference gene, the reaction system is 25 μL, as follows:

[0112] 2 x SYBR Premix Ex Taq II 12.5 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, cDNA 1.5 μL, RNase-free ddH2O up to 25 μL.

[0113] Among them, the specific primer for LincRNA ROFA includes upstream primer and downstream primer, and the specific primer sequence is as follows:

[0114] Upstream primer: 5'-CACCAACACAGGAGCGTCTGCGT-3'; SEQ ID NO. 2;

[0115] Downstream primer: 5'-GAGCGGTGGTGTCGTTTCCCTTAAC-3'; SEQ ID NO. 3.

[0116] The upstream primer and downstream primer sequence of GAPDH internal reference gene is as follows:

[0117] GAPDH-F: 5'-CTGCCGCCTGGAGAAACCT-3'; SEQ ID NO. 4;

[0118] GAPDH-R: 5'-GCTGTAGCCAAATTCATTGTCG-3'; SEQ ID NO. 5.

[0119] (2) Real-time quantitative PCR reaction conditions: first 95 °C pre-denaturation for 30 seconds; 40 cycles, each cycle 95 °C denaturation for 5 seconds, 60 °C annealing for 30 seconds; after the end of the cycle, record the melting curve in the range of 65-95 °C.

[0120] (3) The gene expression abundance is expressed by 2 -ΔΔCt The relative expression results of LincRNA ROFA in healthy follicles and atretic follicles of yak are shown in Figure 2 According to Figure 2 It can be known that the expression amount of LincRNA ROFA in healthy follicles is significantly higher than that in atretic follicles, and can be used for the identification of different follicles and genetic marker assisted breeding.

[0121] Example 3 Construction of LincRNA ROFA overexpression vector and synthesis of siRNA

[0122] The upstream and downstream primers were designed at both ends of the LincRNA ROFA sequence, and the target gene fragment was amplified by ApexHF HSDNA Polymerase FSMasterMix (AG12202, Accurate Biotechnology, China). After successfully amplifying the full-length sequence of LincRNA ROFA, the amplification product was constructed into the pcDNA3.1 vector (Invitrogen Corporation, Carlsbad, CA, USA) overexpression vector by using homologous recombinase (TSV-S2, Gengke Biology, China), and sequencing verification was performed.

[0123] Among them, the amplification primers for LincRNA ROFA include upstream primers and downstream primers, and the specific primer sequences are as follows:

[0124] Upstream primer: 5'-GACACTCAGCTAAGAGCATCGAGGG-3'; SEQ ID NO. 6;

[0125] Downstream primer: 5'-GTACGCGGGGCTCTGGGCCTTCGGG-3'; SEQ ID NO. 7.

[0126] siRNA was synthesized by Guangzhou Ruibo Company, and the specific sequence was as follows:

[0127] 5'-GAUCCGUCUUCCGAUCUAAGU-3'; SEQ ID NO. 8;

[0128] 5'-UUAGAUCGGAAGACGGAUCUG-3'; SEQ ID NO. 9.

[0129] Example 4: Detection of overexpression and knockdown efficiency of LincRNA ROFA

[0130] One pair of siRNA (interference group) targeting LincRNA ROFA and LincRNA ROFA overexpression vector were transfected into in vitro cultured ovarian granulosa cells using lip3000 (ThermoFisher) transfection reagent instructions, and the granulosa cells were collected after 48h of continuous culture. The knockdown and overexpression efficiency of LincRNA ROFA was detected according to the method of Example 2, and the results are shown in Figure 3 and Figure 4 It was found that the overexpression vector and siRNA successfully overexpressed and knocked down LincRNA ROFA (P<0.05).

[0131] Example 5: Analysis of apoptosis and in vitro maturation rate of oocytes

[0132] One pair of siRNA (interference group) targeting LincRNA ROFA, siRNA-NC (5'-GCGACGAUCUGCCUAAGAUdTdT-3'; SEQ ID NO. 10; 5'-AUCUUAGGCAGAUCGUCGCdTdT-3'; SEQ ID NO. 11), LincRNA ROFA overexpression vector and Control (pcDNA3.1) were transfected into in vitro cultured ovarian granulosa cells using lip3000 (ThermoFisher) transfection reagent, and the granulosa cell RNA was collected after 48h of continuous culture. The apoptosis level of in vitro cultured pig ovarian granulosa cells was detected using Annexin V FITC / PI kit (Vazyme Company), and the results are shown in Figure 5 and Figure 6 It was found that overexpression of LincRNA ROFA could significantly reduce the apoptosis rate of in vitro cultured yak ovarian granulosa cells (P<0.05).

[0133] The effect of LincRNA ROFA on the maturation rate of oocytes in the cumulus-oocyte complex cultured in vitro was detected by the first polar body discharge rate, and the results are shown in Figure 7It was found that overexpression of LincRNAROFA significantly improved the in vitro maturation rate of porcine oocytes, while knockdown of LincRNAROFA had the opposite effect (P<0.05).

[0134] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A marker LincRNA ROFA associated with yak follicle atresia and ovarian granulosa cell apoptosis, characterized in that, The sequence is shown as SEQ ID NO.

1.

2. Use of overexpression of LincRNA ROFA in reducing apoptosis of in vitro cultured yak ovarian granulosa cells, characterized in that, The sequence of the LincRNA ROFA is shown as SEQ ID NO.

1.

3. Application of overexpression of LincRNA ROFA in improving in vitro maturation of yak oocytes, characterized in that, The sequence of the LincRNA ROFA is shown as SEQ ID NO.

1.

4. A detection primer of the marker LincRNA ROFA according to claim 1, characterized in that, The primer sequences are as follows: Upstream primer: 5'-CACCAACACAGGAGCGTCTGCGT-3'; SEQ ID NO. 2; Downstream primer: 5'-GAGCGGTGGTGTCGTTTCCCTTAAC-3'; SEQ ID NO.

3.

5. The marker LincRNA ROFA of claim 1 or the detection primer of claim 4 is applied to detect yak follicle atresia without the purpose of disease diagnosis and treatment.

6. The marker LincRNA ROFA of claim 1 or the detection primer of claim 4 is applied to prepare a kit for detecting yak follicle atresia.

7. A kit for detecting the marker LincRNA ROFA according to claim 1, characterized by, The kit contains the primer of claim 4.

8. A method of detecting the marker LincRNA ROFA of claim 1, characterized by, The kit comprises the following steps: (1) extracting total RNA of yak follicle tissue; (2) reverse transcribing the total RNA into cDNA; (3) amplifying and detecting the cDNA obtained in step (2) on a fluorescent real-time quantitative PCR instrument; (4) By solubility curve analysis, 2 -ΔΔCt relative quantification was performed.

Images