A KASP marker related to soybean pod length and its application

Abstract

The invention discloses a KASP marker related to soybean pod length and its application, belonging to the field of molecular genetic breeding. The nucleotide sequence of the KASP marker is shown in SEQ ID NO: 1, and there is an A / G base mutation at the 21 bp. The invention identifies a SNP site S04_372771 (A / G) significantly associated with the appearance quality trait of soybean pod length, develops a KASP marker for the significantly associated SNP and performs genotyping, the sample genotyping effect is obvious, and the pod length of vegetable soybean can be predicted sensitively, efficiently and at low cost, which is beneficial to the screening and cultivation of vegetable soybean varieties with longer pod length, assists soybean functional molecular breeding, and further shortens the breeding process.

Description

Technical Field

[0001] The invention relates to the field of molecular genetic breeding, in particular to a KASP marker related to soybean pod length and an application thereof. Background Art

[0002] China has a long history of growing vegetable soybeans. In the past decade or so, it has gradually become the world's major exporter of vegetable soybeans. Generally, the international market classifies the quality traits of vegetable soybeans into four types: appearance quality, sanitary quality, nutritional quality, and edible quality. Among them, nutritional quality and edible quality directly affect the price of commodities, and the most critical is that appearance quality and sanitary quality directly control the specification level of vegetable soybean commodities (Zhang Yumei et al., 2013). Appearance quality is one of the important aspects of commodity quality, that is, the size and color of fresh pods that consumers can directly see, usually including fresh pod size, fresh pod color, and number of grains per pod. At present, the soybean industry is declining, and the demand for vegetable soybeans at home and abroad is increasing. The potential benefits of growing vegetable soybeans are 2 to 4 times higher than those of ordinary soybeans. The development of vegetable soybeans is one of the important breakthroughs in the soybean industry. Vegetable soybeans are green pod consumer agricultural products. Appearance quality is crucial to product characteristics, directly affecting consumers' purchasing decisions, and is also an important factor in improving farmers' bargaining power in field transactions (He Zibin et al., 2023). Therefore, appearance quality is the focus of quality research and improvement of edible soybeans, and breeding edible soybean germplasm resources with excellent appearance quality has become one of the important goals of soybean molecular breeding research.

[0003] Quantitative trait locus (QTL) refers to the gene locus on the chromosome that can control the quantitative trait. Through linkage analysis of molecular markers and phenotypic data of quantitative traits, the gene loci that regulate quantitative traits can be located, that is, QTL location. Single nucleotide polymorphism (SNP) refers to the polymorphism of DNA sequences at the gene level due to single nucleotide variations, such as deletion, insertion and conversion. As the third-generation molecular genetic marker, SNP marker plays an important role in genetic diversity and genetic improvement. It has the advantages of good stability, easy genotyping, no environmental restrictions, shortened breeding time, high-throughput selection, etc., and can better assist the development of molecular breeding (Wainschtein et al., 2022). Genome wide association analysis (GWAS) is based on the principle of linkage disequilibrium (LD). It conducts association analysis by studying the detected phenotypic data and the genotypic information obtained by population resequencing, and uses statistical principles to detect the association between the two. According to the significant P value, it accurately locates the high-density SNP sites that may affect the phenotypic data and mines the genes related to the phenotype (Qian et al., 2017). At present, genome wide association analysis has made certain progress in the molecular genetic breeding of vegetable soybeans. Soluble total sugar also has an important influence on the umami taste of vegetable soybeans. Through genome wide association analysis of the total soluble sugar content of 264 soybean germplasm resources in the R6 period, a total of 27 SNPs significantly associated with soluble total sugar were identified on Chr.05, 06, 13, and 14, explaining 8.70% to 18.77% of the phenotypic variation (XU et al., 2022). Zhang Hongmei et al. used 264 soybean germplasm resources to determine the contents of arginine, alanine, glutamate and aspartic acid related to the edible quality of edible soybeans in 2020 and 2021, and conducted a whole-genome association analysis. A total of 89 SNPs significantly correlated with the content of four amino acids in edible soybeans were detected in two years, of which 5 markers could be detected simultaneously by 2 years or 2 traits. A single site can explain 11.25% to 28.19% of the phenotypic variation (Zhang Hongmei et al., 2023).At present, the international market has an increasing demand for vegetable soybeans, and the yield requirements are high. Li Xiangnan used 224 micro-core germplasm resources and 1514 high-quality SNPs to conduct genome-wide association analysis on the yield-related traits of vegetable soybeans, such as 100-grain fresh weight, 100-grain dry weight, kernel yield, number of grains per pod, and fresh grain moisture content, in 2015 and 2016. A total of 27, 18, 24, 46, and 20 significantly associated SNPs were detected, of which two SNPs were new loci discovered in this study, and the remaining loci were located with QTLs related to previously reported yield and quality traits, and 15 potential candidate genes related to yield traits were identified through candidate gene analysis (Li Xiangnan et al., 2018). In short, with the continuous advancement of research, genome-wide association analysis will provide a rich theoretical basis for genetic research and improved breeding of vegetable soybeans. However, to date, there are few GWAS studies on the appearance quality of vegetable soybeans, and SNPs and candidate genes related to the appearance quality of vegetable soybeans need to be discovered.

[0004] Competitive allele-specific PCR (KASP) technology can accurately determine the biallelicity of SNPs and InDels at specific sites in a wide range of genomic DNA samples. It has the characteristics of high stability, high accuracy and low cost. It is currently widely used in crop resource identification, genetic breeding and other aspects (Semagn et al, 2014). Summary of the invention

[0005] The purpose of the present invention is to provide a KASP marker related to soybean pod length and its application to solve the problems existing in the above-mentioned prior art. The KASP marker developed by the present invention can sensitively, efficiently and low-costly predict the pod length of edible soybeans, laying an important foundation for improving the appearance quality traits of edible soybeans.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The invention provides a KASP marker related to soybean pod length. The nucleotide sequence of the KASP marker is shown as SEQ ID NO:1.

[0008] Furthermore, there is an A / G base mutation at the 21 bp of the KASP marker.

[0009] The present invention also provides a primer set for detecting the KASP marker, the primer set comprising a forward primer F1, a forward primer F2 and a reverse primer R;

[0010] The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO: 4; the nucleotide sequence of the forward primer F2 is shown in SEQ ID NO: 5; and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO: 6.

[0011] The present invention also provides a reagent or a kit for detecting the KASP marker, comprising the primer set.

[0012] The present invention also provides the use of the KASP marker, the primer set or the reagent or kit in any of the following:

[0013] (1) Detect soybean pod length;

[0014] (2) screening for long-pod and long-soybean varieties or lines;

[0015] (3) Breeding germplasm to improve soybean pod length;

[0016] (4) Soybean molecular marker-assisted breeding;

[0017] (5) Improvement of soybean germplasm resources.

[0018] The present invention also provides a method for detecting the length of soybean pods, comprising the following steps:

[0019] The genomic DNA of the soybean sample to be tested is used as a template, and the template is amplified by fluorescent quantitative PCR using the primer set or the reagent or the kit, and the length of the soybean pod is determined according to the amplification result.

[0020] Furthermore, if the amplification result shows that the genotype of the KASP marker is GG, the pod length of the soybean sample to be tested is judged to be long; if the amplification result shows that the genotype of the KASP marker is AA, the pod length of the soybean sample to be tested is judged to be short.

[0021] Furthermore, the program of the fluorescent quantitative PCR amplification is: pre-denaturation at 94°C for 15 minutes; denaturation at 94°C for 20 seconds, gradient annealing / extension at 61-55°C for 1 minute, decreasing 0.6°C in each cycle, 10 cycles; denaturation at 94°C for 20 seconds, annealing / extension at 55°C for 1 minute, 10 cycles.

[0022] Furthermore, the fluorescent quantitative PCR amplification system is: 4 μL of DNA template, 5 μL of 2×KASP Master mix, 0.14 μL of primer mixture KASP Assay Mix, and 2.0 μL of ddH2O.

[0023] Furthermore, the soybeans include vegetable soybeans.

[0024] The present invention discloses the following technical effects:

[0025] The present invention uses 264 vegetable soybean germplasm resources as test objects, and uses a vegetable soybean phenotypic identification and analysis system to identify the pod length appearance quality-related traits of vegetable soybeans in R6 stage in Nanjing, Huai'an and Nantong. The results show that the variation range of vegetable soybean appearance quality traits is 5.94% to 30.00%. A total of 24 germplasms with excellent appearance quality traits were screened out in the three regions. According to the phenotypic data of vegetable soybean appearance quality traits, a whole genome association analysis was performed in combination with a mixed linear model (MLM), and a SNP site S04_372771 (A / G) significantly associated with the pod length appearance quality trait was identified. The present invention develops KASP markers for significantly associated SNPs and performs genotyping, and the sample genotyping effect is obvious. The pod length of vegetable soybeans can be predicted sensitively, efficiently and at low cost, which is conducive to screening and cultivating vegetable soybean varieties with longer pod lengths, assisting soybean functional molecular breeding, and further shortening the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0027] Figure 1 Comparison of the length, width and color of bean pods in different regions; A, B, C are the comparison of the length, width and color of bean pods in Nanjing, Nantong and Huai'an respectively (*P<0.05, **P<0.01, ***P<0.001);

[0028] Figure 2 The frequency distribution diagram of the appearance quality-related traits of vegetable soybeans in Nanjing, Nantong and Huai'an; A, B and C are the frequency distribution diagrams of pod length, pod width and pod color in Nanjing; D, E and F are the frequency distribution diagrams of pod length, pod width and pod color in Nantong; G, H and I are the frequency distribution diagrams of pod length, pod width and pod color in Huai'an;

[0029] Figure 3 The Manhattan plot and QQ plot of the whole genome association analysis results of soybean pod length in R6 stage; A, B, and C are the Manhattan plots of the whole genome association analysis results of soybean pod length in Nanjing, Nantong, and Huai'an respectively; the red line indicates the significance threshold (-log 10 (P) = 5.0); D, E and F are QQ plots of the genome-wide association analysis results of soybean pod length in Nanjing, Nantong and Huai'an, respectively;

[0030] Figure 4The Manhattan plot and QQ plot of the whole genome association analysis results of soybean pod width in R6 stage; A, B, and C are the Manhattan plots of the whole genome association analysis results of soybean pod width in Nanjing, Nantong, and Huai'an respectively; the red line indicates the significance threshold (-log 10 (P) = 5.0); D, E and F are QQ plots of the genome-wide association analysis results of soybean pod width in Nanjing, Nantong and Huai'an, respectively;

[0031] Figure 5 The Manhattan plot and QQ plot of the whole genome association analysis results of soybean pod color in R6 stage; A, B, and C are the Manhattan plots of the whole genome association analysis results of soybean pod color in Nanjing, Nantong, and Huai'an respectively; the red line indicates the significance threshold (-log 10 (P) = 5.0); D, E and F are QQ plots of the genome-wide association analysis results of soybean pod color in Nanjing, Nantong and Huai'an, respectively;

[0032] Figure 6 This is the significant SNP haplotype analysis of the appearance quality-related traits of natural vegetable soybean population; A is SNP site S04_372771 (A / G); B is S18_51477324 (C / T); C is SNP site S18_55553200 (G / T); *P<0.05, **P<0.01, ***P<0.001;

[0033] Figure 7 The KASP marker is used to genotype different soybean germplasm SNPs; from left to right are the soybean pod length genotyping map, soybean pod width genotyping map, and soybean pod color genotyping map. DETAILED DESCRIPTION

[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0035] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0036] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0037] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0038] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0039] Example 1

[0040] The present invention provides a SNP site S04_372771 (A / G) significantly associated with soybean pod length, and then develops a corresponding KASP marker. It is found that at the S04_372771 site, the fresh pods of soybean germplasm with a genotype of GG are significantly longer than those of soybean germplasm with a genotype of AA; the S04_372771 site is at the 21st base of the nucleotide sequence shown in SEQ ID NO: 1;

[0041] SEQ ID NO: 1:

[0042] AATGTTCTTGGACCTGCAGTACAAATAAAAATAGTTAGTGAACGAAGTTACTTTGGAACGACGTGCTTAT.

[0043] The present invention also provides a SNP site S18_51477324 (C / T) significantly associated with soybean pod width, and then develops a corresponding KASP marker, and finds that at the S18_51477324 site, the fresh pods of soybean germplasm with a genotype of TT are significantly wider than those of soybean germplasm with a genotype of CC; the S18_51477324 site is at the 20th base of the nucleotide sequence shown in SEQ ID NO: 2;

[0044] SEQ ID NO: 2:

[0045] CTAAGCGTATCTGCCTCGCTTAACGAGATATCAACTACTTGAATCTTCTCTTCTTTTGGCTTGAAGCTGAAGTGGTT.

[0046] The present invention also provides a SNP site S18_55553200 (G / T) significantly associated with soybean pod color, and then develops a corresponding KASP marker, and finds that at the S18_55553200 site, the fresh pod color of soybean germplasm with a genotype of GG is closer to the standard pod color than that of soybean germplasm with a genotype of TT; the S18_55553200 site is at the 20th base of the nucleotide sequence shown in SEQ ID NO: 3;

[0047] SEQ ID NO: 3:

[0048] GTGAGCATGCATGCTGTCAGCATTCAATAGAGTTATTTAATTTCACGTATAAATATCC AATGTTTTTTAATTGGTTTGCTTTTATCTAAACAAATTTATAATTATAATGTTTTAAGGGAA A.

[0049] Note: The shaded marks in the above sequences are the mutated base sites.

[0050] The above molecular markers are specifically obtained according to the following method:

[0051] 1. Materials and Methods

[0052] 1. Selection of group materials

[0053] This study selected 264 representative vegetable soybean germplasm resources, including 52 local species and 212 cultivated species (the same applicant's prior patent "CN116590458B A KASP marker related to soybean glycine and its application" used in 264 soybean germplasm resources), all provided by the soybean research group of the Institute of Economic Crops of Jiangsu Academy of Agricultural Sciences. The soybean materials used in this study were planted in Nanjing Liuhe Experimental Base of Jiangsu Academy of Agricultural Sciences (Nanjing), Jiangsu Yanjiang Agricultural Science Institute Experimental Base (Nantong City, Jiangsu Province), and Huai'an Academy of Agricultural Sciences Experimental Base in 2023. A randomized block design was adopted with 3 replications. Each vegetable soybean germplasm material was planted in 3 ridges, 10 holes per ridge, and 2 seedlings per hole. According to the local conventional field management methods, reasonable fertilization and watering were carried out, and weeding and insecticides were carried out regularly.

[0054] 2. Fresh pod image acquisition and preprocessing

[0055] When the test materials grew to the R6 stage, 3 plants were randomly selected from each material, and 5 fresh pods were randomly selected from each plant. The fresh pod images were collected using the HIK industrial camera, and the images were imported into the vegetable soybean phenotypic identification and analysis system to identify the three vegetable soybean appearance quality traits of pod length, pod width, and pod color. Since the image may be distorted by scaling, rotation, etc., the calculation of the fresh pod phenotypic shape will cause errors. Therefore, it is necessary to pre-process the fresh pod image to correct the distortion of the fresh pod image, so as to lay a good foundation for the accurate analysis and calculation of the fresh pod phenotypic traits.

[0056] Assume that the original image of fresh pods is f(x, y), which is changed to g(x′, y′) due to geometric distortion. The coordinates of the pixels before and after the distortion satisfy the following relationship:

[0057]

[0058] By obtaining the analytical expressions h1(x, y) and h2(x, y), an inverse transformation is performed, and the corresponding position (x, y) in the original fresh pod image is found through the point (x′, y′) in the distorted fresh pod image, thereby correcting the geometric distortion of the fresh pod image.

[0059] Assume that the geometric distortion varies linearly, as shown in the following equation:

[0060]

[0061] By using the position coordinates of the known constraint points in the correction template before and after the image deformation, the following linear mapping equations are established and the coefficients are solved to achieve image geometric distortion correction and restore the original spatial relationship of the image:

[0062]

[0063] Fresh pod image data is easily disturbed by the external environment and contains noise. After continuous iterative calculations, errors will occur in the measurement of fresh pod phenotypic parameters. In order to improve the accuracy of fresh pod phenotypic trait determination, a bilateral filtering algorithm is used to filter out noise. The image output by the filtering algorithm is g(x, y). The calculation formula of the bilateral filtering algorithm is as follows:

[0064]

[0065] Where (x, y) is the current processing point, (i, j) is the point in the vicinity of (x, y); w(x, y, i, j) is the weighting coefficient, which comprehensively considers the distance and pixel difference between the two points, as shown in the following formula:

[0066]

[0067] According to the above formula, in the bilateral filtering algorithm, the weight coefficient corresponding to the pixels farther away from the edge is minimized to ensure that the clarity of the pixel value on the edge of the fresh pod is not affected. The output result of the bilateral filtering is affected by the parameter σ d and σ r The choice of σ directly affects d , σ r When the value is small, the image will hardly have a smoothing effect. The control of spatial proximity determines the number of pixels contained in the filter window: as it increases, the influence of distant pixels on the central pixel increases, thereby improving the smoothness of the image. r As σ increases, the effect of controlling grayscale proximity also increases. r When increases, the gray scale difference increases, which will cause the pixel point to have a greater influence on the center point. When the gray scale difference is greater than a certain threshold, the pixel point will not participate in the calculation, thereby preserving the gray scale information of the edge of the image.

[0068] Represents the edge strength of an image at the position (x, y), the magnitude of its directional gradient vector is represented by g(x, y), and the direction is represented by θ(x, y), as shown in the following formula:

[0069]

[0070]

[0071]

[0072] grad(f) can be used to obtain the first-order partial derivatives of the function in the X-axis and Y-axis directions, which represents the gradient at any (x, y) position. The sum of the absolute values ​​of the first-order partial derivatives of the function in the X-axis and Y-axis directions can represent the magnitude of the gradient.

[0073] 3. Measurement of phenotypic parameters of vegetable soybean

[0074] After obtaining the complete segmented fresh pod image, the conversion relationship between the image coordinate system and the real coordinate system can be obtained through the proportional calculation method. First, the segmented fresh pod image contour is calibrated with the minimum circumscribed moment, and then the length and width of the minimum circumscribed moment are calculated. Then, the proportional calculation method is used to convert it into the Euclidean distance to obtain the actual size of the pod in the real coordinate system. The calculation formula is as follows:

[0075]

[0076]

[0077] Where U represents the object size calculation ratio, K a Represents the pixel length of the object, K βRepresents the real length of the object. D represents the Euclidean distance between the points (x2, y2) and (x1, y1).

[0078] After preprocessing the collected fresh pod images, this study then obtained the maximum width of the fresh pod, i.e., the pod width, by finding and calculating the diameter of the maximum inscribed circle of the fresh pod outline. The formula for defining the coordinates of the center of the maximum inscribed circle of the fresh pod outline is as follows:

[0079]

[0080]

[0081]

[0082] S represents the area of ​​the closed contour of the boundary, M represents the horizontal coordinate of the center of the circle, N represents the vertical coordinate of the center of the circle, x i Represents the horizontal coordinate of a point on the closed contour of the boundary, y i is the ordinate of a point on the closed boundary contour. After determining the center of the maximum inscribed circle, the radius of the maximum inscribed circle can be obtained by calculating the distance from each point on the closed boundary contour to the center, thereby obtaining the pod width of the vegetable soybean. The calculation formula for the maximum inscribed circle radius is as follows:

[0083]

[0084] D=2R

[0085] The maximum inscribed circle radius of the fresh pod is R, and the horizontal coordinate of the closed contour is x. i , the ordinate of the closed contour is y i , the horizontal coordinate of the center of the circle is m, the vertical coordinate is n, and the width of the fresh pod is D.

[0086] 4. Fresh pod color similarity matching

[0087] Pod color is the most external expression of the freshness of fresh pods. The fresher the fresh pods, the greener the pods. Aged or diseased pods appear black or yellow. The freshness of the pods can be quickly classified by matching the similarity of fresh pod colors. The color similarity matching algorithm divides the fresh pod image into three color channels, RGB, and calculates their respective histograms. The histogram of the real fresh pod image is numerically matched with the histogram of the reference sample, and finally the matching results of the three color channels are averaged. The one with the highest average matching degree means that the pod color gradient is most similar to the color of the real fresh pod image.

[0088] The fresh pod color gradient division method in this study was referenced (Zhang Xiaobin, Xie Baoliang, Zhu Yihang, Zheng Kefeng, Gu Qing. High-throughput phenotypic acquisition and analysis of edible soybean pods based on image processing technology [J]. Journal of Nuclear Agricultural Sciences, 2022, 36(03): 602-612.), and the final matching results of the fresh pod color to be tested and the pod color of the reference sample were scored and quantified, where 1 point was the standard fresh pod color, and the smaller the score, the closer the pod color was to the standard fresh pod color.

[0089] 5. Genome-wide association analysis

[0090] Our research group previously resequenced 283 soybean germplasms (including 19 wild materials). The average sequencing depth was 12.4×, and a total of 10210329 SNP markers were obtained from this sequencing. This study used 264 soybean materials (52 local varieties and 212 improved varieties) for target trait identification and genome-wide association analysis (Zhang W, Xu W, Zhang H, et al. Comparative selective signature analysis and high-resolution GWAS reveal a new candidate gene controlling seed weight in soybean [J]. Theoretical and Applied Genetics, 2021, 134 (5): 1329-1341.). The 'GAPIT' package of R software was used to calculate the genome-wide association analysis of pod length, pod width, and pod color in the R6 stage of vegetable soybean, and a mixed linear model (MLM) was used for genome-wide association analysis to control false positive association sites.

[0091] 6. Primer design for KASP labeling

[0092] Using the Primer-BLAST function in NCBI (https: / / www.ncbi.nlm.nih.gov / ), primers were designed for SNP sites S04_372771, S18_51477324, and S18_55553200 that were significantly associated with the appearance quality-related traits of natural vegetable soybean populations. Each SNP site had three primers, including two specific forward primers F1 and forward primer F2 and a universal reverse primer R. F1 contained a FAM fluorescent linker sequence, and F2 contained a HEX fluorescent linker sequence (underlined). The designed primers were sent to Qingke Biotechnology (Nanjing) for synthesis. The primer sequences are shown in Table 1:

[0093] Table 1 Specific primers for KASP labeling

[0094]

[0095]

[0096] 7. KASP labeling reaction amplification system

[0097] The KASP-labeled amplification system includes: 4 μL of soybean sample DNA template (50 ng / μL), 5 μL of 2×KASP Master mix, 0.14 μL of primer mixture KASP Assay Mix (F1:F2:R=2:2:5), and 2.0 μL of ddH2O.

[0098] The amplification program of KASP-PCR is as follows: pre-denaturation at 94℃ for 15min; denaturation at 94℃ for 20s, gradient annealing / extension at 61-55℃ for 1min, decreasing 0.6℃ in each cycle, 10 cycles; denaturation at 94℃ for 20s, annealing / extension at 55℃ for 1min, 10 cycles. After the reaction is completed, the QuantStudio5 real-time fluorescence quantitative PCR instrument directly reads the fluorescence data of the PCR reaction product.

[0099] 2. Results and Analysis

[0100] 1. Descriptive statistical analysis of appearance quality traits of vegetable soybeans

[0101] In this study, fresh pods of vegetable soybeans harvested in Nanjing, Nantong and Huai'an in 2023 were used for the investigation experiment of appearance quality traits. Four appearance quality traits, namely pod length, pod width and pod color of vegetable soybeans, were statistically analyzed. Descriptive statistical analysis was performed on the three basic indicators of 264 vegetable soybean germplasms (Table 2) and box plots were drawn ( Figure 1 ). The variation analysis of the three appearance quality traits of vegetable soybean germplasm showed that the coefficient of variation of the main appearance quality traits of the selected 264 materials ranged from 5.94% to 30.00%, with rich genetic diversity. The rich variation helps to better locate the genetic loci related to appearance quality traits. The pod length ranged from 2.82 to 7.62 cm, with an average of 4.27 cm, the pod width ranged from 1.29 to 2.53 cm, with an average of 1.77 cm, and the pod color ranged from 1.47 points to 7 points, with an average of 3.60 points. The coefficient of variation of appearance quality traits at the Nanjing test site ranged from 5.94% to 27.40%, the coefficient of variation of appearance quality traits at the Nantong test site ranged from 8.56% to 19.57%, and the coefficient of variation of appearance quality traits at the Huai'an test site ranged from 9.10% to 30.00%. Overall, the coefficient of variation of appearance quality traits in Huai'an was greater than that in Nanjing and Nantong, indicating that the environment has a certain impact on the variation of appearance quality traits of edible soybeans.

[0102] Table 2 Descriptive statistics of three related traits of fresh pod appearance quality of vegetable soybean in R6

[0103]

[0104]

[0105] 2. ANOVA

[0106] In this study, a one-year multi-point method was used to conduct variance analysis on the fresh pod appearance quality traits of the natural population of vegetable soybeans in the R6 stage in 2023 (Table 3). The results showed that the appearance quality-related traits of the R6 stage were significantly different among the genotypes, between different environments, and in the interaction effect between genotype and environment, indicating that the appearance quality traits of vegetable soybeans of different genotypes were significantly different and were affected by environmental factors and changed with environmental changes. Therefore, it is feasible and effective to use genetic variation to screen out genotypes with different appearance quality traits in the natural population of vegetable soybeans. At the same time, the screening results will also be affected by environmental factors. Since the appearance quality-related traits are quantitative traits controlled by multiple genes, multi-year multi-point experiments can be carried out to screen out stable high-quality appearance quality vegetable soybean germplasm.

[0107] Table 3 Analysis of variance of appearance quality-related traits of vegetable soybean at R6 stage

[0108]

[0109] 3. Frequency distribution analysis of appearance quality traits of vegetable soybeans

[0110] The frequencies of pod length, pod width and pod color of 264 vegetable soybean germplasms in Nanjing, Nantong and Huai'an were calculated using Microsoft Excel 2016, and the frequency distribution diagram and density curve were drawn ( Figure 2 ), the histograms of the phenotypic data all showed characteristics of approximate normal distribution, indicating that the natural population of vegetable soybean in this study has rich genetic variation and is suitable for subsequent whole-genome association analysis.

[0111] 4. Genome-wide association analysis of pod length, pod width and pod color

[0112] In this study, we combined the phenotypic results of pod length, pod width, and pod color of edible soybean with the genotypic data obtained by sequencing and used a mixed linear model (MLM) to perform genome-wide association analysis using the 'GAPIT' package in R. 10 When (P)≥5, the marker is considered to be significantly associated with the trait. Manhattan plots and QQ plots were drawn using the 'CMplot' package of R language ( Figure 3 , Figure 4 and Figure 5). The horizontal axis of the Manhattan plot represents the chromosome position, and the vertical axis represents -log 10 (P). The P value is used to measure the statistical significance of the association, -log 10 The larger the (P) value, the more significant the association. 10 Theoretical value of the conversion, the vertical axis represents the -log 10 The actual P value of the conversion, when the ordinate is closer to the abscissa, can reflect to a certain extent that the selected model can effectively control the influence of population structure and kinship on the analysis results.

[0113] In 2023, a total of 461 SNP loci significantly associated with the appearance quality traits of vegetable soybeans in R6 were detected in the three regions (-log 10 (P) ≥ 5), and the SNP loci S04_372771, S18_51477324, and S18_55553200 were identified as being significantly associated with the three appearance quality traits of pod length, pod width, and pod color. The significant association loci of the appearance quality traits of the R6 stage are shown in Tables 4 to 6.

[0114] Table 4 Loci significantly associated with pod length in natural populations of vegetable soybean in three regions

[0115]

[0116] Table 5 Loci significantly associated with pod width in natural populations of vegetable soybean in three regions

[0117]

[0118]

[0119] Table 6 Loci significantly associated with pod color in natural populations of vegetable soybean in three regions

[0120]

[0121] 5. Haplotype analysis

[0122] In order to study the phenotypic effects of allele variation at the most significantly associated SNP loci, haplotype analysis of different genotypes was performed on the SNP loci S04_372771 (A / G), S18_51477324 (C / T), and S18_55553200 (G / T) that were significantly associated with the three appearance quality traits of vegetable soybean fresh pod length, pod width, and pod color. It was found that at the significant association locus S04_372771 for vegetable soybean pod length, the fresh pod length of vegetable soybeans with genotype GG was longer than that of genotype AA; at the significant association locus S18_51477324 for pod width, the fresh pod width of vegetable soybeans with genotype TT was wider than that of genotype CC; at the significant association locus S18_55553200 for pod color, the fresh pod color of vegetable soybeans with genotype GG was closer to the standard pod color than that of genotype TT ( Figure 6 ).

[0123] 6. Application of KASP Mark

[0124] First, the extracted soybean genomic DNA was used as a template, and the corresponding primers F1, F2, and R (as shown in Table 1) designed for the above-mentioned sites were used to perform PCR amplification in the QuantStudio5 real-time fluorescence quantitative PCR instrument, and the generated fluorescence data was directly read after the reaction was completed. In this study, KASP markers were used to amplify and genotype 20, 15, and 22 vegetable soybeans (soybean germplasm with known appearance quality-related traits, as shown in Table 7) on the QuantStudio5 real-time fluorescence quantitative PCR instrument. The results are shown in Figure 7 As shown, the three molecular marker primers can clearly distinguish the two genotypes.

[0125] Table 7 Appearance quality-related traits and genotyping results of multiple soybean germplasms

[0126]

[0127] The KASP marker was designed for the SNP site S04_372771, which is significantly associated with the length of vegetable soybean pods. The two genotypes can be clearly distinguished. There are two different colored dots in the figure. The red dots close to the X-axis are relatively clustered, representing vegetable soybean germplasm carrying the G allele variation, whose fresh pods are relatively long, while the blue dots represent vegetable soybean germplasm carrying the A allele variation site close to the Y-axis, and the fresh pods are shorter. The fresh pods of soybean germplasm with genotype GG are longer than those of vegetable soybean germplasm with genotype AA.

[0128] The SNP site S18_51477324 significantly associated with vegetable soybean pod width was used to design KASP markers, which can clearly distinguish the two genotypes. There are two different colored dots in the figure. The red dots close to the X-axis are relatively clustered, representing vegetable soybean germplasm carrying the T allele variation, and its fresh pods are relatively wide, while the blue dots represent vegetable soybean germplasm carrying the C allele variation site close to the Y-axis, and the fresh pods are narrow. The fresh pods of soybean germplasm with genotype TT are wider than those of vegetable soybean germplasm with genotype CC.

[0129] The KASP marker was designed for the SNP site S18_55553200, which is significantly associated with the pod color of vegetable soybeans. The two genotypes can be clearly distinguished. There are two different colored dots in the figure. The blue dots close to the Y axis are relatively clustered, representing vegetable soybean germplasm carrying the G allele variation, whose fresh pod color is closer to the standard pod color, while the red dots represent vegetable soybean germplasm carrying the T allele variation site close to the X axis, whose pod color is far from the standard pod color. The pod color of vegetable soybean germplasm with genotype GG is closer to the standard than that of vegetable soybean germplasm with TT.

[0130] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A KASP marker associated with soybean pod length, characterized in that: The nucleotide sequence of the KASP marker is shown in SEQ ID NO: 1, or, as shown in the nucleotide sequence shown in SEQ ID NO: 1 where the 21st base is mutated to G.

2. A primer set for detecting the KASP marker according to claim 1, characterized in that: The primer set comprises a forward primer F1, a forward primer F2 and a reverse primer R; The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO: 4; the nucleotide sequence of the forward primer F2 is shown in SEQ ID NO: 5; and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO:

6.

3. A reagent or kit for detecting the KASP marker according to claim 1, characterized in that: Comprising the primer set of claim 2.

4. Use of the KASP marker according to claim 1, the primer set according to claim 2, or the reagent or kit according to claim 3 in any of the following: (1) Detect soybean pod length; (2) Screening for long-pod and long-soybean varieties or lines; (3) Germplasm breeding to improve soybean pod length.

5. A method for detecting the length of soybean pods, characterized in that: The steps include: The genomic DNA of the soybean sample to be tested is used as a template, and the template is amplified by fluorescent quantitative PCR using the primer set described in claim 2 or the reagent or kit described in claim 3, and the length of the soybean pod is determined according to the amplification result.

6. The method according to claim 5, characterized in that If the amplification result shows that the genotype at the 21st base of the KASP marker of claim 1 is GG, the pod length of the soybean sample to be tested is judged to be long; if the amplification result shows that the genotype at the 21st base of the KASP marker of claim 1 is AA, the pod length of the soybean sample to be tested is judged to be short.

7. The method according to claim 5, characterized in that The program of the fluorescent quantitative PCR amplification is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, gradient annealing / extension at 61-55°C for 1 min, decreasing 0.6°C in each cycle, 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 1 min, 10 cycles.

8. The method according to claim 5, characterized in that The fluorescent quantitative PCR amplification system is: 4 µL of DNA template, 5 µL of 2×KASP Master mix, 0.14 µL of primer mixture KASP Assay Mix, and 2.0 µL of ddH2O.

9. The method according to claim 5, characterized in that The soybeans include vegetable soybeans.

Images